Reagents and methods for detecting monoclonal antibody drugs and anti-monoclonal antibody drug antibodies

Abstract

The present invention relates to blood drug concentration detection, and in particular to reagents and methods for detecting monoclonal antibody drugs and anti-monoclonal antibody drug antibodies. The reagents for detecting monoclonal antibody drugs and anti-monoclonal antibody drug antibodies include C reagents and D reagents, wherein the C reagent includes mouse anti-F(ab)2 monoclonal antibody-1 coupled luminescent markers and mouse anti-F(ab)2 monoclonal antibody-2 coupled biotin; the D reagent includes macromolecular monoclonal antibody drug coupled luminescent markers and F(ab)2 coupled biotin; mouse anti-F(ab)2 monoclonal antibody-1 coupled luminescent markers and macromolecular monoclonal antibody drug coupled luminescent markers are mouse anti-F(ab)2 monoclonal antibody-1 and macromolecular monoclonal antibody drugs labeled with luminescent markers. The present invention can realize the simultaneous detection of monoclonal antibody drugs and their anti-drug antibodies in one sample, with fewer reaction steps and shorter reaction time.

Description

Technical Field

[0001] The present invention relates to blood drug concentration detection, and in particular to a reagent and method for detecting monoclonal antibody drugs and anti-monoclonal antibody drug antibodies. Background Art

[0002] Macromolecular monoclonal antibody drugs, also known as macromolecular monoclonal antibody drugs (mAb), are a class of protein drugs prepared by bioengineering technology with high specificity and affinity. They are derived from monoclonal antibody technology, through a specific immune process, stimulating B lymphocytes under laboratory conditions to produce antibodies targeting only a single antigen epitope, and then using cell culture technology to mass produce such antibodies, and then through purification and other processes to prepare drugs.

[0003] This type of drug is characterized by a large molecular weight (about 150 kDa) and a complex structure, with two heavy chains and two light chains connected by disulfide bonds to form a "Y"-shaped structure. This structure enables monoclonal antibodies to accurately recognize and bind to specific target molecules, such as receptors on cell membranes, signaling molecules within cells, or pathogens outside cells.

[0004] Large molecule monoclonal antibody drugs have clear targets and specific mechanisms of action, and have better safety and efficacy. However, they may also be recognized as foreign bodies by the human immune system, thus inducing adverse immune responses. One of the main manifestations is the production of anti-drug antibodies (ADAs). ADA can interact with mAb, affecting its pharmacokinetic and pharmacodynamic properties and reducing its efficacy. On the one hand, if ADA is directed to the antigen binding site, the mAb-ADA complex will not be biologically active, resulting in changes in the pharmacodynamic properties of mAb; on the other hand, the size and composition of the immune complex formed between mAb and ADA are different, which accelerates the liver and spleen to capture them and activate the immune system and stimulate drug clearance. For these reasons, ADAs can cause primary or secondary drug resistance and affect the therapeutic effect.

[0005] Prior art CN 111024958 B discloses a dissociation solution for detecting monoclonal antibody drugs and anti-monoclonal antibody drug antibodies at different times, wherein the dissociation solution is a glycine buffer or an acetic acid-sodium acetate buffer with a pH of 2-3, 8-10 mM, containing a volume fraction of 0.05%-0.1% Tween-20, 10-15 μg / mL mouse IgG and / or 10-15 μg / mL human IgG. This invention can solve the problems of strong background signal and low signal-to-noise ratio of existing acid dissociation reagents. However, the prior art requires pre-treatment means such as dissociation and neutralization, which makes it impossible to directly detect monoclonal antibody drugs and their ADA on an automated platform, but requires pre-treatment operations. However, the pre-treatment method has many disadvantages, such as acidic or alkaline substances that affect the structure or spatial conformation of antibodies or antigens, thereby affecting the sensitivity of detection.

[0006] Prior art CN114740195A discloses an ADA instant detection test strip and kit for adalimumab, but the patent does not disclose any information on drug tolerance and target tolerance.

[0007] Prior art CN106164670A discloses an assay for detecting the presence or amount of anti-drug antibodies, which requires complex operating steps and overnight precipitation, is not conducive to automation, has low throughput and high cost, and cannot meet the extensive and rapid clinical needs.

[0008] Prior art CN 118792260 A provides a hybridoma cell line TNA1-6C3, a monoclonal antibody, a kit and an application. The hybridoma cell line (Mus musculus) TNA1-6C3 is deposited in the General Microbiology Center of the China Microbiological Culture Collection Administration, with a deposit number of CGMCC NO.46006. The monoclonal antibody TNA1-6C3 produced by the hybridoma cell line TNA1-6C3 in the invention can achieve efficient monitoring of anti-adalimumab antibody, with strong anti-interference ability, high specificity, high sensitivity, simple and fast, and high degree of automation. However, the prior art uses a fusion protein to express the Fab structure, because the Fab structure has poor labeling ability and can only be expressed in the form of a fusion protein. Therefore, the method of the prior art is not very versatile.

[0009] At present, the technology for quantitative detection of macromolecular monoclonal antibodies (mAb) and anti-drug antibodies (ADAs) has the following difficulties:

[0010] (1) The antibodies in the two detection reagents can react with each other, and joint detection cannot be achieved in one reaction.

[0011] (2) Reagent compartment limitation, that is, the number of reagents is greater than the number of reagent compartments, resulting in the carrier being unable to carry two sets of reagents.

[0012] (3) Mass spectrometry has always been a commonly used technical means for monitoring therapeutic drugs, but due to its hardware limitations, it cannot detect large molecules.

[0013] Therefore, there is no technology or product on the market that can simultaneously perform quantitative detection of large molecule monoclonal antibody drugs (mAb) and anti-drug antibodies (ADAs), which is a market gap. Summary of the invention

[0014] The purpose of the present invention is to provide a reagent for quantitatively detecting macromolecular monoclonal antibodies (mAb) and anti-drug antibodies (ADAs) at the same time and its application.

[0015] In order to achieve the above object, the present invention adopts the following technical solution:

[0016] Reagents for detecting monoclonal antibody drugs and anti-monoclonal antibody drug antibodies include C reagent and D reagent, wherein the C reagent includes mouse anti-F(ab)2 monoclonal antibody-1 coupled with a luminescent marker and mouse anti-F(ab)2 monoclonal antibody-2 coupled with biotin; and the D reagent includes a macromolecular monoclonal antibody drug coupled with a luminescent marker and F(ab)2 coupled with biotin;

[0017] Mouse anti-F(ab)2 monoclonal antibody-1 coupled luminescent marker and macromolecular monoclonal antibody drug coupled luminescent marker is mouse anti-F(ab)2 monoclonal antibody-1 and macromolecular monoclonal antibody drug labeled with luminescent marker;

[0018] Mouse anti-F(ab)2 monoclonal antibody-2 conjugated with biotin or F(ab)2 conjugated with biotin is mouse anti-F(ab)2 monoclonal antibody-2 and F(ab)2 conjugated with biotin;

[0019] Mouse anti-F(ab)2 monoclonal antibody-1 and mouse anti-F(ab)2 monoclonal antibody-2 are prepared by introducing F(ab)2 into mice to prepare F(ab)2 immune mice, fusing spleen cells of F(ab)2 immune mice with SP / 20 cells, screening out two monoclonal cell lines that can stably secrete anti-F(ab)2 monoclonal antibody-1 and anti-F(ab)2 monoclonal antibody-2, and obtaining them through secretion of the cell lines; the mouse anti-F(ab)2 monoclonal antibody-1 and mouse anti-F(ab)2 monoclonal antibody-2 can simultaneously specifically bind to F(ab)2 to form an antibody-antigen-antibody sandwich structure.

[0020] F(ab)2 is produced by digestion of the whole IgG antibody by pepsin (structure such as Figure 7 F(ab)2 is a bivalent antibody with a molecular weight of approximately 110 kDa and has two antigen-binding F(ab) portions linked together by a disulfide bond.

[0021] In a preferred embodiment, the luminescent marker is any one of acridinium ester, luminol and isoluminol.

[0022] In one preferred embodiment, the preparation process of mouse anti-F(ab)2 monoclonal antibody-1 coupled to a luminescent marker or a macromolecular monoclonal antibody drug coupled to a luminescent marker comprises the following steps:

[0023] S1. Antibody activation: Use labeling buffer to prepare mouse anti-F(ab)2 monoclonal antibody-1 or macromolecular monoclonal antibody drug into a solution with a concentration of 0.2-0.5mL / mL and let it stand;

[0024] S2, coupling the activated antibody and the luminescent marker at a volume ratio of 15-25:1 at room temperature in the dark for 0.5-1.5 hours; purifying to obtain a mouse anti-F(ab)2 monoclonal antibody-1 coupled luminescent marker or a macromolecular monoclonal antibody drug coupled luminescent marker;

[0025] The concentration of the luminescent marker was 0.2-0.5 mg / mL.

[0026] Unless otherwise specified, the room temperature in the present invention is 15-25°C.

[0027] In one preferred embodiment, the labeling buffer comprises, by weight: 2-4 parts of KH2PO4, 25-39 parts of Na2HPO4·12H2O, 60-100 parts of NaCl, 2-4 parts of KCl and 780-820 parts of ultrapure water.

[0028] In one preferred embodiment, the luminescent marker is diluted with dimethylsilane to form a solution with a concentration of 0.2-0.5 mg / mL.

[0029] In a preferred embodiment, the purification is performed by gel column treatment.

[0030] In a preferred embodiment, the purification is as follows: a G-25 gel filtration chromatography column is selected, and at least three column volumes are balanced with a storage buffer at a flow rate of 1.0-2.0 mL / min.

[0031] In one preferred embodiment, the storage buffer comprises, by weight: 12-14 parts of NaH2PO4, 3-7 parts of Na2HPO4·12H2O, 0.1-0.2 parts of Tween and 780-820 parts of ultrapure water.

[0032] In a preferred embodiment, the biotin is any one of Biotin, Desthiobiotin, Silybin-biotin and Biotin-coumarin.

[0033] In one preferred embodiment, the preparation process of mouse anti-F(ab)2 monoclonal antibody-2 coupled to biotin or F(ab)2 coupled to biotin comprises the following steps:

[0034] The mouse anti-F(ab)2 monoclonal antibody-2 or F(ab)2 is prepared into a solution with a concentration of 0.3-0.7 mL / mL using a biotin labeling buffer; the biotin and antibody are reacted at room temperature for 0.5-1.5 hours according to a molar ratio of biotin to antibody of 15-25:1; and the solution is purified to obtain the mouse anti-F(ab)2 monoclonal antibody-2 coupled with luminescent biotin or F(ab)2 coupled with biotin.

[0035] In one preferred embodiment, the biotin labeling buffer comprises, by weight: 2-4 parts of KH2PO4, 25-35 parts of Na2HPO4·12H2O, 60-100 parts of NaCl, 2-4 parts of KCl and 780-820 parts of ultrapure water.

[0036] In a preferred embodiment, the purification is performed by dialysis.

[0037] In a preferred embodiment, the molecular weight of the dialyzed peptide is below 30 kD.

[0038] In one preferred embodiment, in the reagent, mouse anti-F(ab)2 monoclonal antibody-1 coupled with a luminescent marker and mouse anti-F(ab)2 monoclonal antibody-2 coupled with luminescent biotin are equal in amount, and macromolecular monoclonal antibody drug coupled with a luminescent marker and F(ab)2 coupled with biotin are equal in amount.

[0039] In a preferred embodiment, the macromolecular monoclonal antibody drug is any one of bevacizumab, trastuzumab, sindili, rituximab or infliximab.

[0040] There is a one-to-one correspondence between F(ab)2 and any one of bevacizumab, trastuzumab, sindilu, rituximab or infliximab. If it is bevacizumab, then F(ab)2 is the F(ab)2 of bevacizumab; if it is trastuzumab, then F(ab)2 is trastuzumab F(ab)2, that is, the test items are different and the F(ab)2 sequences are different.

[0041] In one preferred embodiment, the heavy chain gene sequence of bevacizumab F(ab)2 is shown as SEQ ID NO.1, and the light chain gene sequence of bevacizumab F(ab)2 is shown as SEQ ID NO.2.

[0042] In one preferred embodiment, the reagents for detecting monoclonal antibody drugs and anti-monoclonal antibody drug antibodies further include reagent A and reagent B; the reagent A is a streptavidin magnetic bead solution; and the reagent B is a sample diluent.

[0043] In one preferred embodiment, the streptavidin magnetic bead solution comprises streptavidin magnetic beads and a diluent.

[0044] In a preferred embodiment, the concentration of the streptavidin magnetic bead solution is 0.1-0.4 mg / mL.

[0045] In a preferred embodiment, the sample diluent includes a buffer, a protein, and a surfactant.

[0046] In a preferred embodiment, the buffer is one of phosphate buffer, tris(hydroxymethylaminomethane) buffer, citrate buffer, 4-morpholineethanesulfonic acid buffer and acetate buffer.

[0047] In a preferred embodiment, the protein is one of bovine serum albumin, horse serum albumin, casein and bovine collagen.

[0048] In one preferred embodiment, the surfactant is one or more of Tween-20, Triton-100, PEG2000-20000, and sodium dodecylbenzene sulfonate.

[0049] In one preferred embodiment, the sample diluent comprises, by weight, 1-3 parts of KH2PO4, 25-35 parts of Na2HPO4·12H2O, 60-100 parts of NaCl, 1-3 parts of KCl, 2-8 parts of bovine serum albumin, 0.5-3 parts of Tween-20, and 0.5-3 parts of antibacterial agent.

[0050] Based on the same inventive concept, the present invention also claims a method for detecting monoclonal antibody blood concentration and anti-drug antibody using luminescent double detection technology, comprising the following steps:

[0051] (1) Take 10 μL-20 μL of serum sample and dilute it with sample diluent at a ratio of 1:100-200;

[0052] (2) Take 20 μL-40 μL of the diluted sample and place it in two reaction containers. Add reagent C and reagent D to the two reaction containers respectively and incubate at 37±5℃ for 3-7 minutes.

[0053] (3) Add the streptavidin magnetic bead solution to reagent C and reagent D respectively, mix well, and react at 37±5℃ for 3-7 minutes;

[0054] (4) After washing the streptavidin magnetic beads, add the pre-excitation solution and the excitation solution to reagent C and reagent D, respectively, measure the luminescence value, and obtain the monoclonal antibody blood concentration and the anti-drug antibody concentration in the serum sample.

[0055] In one preferred embodiment, the pre-stimulation solution includes 0.10-0.20 M hydrochloric acid, 1.0-2.0 wt % urea peroxide, and the pH of the pre-stimulation solution is 1.0-3.0.

[0056] In one preferred embodiment, the stimulating solution includes 0.40-0.50 M sodium hydroxide, 2.0-3.0 wt % octaalkyltrimethylammonium chloride, and the pH of the stimulating solution is 11.3-13.3.

[0057] The detection method is performed entirely on an ultra-high-speed chemiluminescence instrument.

[0058] The core of the present invention is to develop a new type of luminescent double detection technology. The reagent can specifically identify macromolecular monoclonal antibody drugs and anti-drug antibodies at the same time, and produce strong luminescent signals under the excitation of the chemiluminescent system. By measuring the intensity of this luminescent signal, the concentration of macromolecular monoclonal antibody drugs and the corresponding anti-drug antibody concentration in the sample can be accurately calculated.

[0059] Compared with the prior art, the present invention has the following beneficial effects:

[0060] 1) The present invention adds reagent C and reagent D to a sample respectively. Reagent C contains a mouse anti-F(ab)2 antibody prepared by a recombinantly expressed F(ab)2 structure. The recombinantly expressed F(ab)2 structure is similar to its corresponding monoclonal antibody drug structure and can competitively bind to anti-drug antibodies (ADA) with monoclonal antibody drugs, displacing them from the structure bound to ADA, and then capturing them to complete the detection technology. By adding reagent C and reagent D to a sample respectively, the present invention can achieve simultaneous detection of monoclonal antibody drugs and their ADA under direct sample loading conditions, and achieve fully automated operation.

[0061] 2) The present invention prepares and synthesizes the F(ab)2 structure, which has strong labeling properties and does not need to be expressed in the form of a fusion protein. The F(ab)2 structure of the present invention has its unique advantages in IVD (in vitro diagnostic) detection relative to the Fab structure. The Fab structure has a small molecular weight of about 47-48 kDa, is a monovalent antibody fragment, and can only bind to one antigen binding site. The F(ab)2 structure of the present invention lacks the Fc region, but retains the hinge region, which connects the two antigen binding sites together through a disulfide bond. The F(ab)2 structure of the present invention is a bivalent antibody fragment, that is, it can bind to two antigen binding sites, and its molecular weight is about two-thirds of the entire IgG antibody, that is, about 100 kDa. The F(ab)2 structure of the present invention has better affinity and has two antigen binding sites. Compared with the Fab fragment with only one antigen binding site, it can form a stronger binding force with the antigen, thereby improving the sensitivity and accuracy of the detection. At the same time, the bivalent characteristics of the F(ab)2 structure of the present invention enable it to more effectively capture and bind to the target antigen, especially in the detection of low-concentration antigens, it shows a higher capture efficiency and improves the specificity of the detection.

[0062] 3) The present invention has fewer reaction steps and a shorter reaction time.

[0063] 4) The reagent of the present invention has broad application prospects. It can not only be used for monitoring clinical individualized rational drug use, but also provide strong technical support for drug development, drug efficacy evaluation, and drug metabolism dynamics research. Through the implementation of the present invention, the detection speed and accuracy of large-molecule monoclonal antibody drugs and corresponding anti-drug antibodies can be significantly improved, making an important contribution to the development of precision medicine.

[0064] In summary, the novel luminescent macromolecular monoclonal antibody drug and anti-drug antibody dual detection technology involved in the present invention is innovative, practical and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0065] Figure 1 is the antibody relationship network diagram;

[0066] Figure 2 is the antibody response network diagram;

[0067] Figure 3 An information diagram of chemical coupling between raw materials;

[0068] Figure 4 This is a schematic diagram of the technical solution for detecting large molecule monoclonal antibody drugs (mAb);

[0069] Figure 5 Schematic diagram of the anti-drug antibody (ADAs) detection scheme;

[0070] Figure 6is the detection system of the present invention;

[0071] Figure 7 It is a schematic diagram of the structure of F(ab)2 gene;

[0072] Figure 8 is the master curve of anti-bevacizumab antibody drug and monoclonal antibody drug detection reagent, where: Figure 8 A is the master curve of bevacizumab drug detection reagent, Figure 8 B is the master curve of the anti-bevacizumab antibody drug detection reagent;

[0073] Fig. 9 is the blank detection limit of bevacizumab drug and anti-bevacizumab antibody; Fig. 9 A is the detection limit of bevacizumab, Fig. 9 B is the detection limit of anti-bevacizumab antibody drug;

[0074] Fig.10 is the linear correlation diagram between bevacizumab drug and anti-bevacizumab antibody; wherein, Fig.10 A is the linear correlation of bevacizumab drug; Fig.10 B is the linear correlation of anti-bevacizumab antibody drug;

[0075] Fig.11 The figure is the recovery test result of bevacizumab drug and anti-bevacizumab antibody; Fig.11 A is the recovery test of bevacizumab drug, Fig.11 B is the anti-bevacizumab antibody drug recovery test. DETAILED DESCRIPTION

[0076] The present invention is not limited to the following specific embodiments. A person skilled in the art can implement the present invention in various other specific embodiments according to the contents disclosed in the present invention, or any simple changes or modifications made to the design structure and ideas of the present invention fall within the protection scope of the present invention. It should be noted that the embodiments and features in the embodiments of the present invention can be combined with each other without conflict. Unless otherwise specified, all percentages are weight ratios. Example 1

[0077] Preparation of Mouse Anti-F(ab)2 Monoclonal Antibody-1 and Mouse Anti-F(ab)2 Monoclonal Antibody-2

[0078] In this experiment, mice were immunized with F(ab)2, and mouse spleen cells were fused with SP / 20 cells to screen out two monoclonal cell lines that can stably secrete anti-F(ab)2 monoclonal antibodies C63 and 6F2. The obtained anti-F(ab)2 monoclonal antibodies C63 and 6F2 are mouse anti-F(ab)2 monoclonal antibody-1 and mouse anti-F(ab)2 monoclonal antibody-2, respectively.

[0079] The specific process is as follows:

[0080] 1. Test materials

[0081] SP / 20 cells (mouse myeloma cells) were purchased from Stemcell and SPF-grade BALB / c mice were purchased from the Experimental Animal Center of Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences.

[0082] (1) Main reagents

[0083] Freund's complete and incomplete adjuvant (Sigma);

[0084] Fetal bovine serum (FBS), Protein G antibody purification column (Beijing Quanshijin Biotechnology Co., Ltd.);

[0085] HAT medium supplement (50×), HT medium supplement (50×) (models: H0602 and H0137, Sigma);

[0086] TMB colorimetric solution, ELISA stop solution, and ascites-specific adjuvant (Biodragon);

[0087] Serum-free RPMI 1640 medium (Hyclone);

[0088] Serum-free RPMI 1640 medium was prepared by adding 20% ​​FBS to serum-free RPMI 1640 medium.

[0089] (2) Main instruments and equipment

[0090] ELISA plate washer (Beijing Liuyi Biotechnology Co., Ltd.);

[0091] CO2 cell culture incubator, constant temperature incubator and biological safety cabinet (Thermo Fisher Scientific, USA);

[0092] Fluorescence microscope (Ningbo Yongxin Optics Co., Ltd.);

[0093] Ordinary inverted microscope (Nikon Corporation, Japan);

[0094] Microplate reader (BioTek, USA).

[0095] (3) Preparation of main reagents

[0096] Balance buffer: 0.2 g / L KH2PO4, 2.9 g / L Na2HPO4·12H2O, 8 g / L NaCl, 0.2 g / L KCl to adjust pH = 7;

[0097] Neutralization solution: weigh 121 g Tris and dilute to 1 L ddH2O, adjust pH to 9 with hydrochloric acid;

[0098] Eluent: Weigh 3.84 g of citric acid, dilute to 1 L ddH2O, and adjust pH to 3 with alkali.

[0099] 2. Test methods

[0100] 2.1 Preparation of F(ab)2 monoclonal antibodies

[0101] (1) Animal immunization

[0102] Select three 6-8 week old female BALB / c mice and formulate the corresponding immunization program as follows:

[0103] Table 1 Immunity meter

[0104]

[0105] The first immunization was emulsified with 50 μg of bevacizumab F(ab)2 and an equal volume of Freund's complete adjuvant using a three-way device. After it formed an oil-in-water state, it was injected subcutaneously at multiple points on the back of the mouse. Immunization was performed every 2 weeks. Blood was collected from the eyeball before immunization to determine the serum titer. A total of three immunizations were performed. Blood was collected from the eye 7 days after the three immunizations for ELISA to determine the serum titer. The antibody titer was 1:10. 4 -1:10 7 Within the range, cell fusion can be performed 3 days after immune shock, and whole blood of mice can be collected as polyclonal antibodies.

[0106] The sequence of bevacizumab F(ab)2 is as follows:

[0107] The heavy chain gene sequence of F(ab)2 is shown in SEQ ID NO.1, and the light chain gene sequence of F(ab)2 is shown in SEQ ID NO.2;

[0108] SEQ ID NO.1:-VH-CH1

[0109] GAAGTGCAGCTGGTGGAGAGCGGAGGAGGACTGGTGCAGCCTGGAGGAAGTCTGAGACTGAGCTGCGCCGCTAGCGGATACACATTTACCAACTACGGCATGAACTGGGTGAGACAGGCTCCTGGCAAAGGACTGGAGTGGGTGGGATGGATTAACACCTATACAGGGGAGCCCACCTACGCCGCTGATTTTAAGCGGAGATTCACATTCAGCCTGGACACCAGCAAGAGCACAGCCTACCTGCAGATGAACAGCCTGAGAGCCGAGGACACCGCCGTGTATTATTGCGCCAAGTACCCCCACTACTACGGAAGCAGCCACTGGTACTTCGACGTGTGGGGCCAGGGAACCCTGGTGACAGTGAGTAGC

[0110] GCTAGCACCAAGGGCCCATCGGTCTTCCCCCTGGCACCCTCCTCCAAGAGCACCTCTGGGGGCACAGCGGCCCTGGGCTGCCTGGTCAAGGACTACTTCCCCGAACCGGTGACGGTGTCGTGGAACTCAGGCGCCCTGACCAGCGGCGTGCACACCTTCCCGGCTGTCCTACAGTCCTCAGGACTCTACTCCCTCAGCAGCGTGGTGACCGTGCCCTCCAGCAGCTTGGGCACCCAGACCTACATCTGCAACGTGAATCACAAGCCCAGCAACACCAAGGTGGACAAGAAAGTTGAGCCCAAATCTTGTGACAAAACTCACACATGCCCACCGTGCCCAGAACCTAAAAGCTGCGATAAGACCCACACCTGTCCCCCCTGCCCTTGATTCTAGA。

[0111] .SEQ ID NO.2:-VL- CL

[0112] GATATCCAGATGACCCAGAGCCCCAGCAGCCTGTCTGCTTCTGTGGGAGACAGAGTGACCATTACCTGCAGCGCCAGCCAGGATATTAGCAACTACCTGAACTGGTACCAGCAGAAACCCGGCAAGGCCCCAAAAGTGCTGATCTACTTCACCTCCTCTC TGCACAGCGGCGTGCCATCAAGATTCTCAGGAAGCGGCAGCGGCACCGACTTCACACTGACTATCAGCAGCCTGCAGCCCGAGGACTTCGCAACATACTACTGCCAGCAGTACAGCACCGTCCCCTGGACATTCGGCCAGGGAACAAAAGTGGAAATCAAG

[0113] CGTACGGTGGCTGCACCATCTGTCTTCATCTTCCCGCCATCTGATGAGCAGTTGAAATCTGGAACTGCCTCTGTTGTGTGCCTGCTGAATAACTTCTATCCCAGAGAGGCCAAAGTACAGTGGAAGGTGGATAACGCCCTCCAATCGGGTAACTCCCAGGAGAGTG TCACAGAGCAGGACAGCAAGGACAGCACCTACAGCCTCAGCAGCACCCTGACGCTGAGCAAAGCAGACTACGAGAAACACAAAGTCTACGCCTGCGAAGTCACCCATCAGGGCCTGAGTTCGCCCGTCACAAAGAGCTTCAACAGGGGAGAGTGTTGATTCTAGA.

[0114] The two sequences are linked by a disulfide bond.

[0115] Beijing Sino Biological Technology Co., Ltd. was commissioned to synthesize the bevacizumab F(ab)2 gene sequence.

[0116] Its structural diagram is as follows Figure 7 shown.

[0117] The expression method refers to the literature: Expression and Purification of Functionally Active Serotonin 5-HT2A Receptor in Insect Cells Using Low-titer Viral Stock.

[0118] (2) The ELISA method for determining serum titer is as follows:

[0119] Prepare ELISA plates, dilute F(ab)2 with PBS and coat the plates at a concentration of 200 ng per well, place in a 37°C incubator for 2 h, then wash 4 times with PBST, pat dry, add 5% skim milk powder and block at 37°C for 2 h, wash 4 times with PBST, pat dry, dilute immune mouse serum and non-immune mouse serum with PBST in multiple ratios, with a dilution gradient from 1:1000 to 1:128000, a total of 8 dilution gradients, add 100 μL to each well, then incubate at 37°C for 1 h, wash 4 times with PBST, pat dry, add horseradish peroxidase (HRP)-labeled goat anti-mouse IgG (1:10000 dilution), wash 4 times with PBST, pat dry, add 100 μL of TMB to each well for color development, add ELISA stop solution after 15 minutes, and place on a microplate reader to measure OD450nm.

[0120] (3) Cell fusion

[0121] Preparation before the experiment: Autoclave 1L of water, three sets of tweezers, scissors, and a 1L beaker one day in advance. On the day of the experiment, turn on the ultraviolet light of the clean bench in advance, disinfect the entire table, the needles and foam boards for fixing mice with 75% ethanol, and then sterilize with ultraviolet light for 30 minutes; adjust the water bath to 37°C in advance to keep the autoclaved water warm, or put the autoclaved water in a 37°C incubator to keep it warm; PEG also needs to be placed at 37°C in advance to promote fusion. In addition, serum-free RPMI 1640 culture medium, 75% ethanol, HAT, 2 cell culture dishes, 5 mL syringes, grinding screens, and beakers need to be prepared. The specific steps are as follows:

[0122] 1) Blood was collected from the eyeballs of immunized mice, whole blood was collected, serum was separated to obtain mouse polyclonal antibodies, and the dead mice were placed in a beaker filled with 75% ethanol. The ethanol should submerge the mice and soak for 5 min or more;

[0123] 2) Pour RPMI 1640 medium into two culture dishes, prepare a 50 mL centrifuge tube and fix the grinding screen on the mouth of the 50 mL centrifuge tube;

[0124] 3) Fix the mouse's limbs on a foam board, cut open the inner sides of the two thighs, cut open toward the head and perpendicular to the head, then use tweezers to lift the skin and tear it upwards to find the spleen. Use another pair of autoclaved scissors to cut off the spleen and place it in a cell culture dish;

[0125] 4) Remove the fat tissue from the spleen as much as possible, add RPMI1640 medium to the cell culture dish to wash it, then transfer it to another cell culture dish filled with RPMI 1640 medium, use a 5 mL syringe to suck up RPMI 1640 medium and gently pour it into the spleen, repeatedly blow and beat until the spleen is almost transparent, then put the spleen into the grinding screen and grind it with the piston of the syringe, and rinse the grinding screen with RPMI 1640 culture medium containing spleen cells;

[0126] 5) Take 2 bottles of SP / 20 cells that have been cultured in advance, wash them twice with serum-free RPMI 1640 medium, add about 10 mL of RPMI 1640 medium to the T75 cell culture flask, and gently tap the cells; do the same for the other bottle of SP / 20 cells, merge the two bottles of cells together, and then transfer the cells to a 50 mL centrifuge tube with spleen cells, gently invert to mix, and centrifuge at 500 r / min for 10 min;

[0127] 6) Discard the supernatant, resuspend in RPMI 1640 medium containing serum, and centrifuge again at 500 r / min for 10 min;

[0128] 7) Discard the supernatant and tap the bottom of the tube to loosen the cells;

[0129] 8) Pour the autoclaved water into the beaker and place the 50 mL centrifuge tube into the 37°C water;

[0130] 9) Take the preheated polyethylene glycol PEG, add 1 mL PEG, slowly add it over 1 min, rotate the 50 mL centrifuge tube while adding, stir gently with a pipette tip, and let it stand in water for 1-2 min;

[0131] 10) Pour RPMI 1640 medium into the sample tank, add RPMI 1640 medium to stop, count down for 5 minutes, add 1 mL, 1 mL, 3 mL, 10 mL and 10 mL RPMI 1640 medium every minute, rotate and add slowly and gently;

[0132] 11) Let stand for 2 minutes, invert twice, and let stand for another 7 minutes, all in 37°C high pressure water;

[0133] 12) Centrifuge at 800 r / min for 8 min, discard the supernatant, add an appropriate amount of culture medium containing HAT to resuspend the cells, dispense into 96-well plates, 100 μL per well, and culture in a 37°C cell culture incubator.

[0134] (4) Hybridoma cell screening

[0135] 24 hours after cell fusion, the medium was replenished by adding 50 μL of HAT-containing medium to each well; 5-7 days later, the medium was changed, 120 μL of supernatant was aspirated and discarded, and 150 μL of HT-containing medium was added; 24 hours later, the medium was changed again, 40 μL of supernatant was aspirated and diluted 40 times with 5% skimmed milk powder for ELISA identification, and the operation steps were the same as the ELISA steps in (2); the OD450nm value was read.

[0136] (5) Positive hybridoma cell subcloning

[0137] The specific steps of limiting dilution subcloning are as follows:

[0138] 1) Select the wells that are positive in ELISA identification after cell fusion for subcloning;

[0139] 2) Prepare a new 96-well cell plate and add 100 μL of RPMI 1640 medium containing 20% ​​fetal bovine serum to each well;

[0140] 3) Add 50 μL of RPMI 1640 medium containing 20% ​​FBS to the selected positive wells and mix thoroughly by pipetting. Then, aspirate 100 μL and add it to the 96-well cell plate in step (2). Dilute from the first well downwards and then add 100 μL of RPMI 1640 medium to the positive wells to continue culturing.

[0141] 4) Observe the number of cells in the diluted 96-well plate under a microscope, select wells with 100-200 cells, aspirate 100 μL and add to 5.5 mL of culture medium (RPMI 1640 culture medium containing 20% ​​FBS and 2% HT), mix with a pipette, and add to a new 96-well plate, filling half of the 96-well cell plate;

[0142] 5) After 5-6 days of culture, observe the cell status and perform fluid replenishment. After 5-7 days of fluid replenishment, when the cells have grown to 1 / 4 of the well, aspirate the supernatant for ELISA identification. Dilute the cell supernatant 40 times with 5% skim milk powder for ELISA identification;

[0143] 6) Select the wells with positive ELISA results for multiple subcloning until a monoclonal cell line is screened. The multiple subcloning methods are the same as the first subcloning;

[0144] Results: Several monoclonal cell lines secreting anti-F(ab)2 monoclonal antibodies were screened, including two monoclonal cell lines C63 and 6F2 that can stably secrete anti-F(ab)2 monoclonal antibodies.

[0145] 7) Select monoclonal cell lines for expansion culture in T75 cell culture flasks, some cells are used for cryopreservation, and some cells are used for intraperitoneal injection into mice. The specific operation of cell cryopreservation is as follows.

[0146] .a. Gently tap the cells cultured in the T75 cell flask and transfer them to a 15 mL centrifuge tube;

[0147] b. Centrifuge the cells at 1000 r / min for 5 min, and then discard the supernatant;

[0148] c. Premixed cryopreservation solution: 10% total volume of cell cryopreservation solution (DMSO), 30% total volume of FBS, and 60% total volume of serum-free RPMI 1640 medium;

[0149] d. Add 3 mL of freezing solution to the cell pellet and resuspend it. Divide one T75 cell flask into three cryopreservation tubes, with 1 mL of cell mixture in each tube.

[0150] (6) Preparation of ascites

[0151] Cell recovery: Take out the hybridoma cells frozen in the liquid nitrogen tank, quickly put the cells in a 37℃ water bath, and after thawing, aspirate the cell fluid into a centrifuge tube, add 5 mL of serum-free RPMI 1640 medium, centrifuge at 1000 r / min for 5 min, discard the supernatant, add 5 mL of serum-free RPMI 1640 medium to resuspend the cells, and then transfer them to a cell bottle and culture them in a 37℃ cell culture incubator.

[0152] 10-12 week old BALB / c female mice were selected and each mouse was injected with 0.5 mL of Biolong ascites preparation adjuvant in the left or right lower abdomen. After 15 days, each mouse was injected with 5×10 5 After 7-10 days, the mouse's abdominal cavity will be obviously bulging, the mouse will have difficulty in moving, poor appetite and dark fur color. The ascites can be collected by piercing the lower abdomen with a 2 mL syringe and slowly extracting the ascites. Centrifuge at 13000 r / min for 10 min, aspirate the supernatant and store it at -80℃.

[0153] (7) Ascites purification

[0154] After the extracted ascites is centrifuged, the supernatant is purified. The specific steps are as follows:

[0155] 1) Column loading: resuspend the medium and load it into the chromatography column, leaving 2 mL of column volume after the storage solution flows away;

[0156] 2) Equilibration: Equilibrate the column with 5 column volumes of equilibration buffer;

[0157] 3) Sample loading: Add 16 mL of equilibration buffer to every 4 mL of ascites, mix well, filter with a 0.45 μm filter, and pass through the column twice;

[0158] 4) Washing: Wash the impurities with 5 column volumes of equilibration buffer and collect the effluent;

[0159] 5) Elution: prepare a 15 mL centrifuge tube and add 1 mL of neutralizing solution in advance, add 9 mL of eluent to the column, collect the effluent and immediately adjust the pH to 7.0 with NaOH or concentrated HCl;

[0160] 6) Rinse the column with water and store it in 20% ethanol.

[0161] The eluted ascites was dialyzed twice with 500 mL PBS, and the dialysate was changed every 4 hours. After dialysis, the concentrated monoclonal antibody was centrifuged at 4000 r / min in a concentrator until the concentration of the monoclonal antibody reached 2 mg / mL. The concentrated monoclonal antibody was stored in PCR tubes or 1.5 mL centrifuge tubes.

[0162] Results: Multiple anti-F(ab)2 monoclonal antibodies were obtained, but only anti-F(ab)2 monoclonal antibodies C63 and 6F2 could form stable antibody sandwich structures, namely mouse anti-F(ab)2 monoclonal antibody-1 and mouse anti-F(ab)2 monoclonal antibody-2.

[0163] Example 2

[0164] 1. Preparation of the kit

[0165] Process and reaction system

[0166] like Figure 6 As shown, the detection system includes four chambers, reagents A, B, C, and D, which are respectively filled with four reagents A, B, C, and D. Among them, a certain volume of streptavidin magnetic beads is loaded in the A chamber; a certain volume of sample diluent is loaded in the B chamber; a certain volume of a mixture of mouse anti-F(ab)2 monoclonal antibody-1 coupled with luminescent markers and mouse anti-F(ab)2 monoclonal antibody-2 coupled with biotin is loaded in the C chamber; a certain volume of a mixture of macromolecular monoclonal antibody drugs coupled with luminescent markers and F(ab)2 coupled with biotin is loaded in the D chamber. Antibody relationship network as shown Figure 1 The antibody response network is shown in Figure 2 The coupling information between the raw materials is shown in Figure 3 shown.

[0167] Reagent A: It is a protein buffer containing a certain concentration of streptavidin magnetic beads;

[0168] The buffer can be one of phosphate buffer, tris(hydroxymethylaminomethane) buffer, citrate buffer, 4-morpholineethanesulfonic acid buffer and acetate buffer. The protein can be one of bovine serum albumin, casein and bovine collagen. The surfactant can be one or more of Tween-20, Triton-100, PEG2000-20000 and sodium dodecylbenzenesulfonate.

[0169] For example, 1 L of phosphate buffer was prepared as follows: 2 g KH2PO4, 29 g Na2HPO4·12H2O, 80 g NaCl, 2 g KCl, 5 g bovine serum albumin, 1 mL Tween-20, and 1 mL Proclin 300 (Shanghai Yuduo Biotechnology) were weighed and dissolved in 800 mL ultrapure water, the pH value was adjusted to 7.4±0.05, and finally ultrapure water was added to make up to 1 L, and filtered using a vacuum pump and a 0.22 μm filter membrane.

[0170] The preparation process of reagent A is as follows: Streptavidin magnetic beads (Thermo Fisher, 1 μm) are prepared with diluent to a concentration of 0.1 mg / mL, 0.2 mg / mL, or 0.4 mg / mL as the working concentration of the magnetic beads of reagent A.

[0171] Reagent B: is a buffer solution containing animal serum;

[0172] The buffer can be one of phosphate buffer, tris(hydroxymethylaminomethane) buffer, citrate buffer, 4-morpholineethanesulfonic acid buffer and acetate buffer. The animal serum can be one of fetal bovine serum, bovine serum, horse serum, goat serum, sheep serum, dog serum, pig serum and rabbit serum.

[0173] For example, 1 L of reagent B is prepared as follows: weigh 2 g KH2PO4, 29 g Na2HPO4·12H2O, 80 g NaCl, 2 g KCl, 200 mL horse serum, 1 mL Tween20, and 1 mL PC300, dissolve in 800 mL ultrapure water, adjust the pH to 7.4±0.05, and finally add ultrapure water to make up to 1 L. Filter using a vacuum pump and a 0.22 μm filter membrane.

[0174] The reaction system of reagent C is the same as that of reagent D.

[0175] 2. Preparation process of detection antibody-AE conjugate concentrate:

[0176] 2.1 Preparation of Luminescent Marker Coupling Buffer

[0177] (1) Luminescent marker labeling buffer: Weigh 2 g KH2PO4, 29 g Na2HPO4·12H2O, 80 g NaCl, and 2 g KCl, dissolve in 800 mL ultrapure water, adjust the pH to 8.0±0.05, and finally add ultrapure water to make up to 1 L. Filter and sterilize through a 0.22 μm filter and store at 2-8°C. The shelf life is 6 months.

[0178] (2) Luminescent marker quenching buffer: Weigh 2 g KH2PO4, 29 g Na2HPO4·12H2O, 80 g NaCl, 2 g KCl, and 20 g glycine Gly and dissolve in 800 mL ultrapure water. Adjust the pH value to 8.0±0.05. Finally, add ultrapure water to make up to 1 L. Filter and sterilize through a 0.22 μm filter and store at 2-8°C. The shelf life is 6 months.

[0179] (3) Luminescent marker storage buffer: Weigh 4.40 g Na2HPO4·12H2O, 12.03 g NaH2PO4, and 0.1 mL Tween-20 and dissolve them in 800 mL ultrapure water. Adjust the pH value to 6.0±0.05. Finally, add ultrapure water to make up to 1 L. Filter and sterilize through a 0.22 μm filter and store at 2-8°C. The shelf life is 6 months.

[0180] 2.2 Connection and purification of detection antibody and chemical marker acridinium ester (AE)

[0181] (1) Detection antibody information: Confirm the type of antibody to be labeled.

[0182] (2) Antibody activation: Label the buffer with a luminescent marker, prepare the detection antibody to a concentration of 0.25 mL / mL, and let it stand at room temperature for 5 minutes.

[0183] (3) Treatment of chemical markers (acridinium esters): Take 5 mg and dilute to 0.25 mg / mL with DMOS.

[0184] (4) Connection: Take 0.25 mg / mL of the activated detection antibody (mouse anti-F(ab)2 monoclonal antibody-1 or bevacizumab drug) and 0.25 mg / mL of the treated acridinium ester, and couple them at a volume ratio of 20:1. Incubate at room temperature (25±1°C) in the dark for 1 hour.

[0185] (5) Purification: Select a G-25 gel filtration column, balance at least three column volumes with a luminescent marker storage buffer, select a flow rate of 1.0 mL / min, load the sample after the baseline is flat, observe the peak and collect the first peak, measure the absorbance at 280 nm of the elution peak, calculate the concentration according to the extinction coefficient of 1.0, measure the collection volume, and calculate the total amount. Store at 2~8℃ for testing, with a shelf life of 6 months. After the bevacizumab test antibody is connected, pair it with the intermediate test to screen the working concentration.

[0186] 2.2 Preparation process of capture antibody-Biotin conjugate concentrate:

[0187] 2.2.1 Preparation of biotin coupling buffer

[0188] (1) Biotin labeling buffer: Weigh 2 g KH2PO4, 29 g Na2HPO4·12H2O, 80 g NaCl, and 2 g KCl, dissolve in 800 mL ultrapure water, adjust the pH to 8.0±0.05, and finally add ultrapure water to make up to 1 L. Filter and sterilize through a 0.22 μm filter and store at 2-8°C. The shelf life is 6 months.

[0189] (2) Biotin dialysis buffer: Weigh 2 g KH2PO4, 29 g Na2HPO4·12H2O, 80 g NaCl, and 2 g KCl, dissolve in 800 mL ultrapure water, adjust the pH to 7.4±0.05, and finally add ultrapure water to make up to 1 L. Filter and sterilize through a 0.22 μm filter and store at 2-8°C. The shelf life is 6 months.

[0190] Capture antibody (mouse anti-F(ab)2 monoclonal antibody-2 or bevacizumab F(ab)2) linked to biotin and purified

[0191] (1) Verify the actual recovery rate of the bottle label concentration:

[0192] The UV spectrophotometer was calibrated to zero at 280 nm with Biotin labeling buffer, and the antibody absorbance was measured. The antibody concentration was calculated according to antibody concentration = measured absorbance * dilution factor / 1.36 (Note: If the bottle label concentration is greater than 1.5 mg / mL, the original antibody is diluted 1:10 with Biotin labeling buffer. If it is less than 1.5 mg / mL, the absorbance is tested with the original solution). The recovery rate was calculated as follows: recovery rate = measured antibody concentration / bottle label antibody concentration 100%. If the recovery rate is less than 85%, the operation should be stopped to avoid insufficient antibody feed, which will lead to a lower recovery rate in the following experiment. If the recovery rate is greater than 85%, the operation should be continued according to the original bottle label concentration.

[0193] (2) Antibody information: Record the concentration of the antibody and calculate the amount of antibody required for connection based on the concentration.

[0194] (3) Pre-treatment of capture antibody:

[0195] Replace the BEV capture antibody buffer using G25 column chromatography, load and recover the elution peak, use a spectrophotometer to detect the OD280 value of the recovered product, calculate the recovery concentration, total amount and other parameters with an extinction coefficient of 1.36, and calculate the recovery rate to be greater than 85%. Put it into a centrifugal ultrafiltration tube for concentration, and the final concentration is 3-5 mg / mL.

[0196] (4) Treatment and connection of capture antibody: Weigh the capture antibody and use Biotin labeling buffer to prepare a BEV capture antibody solution with a final concentration of 0.5 mg / mL. Calculate the amount of biotin required for antibody connection. React at a molar ratio of Bition: Ab = 20:1 for 1 hour at room temperature.

[0197] (5) Purification: Place it in a dialysis bag (MW: 30 kD), dialyze it in 4℃ Biotin dialysis buffer for 2.5 hours, replace the dialysis solution, and continue dialysis for another 2.5 hours. Finally, use a pipette to take out all the solution in the dialysis bag and put it into a centrifuge tube. Store it at 2-8℃ for testing. The validity period is 6 months. After the BEV detection antibody is connected, pair it with the intermediate product test to screen the working concentration.

[0198] 2.3 Reagent Integration

[0199] The luminescent marker conjugate and the biotin conjugate are mixed in an equal volume ratio to prepare reagent C or reagent D. The mouse anti-F(ab)2 monoclonal antibody-1 coupled luminescent marker and the mouse anti-F(ab)2 monoclonal antibody-2 coupled biotin are mixed in an equal volume ratio to prepare reagent C; the bevacizumab drug coupled luminescent marker and the bevacizumab F(ab)2 coupled biotin are mixed in an equal volume ratio to prepare reagent D.

[0200] Example 3

[0201] Taking bevacizumab as an example, the master curve (standard curve) of the bevacizumab drug detection reagent was tested.

[0202] Bevacizumab was purchased from Bio-Thera Pharmaceuticals Co., Ltd. (BAT706) Avzivi (bevacizumab). The detection method was performed on an ultra-high-speed chemiluminescence instrument.

[0203] In the detection of the present invention, the schematic diagram of the large molecule monoclonal antibody drug (mAb) detection technology scheme is as follows Figure 4 The schematic diagram of the anti-drug antibody (ADAs) detection scheme is shown in Figure 5shown.

[0204] The test method of the master curve of bevacizumab drug detection reagent is as follows:

[0205] The master curve of the bevacizumab drug detection reagent is a gradient dilution of the bevacizumab drug to obtain six concentration points: S0, S1, S2, S3, S4, and S5, where point S0 is the sample diluent (containing 20% ​​horse serum).

[0206] The master curve of the anti-bevacizumab antibody drug detection reagent is a gradient dilution of the naked antibody (unlabeled antibody) of the mouse anti-F(ab)2 monoclonal antibody to obtain six concentration points: T0, T1, T2, T3, T4, and T5. The T0 point is the sample dilution solution (containing 20% ​​horse serum). The results are as follows: Figure 8 As shown in A.

[0207] The master curve of bevacizumab drug detection reagent is within the linear range, R 2 =0.9941; the main curve of anti-bevacizumab antibody drug detection reagent is within the linear range, R 2 =0.9999. The result is as follows Figure 8 As shown in B.

[0208] Example 4

[0209] Taking bevacizumab as an example, a method for detecting monoclonal antibody blood concentration and anti-drug antibody using luminescence dual detection technology includes the following steps:

[0210] (1) Take 10 μL of serum sample and dilute it with sample diluent at a ratio of 1:100-200;

[0211] (2) Take 20 μL of the diluted sample and place it in two reaction cups. Add reagent C and reagent D to the two reaction cups respectively and incubate at 37±5℃ for 3-7 minutes.

[0212] (3) Add streptavidin magnetic beads and mix well; react at 37±5℃ for 3-7min;

[0213] (4) After washing the magnetic beads, add the pre-excitation solution and the excitation solution, measure the luminescence value, and substitute the luminescence value of the serum sample into the standard curve to obtain the monoclonal antibody blood concentration and the concentration of the anti-drug antibody in the serum sample.

[0214] Pre-excitation solution: 0.10M hydrochloric acid, 1.0wt% urea peroxide, pH=1.0.

[0215] Exciting solution: 0.40M sodium hydroxide, 2.0wt% octaalkyltrimethylammonium chloride, pH=13.3.

[0216] Example 5

[0217] Detection limit test

[0218] Repeat the measurement 20 times with the zero-concentration calibrator to obtain the relative luminescence values ​​of the 20 measurement results, calculate the average value (X) and standard deviation (SD), and obtain the relative luminescence value corresponding to (X+2SD). Measure the adjacent concentration calibrator (main calibrator S1) 3 times, record its relative luminescence value, take the average value (X1), and perform a two-point regression fitting based on the concentration-relative luminescence value results between the zero-concentration calibrator and the adjacent calibrator to obtain a linear equation. Substitute the relative luminescence value corresponding to (X+2SD) into the above equation to calculate the corresponding concentration, which is the blank detection limit. The results are shown in Tables 2 and Fig. 9 (The detection limit of bevacizumab is Fig. 9 A, Anti-bevacizumab antibody drug detection limit is as follows Fig. 9 B) as shown.

[0219] Table 2 Detection limits of bevacizumab and anti-bevacizumab antibodies

[0220]

[0221] The blank detection limit of bevacizumab drug detection reagent shall not exceed 0.005 μg / mL; the blank detection limit of anti-bevacizumab antibody drug detection reagent shall not exceed 0.001 μg / mL.

[0222] Example 6

[0223] Linear Correlation Test

[0224] The high-value samples close to the upper limit of the linear range were diluted into at least 6 series of gradient concentration samples using sample diluent. Each concentration of the sample was measured 3 times, and the mean of the test results was calculated. The dilution concentration was used as the independent variable and the mean of the test results was used as the dependent variable. The least squares method was used for linear fitting and the linear correlation coefficient was calculated. The results are shown in Tables 3, 4 and Fig.10 (The linear correlation of bevacizumab drug is as follows Fig.10 A, anti-bevacizumab antibody drug linear correlation Fig.10 B) as shown.

[0225] Table 3 Linear correlation test results of bevacizumab

[0226]

[0227] Table 4 Linear correlation test results of anti-bevacizumab antibody drugs

[0228]

[0229] The linear correlation coefficient of bevacizumab drug detection reagent is R2=0.997; the linear correlation coefficient of anti-bevacizumab antibody drug detection reagent is R2=0.998.

[0230] Example 7

[0231] Repeatability test

[0232] The same batch of test kits were used to measure the enterprise precision reference products, and the test was repeated 10 times. The mean value (X) and standard deviation S of the measured values ​​were calculated respectively. The coefficient of variation (CV) was calculated according to Formula 1 and Formula 2.

[0233] Formula 1

[0234] Formula 2

[0235] In the formula: SD----standard deviation of n measured values;

[0236] CV---coefficient of variation;

[0237] ---The average of n measured values;

[0238] ---The measured value of the i-th time;

[0239] n-----Number of measurements.

[0240] The results are shown in Tables 5 and 6.

[0241] Table 5 Repeatability test results of bevacizumab

[0242]

[0243] Table 6 Repeatability test results of anti-bevacizumab antibody drugs

[0244]

[0245] The repeatability of bevacizumab drug detection reagent shall not exceed 5%; the repeatability of anti-bevacizumab antibody drug detection reagent shall not exceed 5%.

[0246] Example 8

[0247] Correctness test

[0248] Evaluation method: Measure the working calibrant 3 times for each concentration, calculate the average value, and calculate according to the formula E n Absolute value.

[0249] Formula 4

[0250] Where:

[0251] Average value of laboratory measurement results;

[0252] Use measurement standards to indicate values ​​for correctness evaluation;

[0253] is the measurement uncertainty;

[0254] The uncertainty of the measurement standard used for verification of trueness.

[0255] The results are shown in Tables 7 and 8.

[0256] Table 7 Bevacizumab drug accuracy test results

[0257]

[0258] Table 8 Results of accuracy test of anti-bevacizumab antibody drugs

[0259]

[0260] The relative deviation of bevacizumab drug detection reagent shall not exceed 10%; the relative deviation of anti-bevacizumab antibody drug detection reagent shall not exceed 10%.

[0261] Example 9

[0262] Recovery test

[0263] Evaluation method: Add a known concentration of target analyte to the sample and calculate the recovery rate based on the test results and the spiked amount. The recovery rate calculation formula is: (target analyte amount detected - target analyte amount in the original sample) / spiked amount × 100%. The results are as follows Fig.11 As shown in Figure 2, the recovery rate of bevacizumab drug was tested as follows: Fig.11 A, Anti-bevacizumab antibody drug recovery test Fig.11 B.

[0264] The spiked recovery rate of bevacizumab drug detection reagent is within ±20%; the spiked recovery rate of anti-bevacizumab antibody drug detection reagent is within ±20%.

[0265] Example 10

[0266] Stability test

[0267] Evaluation method: Take the reagent sample and place it at 37℃, test it once on the 7th day and the 10th day, and observe the change of the result. The 37℃ accelerated destruction test should be stable for more than 7 days (storage at 37℃ for 1 day is equivalent to stabilization at 2℃~8℃ for 2 months).

[0268] The results are shown in Tables 9 and 10.

[0269] Table 9 Stability test results of bevacizumab drug

[0270]

[0271] Table 10 Stability test results of anti-bevacizumab antibody drugs

[0272]

[0273] The master curve, blank detection limit, linearity, repeatability, accuracy, recovery rate and stability of the dual detection reagent of bevacizumab drug and anti-bevacizumab antibody drug all meet the quality requirements of this industry.

[0274] It should be noted that the above embodiments are merely examples for clearly illustrating the present invention, and are not intended to limit the embodiments of the present invention. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is impossible to list all the embodiments here. Any obvious changes or modifications derived from the technical solution of the present invention are still within the scope of protection of the present invention.

Claims

1. A reagent for detecting anti-bevacizumab drug antibodies, characterized in that: The method comprises a D reagent, wherein the D reagent comprises a bevacizumab drug coupled to a luminescent marker and bevacizumab F(ab)2 coupled to biotin; the heavy chain gene sequence of bevacizumab F(ab)2 is shown in SEQ ID NO.1, and the light chain gene sequence of bevacizumab F(ab)2 is shown in SEQ ID NO.2; Bevacizumab drug coupled with luminescent marker is bevacizumab labeled with luminescent marker; bevacizumab F(ab)2 coupled with biotin is bevacizumab F(ab)2 coupled with biotin.

2. The reagent according to claim 1, characterized in that The luminescent marker is any one of acridinium ester, luminol and isoluminol.

3. The reagent according to claim 1, characterized in that The preparation process of the bevacizumab drug-coupled luminescent marker includes the following steps: S1. Antibody activation: Prepare bevacizumab drug into a solution with a concentration of 0.2-0.5 mL / mL using labeling buffer and let stand; S2. Conjugate the activated antibody and the luminescent marker at a volume ratio of 15-25:1 at room temperature in the dark for 0.5-1.5 hours; purify to obtain the bevacizumab drug-conjugated luminescent marker; the concentration of the luminescent marker is 0.2-0.5 mg / mL.

4. The reagent according to claim 1, characterized in that The biotin is any one of Biotin, Desthiobiotin, Silybin-biotin and Biotin-coumarin.

5. The reagent according to claim 1, characterized in that The preparation process of bevacizumab F(ab)2 coupled to biotin comprises the following steps: The bevacizumab F(ab)2 is prepared into a solution with a concentration of 0.3-0.7 mL / mL using a biotin labeling buffer; biotin and the bevacizumab F(ab)2 are reacted at room temperature for 0.5-1.5 hours at a molar ratio of 15-25:1; and the bevacizumab F(ab)2 is purified to obtain the bevacizumab F(ab)2 coupled with biotin.

6. The reagent according to claim 1, characterized in that In the reagent, the bevacizumab drug coupled with the luminescent marker and the bevacizumab F(ab)2 coupled with biotin are in equal amounts.

7. The reagent according to any one of claims 1 to 6, characterized in that The reagents also include reagent A and reagent B; the reagent A is a streptavidin magnetic bead solution; and the reagent B is a sample diluent.

Images