Adeno-associated virus retinal cell trophil capsid mutant and application thereof

Abstract

The invention discloses an adeno-associated virus retinal cell tropism capsid mutant and application thereof, and relates to an adeno-associated virus capsid protein mutant for improving retinal cell tropism of capsid protein by inserting a heterologous peptide behind type 5 adeno-associated virus capsid protein Q574. The invention also discloses a recombinant adeno-associated virus vector containing the mutant coding gene. The recombinant adeno-associated virus vector provided by the invention has enhanced infection tropism of retinal cells, and has an application prospect in preparation of retina-related disease treatment drugs as a delivery vector.

Description

Technical Field

[0001] The present disclosure relates to the technical field of virus vectors, and in particular to a recombinant adeno-associated virus targeting the retina and applications thereof. Background Art

[0002] Adeno-associated virus (AAV) is a small non-enveloped virus with single-stranded DNA, with a particle size of 24 to 26 nm. Its genome consists of Rep and Cap genes, with 2 ITRs on both sides. AAV requires the help of helper viruses for DNA replication. AAV attaches to the cell surface under the action of receptors, triggering endocytosis signals in the cell, thereby infecting target cells. Next, the virus particles are released from the endosomes and release their single-stranded DNA, which is then converted into double-stranded DNA in the cell. AAV genes can be expressed for a long time in non-dividing cells.

[0003] Retinal diseases, including Leber hereditary optic neuropathy (LHON), Leber congenital amaurosis (LCA), Stargardt disease, and age-related macular degeneration (AMD), can cause great damage to patients' ability to live independently and perform daily activities, and there is still a lack of effective treatments. As one of the most promising gene delivery tools, AAV has the advantages of high delivery efficiency and long-term expression, which may completely change the treatment status of eye diseases, especially retinal diseases.

[0004] Due to the different pathogenesis of different fundus diseases, when using AAV virus to treat retinal diseases, the cell levels that need to be infected are different. Different AAV serotypes have different transduction efficiencies and eye tissue tropisms, and by modifying the capsid of the AAV vector, its tissue tropism, transduction efficiency, and the ability of the capsid to escape the host immune response can be changed. The purpose of the present invention is to screen out recombinant AAV vectors with higher retinal infection efficiency and more specific cell tropism through capsid modification, and to provide their use in the preparation of gene therapy drugs for retinal diseases. Summary of the invention

[0005] Based on the above purpose, the present invention first provides a heterologous peptide for improving the retinal cell tropism of adeno-associated virus capsid protein, the sequence of the heterologous peptide is shown in SEQ ID NO. 3 or 9. In the present invention, the mutant having the sequence as SEQ ID NO. 3 is named V2 heterologous peptide, and the mutant having the sequence as SEQ ID NO. 9 is named V5 heterologous peptide.

[0006] Secondly, the present invention provides a polynucleotide encoding the above-mentioned heterologous peptide, the sequence of the polynucleotide is shown in SEQ ID NO.4 or 10, wherein the polynucleotide sequence encoding the heterologous peptide V2 with a sequence such as SEQ ID NO.3 is shown in SEQID NO.4, and the polynucleotide sequence encoding the heterologous peptide V5 with a sequence such as SEQ ID NO.9 is shown in SEQ ID NO.10.

[0007] Thirdly, the present invention provides an adeno-associated virus capsid protein mutant containing the above-mentioned heterologous peptide. The term "containing" in the present invention means that the heterologous peptide is inserted into the adeno-associated virus capsid protein.

[0008] In a preferred embodiment, the insertion position of the heterologous peptide is located after Q574 of the adeno-associated virus capsid protein amino acid sequence. The adeno-associated virus capsid protein amino acid sequence of the present invention is set based on the adeno-associated virus capsid protein amino acid sequence represented by Genbank ID YP_068409.1, and the insertion site is located in the variable region VIII.

[0009] In a more preferred embodiment, the amino acid sequence of the adeno-associated virus type 5 capsid protein mutant is shown in SEQ ID NO. 11 or 13. In the present invention, the adeno-associated virus type 5 capsid protein mutant with SEQ ID NO. 11 is named as mutant #2, and the adeno-associated virus type 5 capsid protein mutant with SEQ ID NO. 13 is named as mutant #5.

[0010] Fourth, the present invention provides a polynucleotide encoding the adeno-associated virus capsid protein mutant, the sequence of the polynucleotide is shown in SEQ ID NO.12 or 14. In the present invention, the sequence of the encoding polynucleotide with the amino acid sequence shown in SEQ ID NO.11 is shown in SEQ ID NO.12, and the sequence of the encoding polynucleotide with the amino acid sequence shown in SEQ ID NO.13 is shown in SEQ ID NO.14.

[0011] Fifth, the present invention provides a vector containing a polynucleotide encoding the above-mentioned adeno-associated virus capsid protein mutant.

[0012] In a preferred embodiment, the vector further contains genes encoding biological effector molecules and / or biomarker molecules. The genes encoding biological effector molecules of the present invention include but are not limited to: Crry gene or Nrf2 gene. Crry (CR1-related protein Y) described in the present invention encodes an important cell surface complement regulatory receptor, which plays a key role in regulating the activity of the complement system and can regulate the classical and alternative complement pathways. As a membrane protein, Crry is a key cell regulator of complement activation in mice, which regulates the activity of the complement system by inhibiting the activation of C3. Nrf2 (Nuclear factor erythroid 2-related factor 2) encodes nuclear factor E2-related factor 2, which is a key transcription factor that plays a core role in the anti-oxidative stress response of cells. It protects cells from oxidative stress and inflammatory damage through various mechanisms in the body and plays an important role in the prevention and treatment of various diseases. The biomarker molecules of the present invention can also be, but are not limited to: green fluorescent protein (GFP) gene, luciferase (luciferase) gene.

[0013] In a more preferred embodiment, the vector is a recombinant adeno-associated virus vector. In a specific embodiment of the present invention, the adeno-associated virus is adeno-associated virus type 5.

[0014] Finally, the present invention provides an application of the above-mentioned recombinant adeno-associated virus vector in the preparation of a drug for treating retinal diseases. In some application examples, the retinal disease is selected from any one of Leber hereditary optic neuropathy (LHON), Leber congenital amaurosis (LCA), Stargardt disease, and age-related macular degeneration (AMD). These diseases are accompanied by damage or degenerative changes in the RPE layer, resulting in impaired photoreceptor function, which in turn causes decreased vision. The above-mentioned recombinant adeno-associated virus vector can deliver the therapeutic gene to the RPE layer to alleviate pathological damage to the RPE layer.

[0015] The beneficial effects of the present invention are that compared with the parental serotype AAV5, the #2 mutant and the #5 mutant exhibit faster gene delivery kinetics and higher long-term expression levels of intraocular transgenes in BALB / cJ and C57BL / 6J mouse models, especially in the specific transduction of the RPE cell layer.

[0016] The adeno-associated virus capsid protein and the adeno-associated virus containing the same disclosed in the present invention have the characteristic of enhanced retinal transduction ability, can be used as a delivery vector for the treatment of retinal-related diseases, and play an important role in expanding AAV-related gene therapy. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 Schematic diagram of the production and screening of capsid variants from AAV5 viral libraries via peptide display; Figure 2 This is the plasmid map of the pAIRC vector; Figure 3 Flow cytometry was used to analyze the transduction efficiency of rAAVs in 293T cell lines; Figure 4 The histogram shows the percentage of transfected 293T cells gated for EGFP-positive cells determined by flow cytometry; Figure 5 Flow cytometry was used to analyze the transduction efficiency of rAAVs in the 661W cell line; Figure 6 The histogram shows the percentage of transfected 661W cells gated for EGFP-positive cells as determined by flow cytometry; Figure 7 Firefly luciferase activity was measured using a luminometer after rAAVs transduction of 293T cells; Figure 8 Firefly luciferase activity was measured using a luminometer after rAAVs transduction of 661W cells; Fig. 9 In vivo imaging detection after recombinant AAVs-luc was injected into the vitreous cavity of BALB / cJ mice; Fig.10 This is an in vivo imaging test after recombinant AAVs-luc was injected into the vitreous cavity of C57BL / 6J mice; Fig.11 To analyze the gene expression level of recombinant AAVs-luc after intravitreal injection in BALB / cJ mice; Fig.12 Analysis of gene expression levels after recombinant AAVs-luc injection into the vitreous cavity of C57BL / 6J mice. DETAILED DESCRIPTION

[0018] The present invention will be further described below in conjunction with specific embodiments, and the advantages and features of the present invention will become clearer as the description proceeds. However, these embodiments are merely exemplary and do not constitute any limitation on the scope of protection defined by the claims of the present invention.

[0019] Example 1: Screening of AAV5 capsid mutants Figure 1 The steps for the production and screening of capsid variants from an AAV5 viral library by peptide display are given.

[0020] (1) Construction of AAV5 backbone plasmid Using AAV2 plasmid (Takara, 6230) to provide the Rep gene, AAV5 plasmid (Aonogene, pAAV-RC5) to provide the Cap gene, and pAAV-ITR-MCS plasmid (Takara, 6230) to provide the backbone vector, the Rep gene and the Cap gene were cloned between the two ITRs on the backbone plasmid to construct the pAIRC vector containing the wild-type AAV genome (see the pAIRC vector plasmid map for details). Figure 2 ). The primers for amplifying the Rep gene and the Cap gene are as follows: Rep forward primer: 5'-gtttgaacgcgcagccgccatgccggggttttacgagattg-3' (SEQ ID NO.15), Rep reverse primer: 5'-catacctgGCTAGCcatttattgttcaaagatgcagtcatcc-3' (SEQ ID NO.16); Cap forward primer: 5'-caataaatgGCTAGCcaggtatgtcttttgttgatcaccctcc-3' (SEQ ID NO. 17); Cap reverse primer: 5'-gattaacaagcaaACTAGTttaaaggggtcgggtaagg-3' (SEQ ID NO. 18).

[0021] (2) Construction of a 7-peptide displayed AAV5 mutant plasmid library Using pAIRC as the basic backbone vector, a sequence encoding 7 amino acids (aa) was inserted after Q574 on the AAV5 capsid using trimer primers (completed by Suzhou Hongxun Biotechnology Co., Ltd.), generating an AAV5-NNK plasmid library. Finally, a 21-base random sequence was inserted after Cap Q574: NNK NNK NNK NNK NNK NNK NNK, generating 10 6 The purified plasmid library was electroporated into NEB 10-beta E. coli competent cells (NEB, C3019H).

[0022] (3) Construction of AAV5 mutant virus library The AAV5-NNK plasmid library and Ad Helper plasmid (Takara, 6230) were co-transfected into 293T cells using polyethyleneimine (polyciences, 23966) to produce the corresponding AAV virus library. 293T cells were collected 72 h after transfection and the virus was obtained by lysing the cells through three rounds of rapid freezing / thawing.

[0023] (4) Amplification of AAV5 mutant virus library Ad Helper was transfected into 293T cells. 24 h after transfection, the first round of AAV virus library was used to infect the cells. 48 h after infection, 293T cells were collected and the viruses were obtained by three rounds of rapid freezing / thawing and lysing the cells.

[0024] (5) Screening of AAV5 mutants The screening process of AAV5 capsid mutants is as follows Figure 1 As shown in the figure (screening is based on the principle of engineering AAV capsid to change cell tropism), the packaged AAV5 mutant virus library was added at an MOI of 10 4 Infection of 661W cell line (mouse retinal photoreceptor cells ,BNCC,353554 ), after 6 h of infection, the cells were centrifuged and washed twice with PBS to remove AAVs not bound to 661W cells. The AAV genome was extracted using a DNA extraction kit, and the recombinant CAP (rCap) gene sequence was amplified by PCR using the corresponding primers (Cap forward primer (SEQ ID NO.17) and Capreverse primer (SEQ ID NO.18)).

[0025] The amplified rCap gene was cloned into the pAIRC vector after double digestion with NheI & SpeI using the Gibson homologous recombination kit to construct a new plasmid library. The library was electroporated into NEB 10-beta E. coli competent cells and inoculated into 5 mL of ampicillin-resistant LB medium. After culture, the plasmid was extracted using a plasmid extraction kit, which was the AAV5 mutant plasmid library of peptide display after the first round of screening. The library was used again for AAV5 packaging and a second round of screening.

[0026] The above three rounds of in vitro screening were performed, and the AAV genome in the cells after the third round of screening was extracted using a DNA extraction kit, and corresponding primers were designed for PCR amplification: NGS F(5'→3'): caacatgctcatcaccag (SEQ ID NO.19); NGS R(5'→3'): gtacacgtccctctccatc (SEQ ID NO. 20).

[0027] After amplification, a sequence of about 170 bp was obtained for next generation sequencing (NGS) (caacatgctcatcaccagcgagagcgagacgcagccggtgaaccgcgtggcgtacaacgtcggcgggcagatggccaccaacaaccagXXXagctccaccactgcccccgcgaccggcacgtacaacctccaggaaatcgtgcccggcagcgtgtggatggagagggacgtgtac, XXX is the inserted gene). The DNA fragment size was identified by gel electrophoresis, and the target band fragment was recovered using a gel recovery kit. The purified PCR fragment product was sent to a sequencing company for high-throughput sequencing, and the high-frequency inserted peptide sequence and the detected frequency are shown in Table 1. The peptide insertion position is after the glutamine Q at position 574 of the wild-type AAV5 CAP protein. The wild-type AAV5 CAP protein original sequence is inserted into the peptide V5 shown in the sequence of SEQ ID NO.9 to obtain the Cap protein mutant (#5) shown in the sequence of SEQ ID No.13; and the peptide V2 shown in the sequence of SEQ ID NO.3 is inserted into the Cap protein mutant (#2) shown in the sequence of SEQ ID No.11.

[0028] Table 1. Frequency and amino acid sequence of inserted oligopeptides detected in 9,323,750 peptide sequences

[0029] Example 2: Construction of AAV5 capsid protein mutants and virus packaging The coding sequences shown in SEQ ID NO.2, 4, 6, 8, and 10 were designed on the homology arms by primers, and connected to the Cap gene Q574 of the pAAV-RC5 plasmid by Gibson assembly to construct the auxiliary plasmid encoding the recombinant capsid protein. The eGFP or luciferase transgene was packaged into the pAAV-CMV-MCS vector, and co-transfected with the pAAV-RC5 auxiliary plasmid and the adeno-associated virus auxiliary plasmid to package the recombinant AAV that can express two fluorescent reporter genes respectively. After freezing and thawing three times, the cells were treated with nuclease (50 U / ml) at 37°C for 1 h, the cell debris was removed by centrifugation, and qPCR titration was performed with CMV primers to obtain recombinant AAV-eGFP or AAV-Luciferase.

[0030] CMV F primer: 5'-ttcctacttggcagtacatctacg-3' (SEQ ID No. 21), CMV R primer: 5'-gtcaatggggtggagacttgg-3' (SEQ ID No. 22).

[0031] Example 3: In vitro functional verification of recombinant AAV5 virus 293T cells or 661W cells in the logarithmic growth phase were seeded in 48-well plates and cultured overnight. 4 On the one hand, wt-AAV5, AAV5-STCVNTNRA-CMV-eGFP (#1 rAAV5), AAV5-PGRSNST-CMV-eGFP (#5 rAAV5), AAV5-PNSPNRV-CMV-eGFP (#3 rAAV5), AAV5-STCVSTNRA-CMV-eGFP (#4 rAAV5), AAV5-KGMSNVI-CMV-eGFP (#2 rAAV5) were used to transduce 293T and 661W cell lines, and the cells were trypsinized 48 h later, washed twice with PBS and resuspended, and the cells were stained for live / dead, and eGFP expression was analyzed by flow cytometry. Samples were acquired using a BD FACSCanto, and the number of eGFP-positive cells in the live or dead cell population was counted using Flowjo 10.8.1 software. The % Parent of the gated cells was then used to determine the transduction differences of rAAVs.

[0032] Figure 3 , Figure 5 Shown are graphs showing the results of flow cytometric analysis of transduced 293T and 661W cell lines. Figure 4 and Figure 6 The histograms of the percentage of eGFP-positive cells gated for transfected 293T and 661W cell lines determined by flow cytometry are shown, respectively (* p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001), Figure 4 and Figure 6The results showed that the GFP expression of mutants #2 (16.9% in 293T and 4.3% in 661W), #4 (18.1% in 293T and 4.1% in 661W) and #5 (9.9% in 293T and 2.8% in 661W) after infection in 293T and 661W cells was significantly higher than that of WT AAV5 (6.4% in 293T and 0.9% in 661W).

[0033] On the other hand, for cells infected with AAV-luciferase, luciferase substrate was added to the cells 48 hours after infection. Luciferase reacted with the substrate to produce fluorescence. The activity of luciferase was determined by detecting the intensity of fluorescence to evaluate the gene expression level of AAV mutants ( Figure 7 and Figure 8 ). The levels of luciferase expression in 293T cells infected with mutants #1, #2, #4, and #5 (RLU for #1 was 6.48×10 5 , the RLU of #2 is 1.58×10 6 , the RLU of #4 is 1.49×10 6 , the RLU of #5 is 2.20×10 6 ) was significantly higher than WT AAV5 (RLU was 6.20×10 4 ). In 661W cells, only the luciferase expression level after infection with the #5 mutant (RLU was 3.23×10 3 ) was significantly higher than WT AAV5 (RLU was 1.31×10 3 ). The above results suggest that the capsid change of the #5 mutant significantly enhances the transduction efficiency of AAV5 in 293T and 661W cell lines in vitro.

[0034] Example 4: Verification of in vivo transduction efficiency of recombinant AAV5 virus Mice were anesthetized by intraperitoneal injection of ketamine (0.1 mg / g), and 1 μL of virus solution (10 11 The needle was positioned at 100 copies / μL under a stereomicroscope, and the sclera, choroid, and retina were pierced to directly visualize the rAAV vector solution injected into the mouse vitreous. Three mice were injected with each virus, and erythromycin ointment was applied to the eyes after injection. The animals were placed on a heat pad to maintain body temperature during the recovery period.

[0035] The expression of luciferase in the mouse eyes was detected by in vivo imaging at 1, 2, 3, 4, 8, 12, and 24 weeks after injection. In BALB / cJ mice, the expression level of luciferase in the eyes of mutants #2 and #5 was higher than that of WT AAV5 ( Fig. 9and Fig.11 ), among which the luciferase expression level of mutant #5 was significantly higher than that of WT AAV5 at each time point tested.

[0036] In C57BL / 6J mice, the ocular luciferase expression level of mutant #5 was higher than that of WT AAV5 at all time points tested ( Fig.10 and Fig.12 ) Except for the 4th week after injection, the luciferase expression levels of mutant #5 and WT AAV5 were statistically different.

Claims

1. A heterologous peptide for increasing the retinal cell tropism of adeno-associated virus capsid protein, characterized in that: The sequence of the heterologous peptide is shown as SEQ ID NO.3 or SEQ ID NO.

9.

2. A polynucleotide encoding the heterologous peptide according to claim 1, characterized in that: The sequence of the polynucleotide is shown as SEQ ID NO.4 or SEQ ID NO.

10.

3. An adeno-associated virus capsid protein mutant containing the heterologous peptide according to claim 1.

4. The adeno-associated virus capsid protein mutant according to claim 3, characterized in that: The insertion position of the heterologous peptide is located after Q574 of the amino acid sequence of the capsid protein of type 5 adeno-associated virus.

5. The adeno-associated virus capsid protein mutant according to claim 4, characterized in that: The amino acid sequence of the adeno-associated virus type 5 capsid protein mutant is shown in SEQ ID NO.11 or SEQ ID NO.

13.

6. A polynucleotide encoding the adeno-associated virus capsid protein mutant according to claim 5, characterized in that: The sequence of the polynucleotide is shown as SEQ ID NO.12 or SEQ ID NO.

14.

7. A vector containing the polynucleotide encoding the adeno-associated virus capsid protein mutant according to claim 6.

8. The carrier according to claim 7, characterized in that The vector also contains genes encoding biological effector molecules and / or biological marker molecules.

9. The carrier according to claim 8, characterized in that The vector is a recombinant adeno-associated virus vector.

10. Use of the carrier according to claim 9 in the preparation of drugs for treating retinal diseases.

Images