Medicago truncatula plant type development control protein and the gene encoding same and application thereof
By cloning and editing the MINI gene, the plant architecture of alfalfa tribulus was regulated, solving the problem of the lack of a complete regulatory network for plant architecture development in existing technologies, and achieving the effects of reduced plant height, smaller leaves, and increased number of branches.
Patent Information
- Application Number
- CN202311130286.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-09-04
- Publication Date
- 2025-11-04
- Estimated Expiration
- 2043-09-04
AI Technical Summary
In the current technology, the research on genes related to plant architecture development in alfalfa has not formed a complete regulatory network, and there is a lack of effective means to regulate plant architecture.
The MINI gene was cloned, and the MINI gene knockout line mini-3 was constructed using gene editing technology to regulate plant type, reduce plant height, decrease leaf size, and increase the number of branches.
This study achieved effective regulation of plant architecture in alfalfa tribulus, reducing plant height, leaf size, and branching number, providing a genetic engineering method for regulating plant architecture.
Smart Images

Figure HDA0004429877820000011 
Figure HDA0004429877820000021 
Figure HDA0004429877820000031
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of genetic engineering, and particularly relates to a Medicago truncatula plant type development control protein, a gene coding the protein and application thereof. BACKGROUND
[0002] Plant type is a comprehensive agronomic trait, and is an important trait affecting plant population structure and yield formation. Research on forage grass plant type mainly focuses on leaf morphology, plant height, branch number, branch angle, etc. Plant type plays a role at both individual and population levels. Under specific natural environment, plant individual development and population structure interact to obtain reasonable individual plant type and population structure, which can not only improve biological yield, but also improve light transmission and ventilation conditions, reduce occurrence of diseases and insect pests, and reduce pesticide use amount, etc. Plant type determines plant yield potential, harvest index, disease resistance and adaptability to growth environment.
[0003] Leaves are important vegetative organs of plants, and are main sites of photosynthesis, which can convert solar energy and inorganic substances into organic substances for growth and development of plants through a series of photosynthesis processes. Leaf development is an important issue in developmental biology, and leaf size and morphology are very important in forage production, mainly reflected in the following aspects: (1) leaves are main sites of photosynthesis, and are closely related to forage yield; (2) leaf amount directly determines forage nutritional value and quality; and (3) appropriate leaf shape helps to improve photosynthetic efficiency and increase yield, and is closely related to stress response. In view of the important value of leaf development process in improving forage yield and quality, the molecular mechanism affecting leaf development has always been concerned.
[0004] Legume plants are widely distributed in the world, and are one of important sources of protein and oil in human food. In addition, part of legume species are excellent forage grasses, which provide a large amount of protein for livestock. Therefore, it is of great significance to carry out gene function research on legume species. Medicago truncatula belongs to Medicago genus of Leguminosae, and has the advantages of small ploidy (2n = 16), small genome, self-pollination, high genetic transformation efficiency, etc., and is very suitable for genetic mechanism research. Moreover, because Medicago truncatula has good collinearity with Medicago sativa, Glycine max and other plants, research results can be directly applied. In recent years, with the completion of Medicago truncatula genome sequencing and the establishment of various artificial mutant libraries, Medicago truncatula has become an ideal model material for studying legume plants.
[0005] At present, some Medicago truncatula plant type development related genes have been cloned through forward and reverse genetic research methods, but most of them are single trait research, and a complete regulatory network has not been formed. Therefore, it is necessary to provide a plant plant type development control gene and a protein coding the gene. SUMMARY
[0006] The present application aims to provide a protein related to plant architecture and its application.
[0007] In the first aspect, the present application protects a protein related to plant architecture, which is named MINI, and the MINI protein is any one of the following (a1)-(a4):
[0008] (a1) the protein shown in SEQ ID NO: 2 in the sequence listing;
[0009] (a2) a fusion protein obtained by connecting a tag to the N-terminal or / and C-terminal of the protein in (a1);
[0010] (a3) a protein related to plant architecture obtained by substitution and / or deletion and / or addition of one or several amino acid residues of (a1);
[0011] (a4) a protein derived from alfalfa and having more than 98% identity with (a1) and being related to plant architecture.
[0012] In the protein of (a2) above, the tag refers to a polypeptide or protein fused and expressed with the target protein by DNA in vitro recombination technology, so as to facilitate the expression, detection, tracking and / or purification of the target protein. The tag can be Flag tag, His tag, MBP tag, HA tag, myc tag, GST tag and / or SUMO tag, etc.
[0013] In the protein of (a3) above, the substitution and / or deletion and / or addition of one or several amino acid residues is substitution and / or deletion and / or addition of not more than 10 amino acid residues, or not more than 9 amino acid residues, or not more than 8 amino acid residues, or not more than 7 amino acid residues, or not more than 6 amino acid residues, or not more than 5 amino acid residues, or not more than 4 amino acid residues, or not more than 3 amino acid residues, or not more than 2 amino acid residues, or not more than 1 amino acid residue.
[0014] The identity in the protein of (a4) above refers to the identity of the amino acid sequence. The identity of the amino acid sequence can be determined using a homology search site on the Internet, such as the BLAST page of the NCBI homepage. For example, the identity of one pair of amino acid sequences can be calculated by using blastp as the program, setting the Expect value to 10, setting all Filters to OFF, using BLOSUM62 as the Matrix, setting Gap existence cost, Per residue gap cost and Lambda ratio to 11, 1 and 0.85 (default values), respectively, and performing a search in High- Score BLAST 2.1, and then the value of the identity (%) can be obtained.
[0015] The protein of any one of (a1) to (a4) above can be artificially synthesized, or a gene encoding the same can be synthesized first and then expressed biologically.
[0016] In a second aspect, the present application protects a nucleic acid molecule encoding a MINI protein.
[0017] The nucleic acid molecule is a DNA molecule of (b1) or (b2) below:
[0018] (b1) a DNA molecule represented by SEQ ID NO: 1 in the Sequence Listing;
[0019] (b2) a DNA molecule derived from Medicago truncatula and having 75% or more identity to (b1) and encoding the MINI protein.
[0020] Those skilled in the art can easily mutate the nucleotide sequence encoding the MINI protein of the present application using known methods, such as methods of directed evolution and point mutation. Those nucleotides artificially modified to have 75% or more identity to the MINI nucleotide sequence isolated in the present application, as long as they encode the MINI protein and have the same function, are derived from the nucleotide sequence of the present application and equivalent to the sequence of the present application.
[0021] The term "identity" used herein refers to sequence similarity to the natural nucleic acid sequence. The "identity" includes a nucleotide sequence having 75% or more, or 80% or more, or 85% or more, or 90% or more, or 95% or more identity to the nucleotide sequence of the protein consisting of the amino acid sequence represented by SEQ ID NO: 2 of the present application. The identity can be evaluated by the naked eye or computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%) which can be used to evaluate the identity between related sequences.
[0022] In a third aspect, the present application protects an expression cassette, a recombinant vector or a recombinant microorganism containing the nucleic acid molecule.
[0023] The expression cassette refers to DNA capable of expressing MINI protein in a host cell, which can include not only a promoter for initiating MINI transcription, but also a terminator for terminating MINI transcription. Further, the expression cassette can also include an enhancer sequence.
[0024] The vector can be a plasmid, cosmid, bacteriophage or viral vector. The recombinant vector can be a vector containing the DNA molecule for encoding MINI protein shown in SEQ ID NO: 1. In order to facilitate the identification and screening of transgenic plant cells or plants, the plant expression vector used can be processed, such as adding a gene (GUS gene, luciferase gene, etc.) encoding an enzyme or luminescent compound capable of producing a color change that can be expressed in plants, an antibiotic marker (gentamicin marker, kanamycin marker, etc.) with resistance, or an anti-chemical reagent marker gene (such as an anti-herbicide gene).
[0025] The recombinant microorganism can be yeast, bacteria, algae and fungi containing the nucleic acid molecule, the expression cassette or the recombinant vector described above.
[0026] In a fourth aspect, the present application protects a new use of the MINI protein or the nucleic acid molecule or the expression cassette, the recombinant vector or the recombinant microorganism described above.
[0027] The present application protects the use of the MINI protein or the nucleic acid molecule or the expression cassette, the recombinant vector or the recombinant microorganism described above in any one of c1) to c6) below:
[0028] c1) regulating plant architecture;
[0029] c2) regulating plant height;
[0030] c3) regulating plant leaf size;
[0031] c4) regulating plant branch number;
[0032] c5) cultivating a transgenic plant with changed architecture;
[0033] c6) cultivating a transgenic plant with increased plant height and / or larger leaves and / or reduced branch number.
[0034] In a fifth aspect, the present application protects a new use of a substance inhibiting the MINI protein described above.
[0035] The present application protects the use of a substance inhibiting the MINI protein described above in any one of d1) to d6) below:
[0036] d1) regulating plant architecture;
[0037] d2) reducing plant height;
[0038] d3) reducing leaf size;
[0039] d4) increasing the number of branches;
[0040] d5) breeding transgenic plants with altered plant architecture;
[0041] d6) breeding transgenic plants with reduced plant height and / or reduced leaf size and / or increased number of branches;
[0042] The substance inhibiting the above MINI protein can be a substance that inhibits or reduces the activity and / or content of the MINI protein in plants.
[0043] Further, the substance that inhibits or reduces the activity and / or content of the MINI protein in plants can be a substance that inhibits the activity of the above MINI protein or a substance that inhibits the expression of the gene encoding the above MINI protein or a substance that knocks out the gene encoding the above MINI protein.
[0044] The substance that inhibits the activity of the above MINI protein can be any substance that can cause the activity of the above MINI protein in plants to be lost, such as a protein, a polypeptide or a small molecule compound (such as a protein activity inhibitor) that inhibits the synthesis of the above MINI protein or promotes the degradation of the above MINI protein or inhibits the function of the above MINI protein.
[0045] The substance that inhibits the expression of the gene encoding the above MINI protein can be any substance that can cause the gene encoding the above MINI protein in plants to be unable to express, such as a substance (such as miRNA, siRNA, dsRNA, shRNA, etc.) that silences the gene encoding the above MINI protein in plants.
[0046] The substance that knocks out the gene encoding the above MINI protein can be a substance that achieves in any way that the host cell does not produce a functional protein product of the gene, such as removing all or part of the coding gene sequence, introducing a frameshift mutation so that no functional protein is produced, removing or changing the regulatory components (e.g. promoter editing) so that the coding gene sequence is not transcribed, preventing translation by binding to mRNA, etc. Generally, the knockout is carried out at the level of genomic DNA, so that the offspring of the cell also permanently carry the knockout.
[0047] Further, the substance for knocking out the gene encoding the MINI protein can be any substance capable of mutating the gene encoding the MINI protein in the plant (the mutant form can be a deletion mutation and / or an insertion mutation and / or a base substitution) so as to lose activity, such as a zinc finger protein ZFN gene editing system or a TALENs gene editing system or a CRISPR / Cas9 gene editing system or a biological mutagenesis system, etc.
[0048] Still further, the biological mutagenesis system can be a substance for T-DNA insertion, a substance for transposon insertion or a substance for retrotransposon insertion.
[0049] The CRISPR / Cas9 gene editing system comprises sgRNA and Cas9 nuclease.
[0050] In a specific embodiment of the present application, the substance for retrotransposon insertion is a substance for Tnt1 retrotransposon insertion.
[0051] In another specific embodiment of the present application, the target sequence of the sgRNA is TTCACCGCCATAAGAAGATG, ATGGCGGATATCACCGATGA and CGACCTCGAGGTTCTGACGA.
[0052] In a sixth aspect, the present application protects a method for cultivating a transgenic plant with altered plant type and / or reduced plant height and / or smaller leaf and / or increased number of branches.
[0053] The method for cultivating a transgenic plant with altered plant type and / or reduced plant height and / or smaller leaf and / or increased number of branches protected by the present application comprises the step of reducing the content and / or activity of MINI protein in a recipient plant to obtain a transgenic plant; the plant height of the transgenic plant is lower than that of the recipient plant and / or the leaf of the transgenic plant is smaller than that of the recipient plant and / or the number of branches of the transgenic plant is more than that of the recipient plant.
[0054] Further, the method for reducing the content and / or activity of MINI protein in a recipient plant comprises introducing the above-mentioned substance for reducing the content and / or activity of MINI protein into the recipient plant.
[0055] Still further, the substance for reducing the content and / or activity of MINI protein is a substance for Tnt1 retrotransposon insertion or a CRISPR / Cas9 gene editing system.
[0056] In a specific embodiment of the present application, the transgenic plant is a mini-1 homozygous mutant.
[0057] The mini-1 homozygous mutant differs from the wild-type Medicago polymorpha R108 only in that a Tnt1 sequence is inserted between the 5th and 6th positions of the MINI gene sequence (Sequence 1); the Tnt1 sequence is shown as Sequence 3 in the Sequence Listing.
[0058] In another specific embodiment of the present application, the transgenic plant is a MINI gene knockout line mini-3.
[0059] The MINI gene knockout line mini-3 differs from the wild-type Medicago polymorpha R108 only in that a 5-bp base deletion occurs between the 32nd and 36th positions of the MINI gene sequence (Sequence 1).
[0060] In a seventh aspect, the present application provides a method for preparing a transgenic plant.
[0061] The method for preparing a transgenic plant provided by the present application can be any one of the following e1) or e2):
[0062] e1) inserting the DNA molecule shown as Sequence 3 between the 5th and 6th positions of the MINI gene (Sequence 1) of a recipient plant to obtain a transgenic plant; the transgenic plant has a lower plant height than the recipient plant and / or has smaller leaf blades than the recipient plant and / or has more branches than the recipient plant;
[0063] e2) replacing "CCTCATCTTCTTATGGCGG" in the MINI gene (Sequence 1) of a recipient plant with "CCTCATTATGGCGG" to obtain a transgenic plant; the transgenic plant has a lower plant height than the recipient plant and / or has smaller leaf blades than the recipient plant and / or has more branches than the recipient plant.
[0064] Any of the above-mentioned replacements is a homozygous replacement, i.e., the same replacement occurs in homologous chromosomes.
[0065] The smaller leaf blades of any of the above-mentioned transgenic plants than the recipient plant are manifested as smaller leaf area of the transgenic plant than the recipient plant. The leaf area is the leaf area of the top leaflets of compound leaves.
[0066] Any of the above-mentioned branch numbers includes the number of primary branches and / or the number of secondary branches.
[0067] In any of the above-mentioned applications or methods, the plant is any one of the following d1) to d5):
[0068] d1) a monocotyledonous plant;
[0069] d2) a dicotyledonous plant;
[0070] d3) Leguminosae plants;
[0071] d4) Medicago sativa;
[0072] d5) Medicago truncatula.
[0073] The present application firstly finds a Tnt1 insertion mutant mini-1 with changed plant type from a Medicago truncatula Tnt1 insertion mutant library, clones the control gene MINI of the plant type development through whole genome resequencing combined with gene-phenotype linkage analysis, then in order to prove that MINI is the control gene of the plant type development, a natural mutant mini-2 of the MINI gene is screened in the mutant library, and a MINI gene knockout strain mini-3 is also constructed, and it is found through analysis that the phenotypes of mini-2 and mini-3 are completely same as those of the mini-1 mutant. The above results prove that the MINI gene in the present application can regulate the plant type.
[0074] Compared with the prior art, the present application can obtain the following technical effects:
[0075] 1) The present application firstly clones a MINI gene controlling the plant type development of Medicago truncatula, and the gene mutation makes the plant height of the plant decrease, the leaf becomes small, and the branch number increases.
[0076] 2) The MINI gene cloned in the present application can provide evidence for the plant type development research of Leguminosae plants such as Medicago sativa and other dicotyledonous plants. BRIEF DESCRIPTION OF DRAWINGS
[0077] Figure 1 Phenotypes of wild type Medicago truncatula R108 and mini mutant. Wherein, Fig. A and Fig. B are respectively phenotypes of four-week-old wild type Medicago truncatula R108 and mini-1 mutant plants. Fig. C and Fig. D are respectively phenotypes of eight-week-old wild type Medicago truncatula R108 and mini-1 mutant plants. Fig. E and Fig. F are respectively top parts of wild type Medicago truncatula R108 and mini-1 mutant plants. Fig. G is a comparison diagram of eight-week-old wild type Medicago truncatula R108 and mini-1 mutant plants. Fig. H is a phenotype diagram of four-week-old mini-3 mutant plant. Fig. I is a phenotype diagram of four-week-old mini-2 mutant plant. Fig. J is a model diagram of eight-week-old wild type Medicago truncatula R108 and mini-1 mutant plants. Bar = 1 cm.
[0078] Figure 2Figure 1 is a structural diagram of MINI gene and expression detection of MINI gene in mutants. Figure 1A is a structural diagram of MINI gene and insertion position of Tnt1 retrotransposon in mini-1 mutant. Figure 1B is a DNA level identification result, wherein a 1143 bp fragment is amplified in wild-type Medicago truncatula R108 by using MINI gene primers, and a 952 bp fragment is amplified in mini-1 by using Tnt1 specific primers LTR6 and MINI gene R end primers. Figure 1C is a RT-PCR detection result of MINI full-length gene expression in wild-type Medicago truncatula R108 and mini-1 mutant, and compared with wild-type Medicago truncatula R108, MINI gene in mini-1 mutant has no expression. Figure 1D is a base mutation of MINI gene knockout line mini-3.
[0079] Figure 3 Figure 2 is a statistical result of plant height, leaf area and branch number of four-week-old wild-type Medicago truncatula R108 and mini-1 mutant. Figure 2A is a statistical result of plant height of four-week-old wild-type Medicago truncatula R108 and mini-1 mutant. Figure 2B is a statistical result of leaf area of top leaf of compound leaf of the same part of four-week-old wild-type Medicago truncatula R108 and mini-1 mutant. Figure 2C and Figure 2D are statistical results of first branch number and second branch number of four-week-old wild-type Medicago truncatula R108 and mini-1 mutant, respectively. DETAILED DESCRIPTION
[0080] The application will be further described in detail below with specific embodiments. The examples given are only for illustrating the application, and are not intended to limit the scope of the application. The examples provided below can serve as a guide for further improvement by those skilled in the art, and do not constitute any limitation on the application.
[0081] In the following examples, the experimental methods are all conventional methods, and are performed according to the techniques or conditions described in the literature in the art or according to the product instructions, unless otherwise specified. The materials, reagents and the like used in the following examples can be obtained from commercial channels, unless otherwise specified.
[0082] The wild-type Medicago truncatula R108 in the following examples is described in the literature “WOX family transcriptional regulators modulate cytokinin homeostasis during leaf blade development in Medicago truncatula and Nicotiana sylvestris”.
[0083] The pGREB31 vector in the following examples is described in the document "Multiplex CRISPR / Cas9-mediated mutagenesis of alfalfa FLOWERING LOCUS Ta1 (MsFTa1) leads to delayed flowering time with improved forage biomass yield and quality".
[0084] Example 1, obtaining of MINI protein and its encoding gene
[0085] I. Extraction of RNA
[0086] Extraction of RNA from wild-type Medicago truncatula R108 was performed as follows:
[0087] 1. About 0.1 g of plant material was quickly placed in liquid nitrogen, and the sample was ground into powder with liquid nitrogen. Then, 1 mL of Trizol was immediately added, and the mixture was shaken and mixed. If there were more samples, they could be placed on ice first and then processed.
[0088] 2. 200 μL of chloroform was added, and the mixture was shaken and mixed. It was then placed at room temperature for 2 min and centrifuged at 4°C and 12000 x g for 10 min.
[0089] 3. The supernatant was transferred to a new 1.5 mL centrifuge tube, 500 μL of isopropanol was added, and the mixture was inverted and mixed. It was then placed at room temperature for 5 min and centrifuged at 4°C and 12000 x g for 15 min.
[0090] 4. The supernatant was discarded, and 1 mL of 75% ethanol was added to wash the precipitate. It was then centrifuged at 4°C and 7500 x g for 5 min, and the process was repeated once.
[0091] 5. After 2 min, the ethanol was completely absorbed with a syringe, and the mixture was dried at room temperature for 10 min or the ethanol was blown off in a clean bench.
[0092] 6. 30-50 μL of DEPC H2O was added to dissolve the precipitate. If the precipitate was large, it could be shaken to help dissolve.
[0093] 7. After the precipitate was completely dissolved, 1 μL was taken to detect the concentration and purity of RNA using NANO DROP 2000. The remaining RNA was stored at -80°C.
[0094] II. Reverse transcription
[0095] The RNA extracted in step I was used as a template, and a TRANS kit was used for reverse transcription to cDNA. The specific steps are as follows:
[0096] In 200 μL centrifuge tube, 5000 ng RNA and 1 μL Primer Oligo(dTs) were added, DEPC H2O was added to 8 μL, after mixing, the reaction was carried out in PCR instrument, and the reaction conditions were as follows: 65℃ denaturation 5 min, ice bath 2 min. After the reaction was completed, the following components were added in turn: 2 x Ts Uni Reaction Mix 10 μL, RI Enzyme Mix 1 μL, G DNA Remover 1 μL, after mixing, 50℃ incubation 30 min, 85℃ reaction 5 s, -20℃ storage for standby.
[0097] III. PCR amplification
[0098] The cDNA obtained in step two was used as a template, and a primer pair composed of primer MINI-5'UTR-F and primer MINI-3'UTR-R was used for amplification, and a PCR amplification product was obtained. The primer sequences are as follows:
[0099] MINI-5'UTR-F: 5'-TTCGTACCGTAATCTCAACC-3';
[0100] MINI-3'UTR-R: 5'-CACAGGTCAAATGTCCAAAG-3'.
[0101] IV. PCR amplification product detection
[0102] After the PCR amplification product obtained in step three was connected to a T vector, sequencing was carried out, and the coding region sequence (CDS sequence) of the MINI gene was obtained, which is shown as sequence 1 in the sequence table, and encodes the MINI protein shown as sequence 2 in the sequence table, and the MINI protein is composed of 666 amino acid residues.
[0103] Example 2, obtaining of mini mutant and phenotype analysis thereof
[0104] The present application finds a Tnt1 insertion mutant mini-1 with changed plant type from a Medicago Tnt1 insertion mutant library (medicago-mutant.dasnr.okstate.edu), and clones the plant type development control gene MINI through whole genome resequencing combined with flanking sequence analysis. In order to prove that MINI is a plant type development control gene, a natural mutant mini-2 of the MINI gene is screened in the mutant library, and a MINI gene knockout strain mini-3 is also constructed, and it is found that the phenotypes of mini-2 and mini-3 are completely same as those of the mini-1 mutant. The specific steps are as follows:
[0105] I. Obtaining of mini-1 and mini-2 mutants
[0106] This invention obtained two mutants with altered plant type, mini-1 and mini-2, from the Tnt1 insertion mutant library of alfalfa, with the numbers NF2946 and NF18721, respectively.
[0107] 1. Obtaining and analyzing mini-1 mutants
[0108] By screening the *Alfalfa* Tnt1 insertion mutant library, a mutant with reduced plant height, smaller leaves, and increased branching was obtained and named mini-1 (NF2946). To identify the functional gene causing this phenotype, pollen from the mini-1 heterozygous mutant (+ / -) was first applied to the stigma of wild-type *Alfalfa* R108 and backcrossed. After two generations of backcrossing, the segregation ratio of wild-type to mutant phenotypes in the offspring was approximately 3:1, suggesting that the mini-1 phenotype is caused by a single-gene recessive mutation. Then, based on the flanking sequences published on the *Alfalfa* mutant library website, gene-phenotype linkage analysis was performed, and no insertion sites linked to the mini-1 phenotype were found.
[0109] The MINI heterozygote was backcrossed with the parental R108 for one generation, resulting in the segregation of the mini-1 homozygous mutant. ONT third-generation resequencing was performed on pooled samples of the mutant, and the resequencing results were compared with those of wild-type R108. Phenotypic and genotypic linkage verification was performed on possible Tnt1 insertion sites. Primers F and R were designed at positions crossing the Tnt1 insertion site. Using mutant and other wild-type-like DNA as templates, amplification was performed using primers F / R and primers F or R with primer LTR on Tnt1, respectively. The results were used to determine which gene insertion was linked to the mutant, ultimately identifying the MINI gene (Medtr4g102120) linked to the mutant phenotype.
[0110] Compared to wild-type Alfalfa R108, the mutant, when used as a template, can amplify a specific band using MINI gene-specific primers combined with Tnt1-specific primers. Figure 2 B), sequencing and alignment confirmed that the insertion of Tnt1 was the cause. The CDS sequence of the MINI gene is shown in Sequence 1 of the sequence listing. Analysis shows that in the mini-1 mutant, Tnt1 is inserted in the first exon of the MINI gene. Figure 2A) The difference between the homozygous mutant mini-1 and wild type Medicago truncatula R108 is only that a Tnt1 sequence is inserted between the 5th and 6th position of the MINI gene (Sequence 1). The Tnt1 sequence is shown in Sequence 3 in the Sequence Listing. RT-PCR was used to detect the expression of the mini full-length gene in wild type Medicago truncatula R108 and mini-1 mutant. The results show that the MINI gene is not expressed in the mini-1 mutant compared to the wild type Medicago truncatula R108 Figure 2 C).
[0111] 2. Obtaining and analyzing mini-2 mutant
[0112] Further reverse screening of other insert lines was performed using MINI genomic DNA in the Medicago truncatula Tnt1 mutant library. The MINI genomic sequence was searched in the website of the mutant library (medicago-mutant.dasnr.okstate.edu), and NF18721 was ordered again according to the search results and alignment results. It was found that a mutant with the same phenotype as mini-1 could also be isolated from this line, which was named mini-2. Figure 1 I) Sequencing found that this line was not caused by Tnt1 insertion to change the phenotype, but due to the error in the transcription process of MINI, the translated RNA lacked 42 bp of bases at the eighth and ninth exons.
[0113] The difference between the homozygous mutant mini-2 and wild type Medicago truncatula R108 is only that a 42 bp base deletion occurs at the 566-607th position of the MINI gene (Sequence 1), which leads to the inability to translate the MINI protein.
[0114] II. Obtaining mini-3 mutant
[0115] In order to prove that MINI gene is the control gene of the mutant, mini-3, a MINI gene knockout line, was constructed. The specific steps are as follows:
[0116] 1. According to the sequence of MINI gene, gRNA target sequence was designed, and finally three gRNA target sequences were selected, and the target sequences are as follows:
[0117] gRNA-1 target sequence: TTCACCGCCATAAGAAGATG;
[0118] gRNA-2 target sequence: ATGGCGGATATCACCGATGA;
[0119] gRNA-3 target sequence: CGACCTCGAGGTTCTGACGA.
[0120] 2. Commissioning Genesbio Technology Co., Ltd. to synthesize the DNA molecule shown in sequence 4 (containing three gRNA coding gene sequences) and ligate it into -Blunt Zero vector (TransGen Biotech, catalog number CB501-01) to obtain a -Blunt Zero vector; then PCR amplification of the target sequence-containing -Blunt Zero vector using primers M13F and M13R to obtain a PCR amplification product. The primer sequences are as follows:
[0121] M13F: 5'-TGTAAAACGACGGCCAGT-3';
[0122] M13R: 5'-CAGGAAACAGCTATGACC-3'.
[0123] 3. Restriction enzyme Bsa I was used to cleave the PCR amplification product and the CRISPR vector pGREB31, respectively, and then Solution I was used for ligation to obtain the vector pGREB31-MINI.
[0124] 4. The vector pGREB31-MINI was transformed into the leaves of wild-type Medicago truncatula R108 using the Agrobacterium transformation method, and transgenic plants were obtained through tissue culture. After molecular identification and sequencing, a MINI gene knockout line was obtained, denoted as mini-3.
[0125] The specific method of the above Agrobacterium transformation is as follows:
[0126] 1) Preparation of Agrobacterium infection solution
[0127] The Agrobacterium strain used in this experiment is AGL1. The bacteria strain stored at -80°C was activated two days in advance, and the overnight-activated strain was shaken on the second day until saturation. The next day, the strain was transferred 4 hours in advance at a ratio of 1:100, and the OD 600 between 0.6 and 1.2, the leaf treatment can be prepared.
[0128] 2) Leaf treatment
[0129] Select healthy leaves that have grown in the greenhouse for 4 to 6 weeks, and dilute the sodium hypochlorite solution with an effective chlorine content of 3% to 5% to 3% of the original solution. Disinfect the leaves, and treat them for 7 to 12 minutes according to the leaf condition.
[0130] The sterilized leaves are cut into 5-6 horizontal pieces per leaf with a sharp blade. The cut leaves are placed in SH3a liquid medium. At this point, the bacteria are collected by centrifugation at 6000 rpm for 15 min at room temperature, and the supernatant is discarded. The bacterial cells are resuspended in the prepared SH3a liquid medium, and 0.1 mM AS is added to the SH3a liquid medium. This bacterial solution is the infection solution.
[0131] 3) Infection
[0132] The leaves are mixed with the infection solution, ensuring that the bacterial solution completely covers the leaves, and are infected for 20 min. Ultrasonic treatment can be performed before infection according to the state of the leaves.
[0133] 4) Co-culture
[0134] The bacterial solution is poured out, and the excess bacterial solution on the leaves is absorbed with sterile filter paper. The adaxial surface of the leaves is attached to the co-culture medium, and the leaves are treated in the dark at 25°C for 2 days.
[0135] 5) Subculture
[0136] After co-culture, the leaves are transferred to SH3a medium containing antibiotics. Every 2-3 weeks, the leaves are transferred to new medium, and yellow calli grow from the original leaves.
[0137] 6) Differentiation of seedlings
[0138] After the new calli grow, the calli are transferred to SH9 medium and treated with light. Every 2-3 weeks, the calli are transferred to new medium until seedlings grow from the calli. Then, the calli are transferred to 1 / 2MS medium for rooting culture.
[0139] 7) Transplanting
[0140] Healthy seedlings are removed from the medium and transplanted into vermiculite, with attention paid to moisture retention. After the root system of the seedlings is fully developed, the seedlings can be transplanted into soil and cultured normally.
[0141] The sequencing results show that the difference between the MINI gene knockout strain mini-3 and the wild-type Medicago truncatula R108 is only a 5-bp deletion at positions 32-36 of the MINI gene (SEQ ID NO: 1) Figure 2 D).
[0142] III. Phenotype analysis
[0143] Wild-type Medicago truncatula R108, mini mutants (mini-1 and mini-2), and the MINI gene knockout strain mini-3, which have been grown for four and eight weeks, respectively, are subjected to phenotype observation, and the plant height, leaf area, and first and second branch numbers are counted.
[0144] The results are shown in Table 1. Figure 1Figure A and Figure B are the phenotype of wild type Medicago truncatula R108 and mini-1 mutant plant at the fourth week of growth, respectively; Figure C and Figure D are the phenotype of wild type Medicago truncatula R108 and mini-1 mutant plant at the eighth week of growth, respectively; Figure E and Figure F are the top part of wild type Medicago truncatula R108 and mini-1 mutant plant, respectively, and it can be observed that the leaf of mini mutant is significantly smaller; Figure G is the comparison of wild type Medicago truncatula R108 and mini-1 mutant plant at the eighth week of growth; Figure H is the phenotype of mini-3 mutant plant; Figure I is the phenotype of mini-2 mutant plant at the fourth week of growth; and Figure J is the pattern of wild type Medicago truncatula R108 and mini-1 mutant plant at the eighth week of growth, and it can be observed that the number of branches of mini-1 mutant is significantly increased compared with wild type Medicago truncatula R108.
[0145] The measurement results of plant height, leaf area, primary branch number and secondary branch number are shown in Table 1-Table 4, and the statistical results of data are shown in Figure 3 The results show that, compared with wild type Medicago truncatula R108, the plant height of mini-1 mutant plant is significantly reduced, the leaf area is significantly reduced, and the primary branch number and secondary branch number are significantly increased.
[0146] Table 1, plant height (cm) of wild type R108 and mini-1 mutant
[0147] R108 8.1 5.5 7.7 8.1 7.8 7.3 7.1 7.8 9 8 8.4 mini-1 0.8 1.1 1 1.2 1.5 1.0 2.1 1.5 2.0
[0148] Table 2, leaf area (cm2) of wild type R108 and mini-1 mutant 2
[0149] R108 1.074 1.572 1.572 0.889 0.916 1.542 1.55 1.125 1.125 2.022 1.359 mini-1 0.028 0.005 0.021 0.057 0.007 0.016 0.077 0.033 0.046 0.02 0.034
[0150] Table 3, primary branch number (pieces) of wild type R108 and mini-1 mutant
[0151] R108 4 3 4 4 4 4 3 4 4 4 2 mini-1 6 7 6 6 7 6 8 5 9
[0152] Table 4, secondary branch number (pieces) of wild type R108 and mini-1 mutant
[0153] R108 0 0 0 0 0 0 0 0 0 0 mini-1 16 14 15 16 15 14 10 16
[0154] The application has been described in detail. For those skilled in the art, the application can be implemented in a wider range under the same parameters, concentrations and conditions without departing from the spirit and scope of the application and without unnecessary experiments. Although the application gives a specific example, it should be understood that the application can be further improved. In summary, according to the principle of the application, the application intends to include any change, use or improvement of the application, including changes made by conventional techniques known in the art, which deviates from the range disclosed in the application. Some basic features can be applied within the scope of the following attached claims.
Claims
1. The application of a protein-inhibiting substance in any of the following d1)-d4): d1) Reduce plant height; d2) Makes plant leaves smaller; d3) Increase the number of plant branches; d4) Cultivating transgenic plants with reduced plant height and / or smaller leaves and / or increased number of branches; The protein is any one of the proteins described in a1)-a2) below: a1) The protein shown in sequence 2 of the sequence listing; a2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein described in a1); The substance that inhibits the protein is a substance that knocks out the gene encoding the protein; The plant in question is alfalfa.
2. The application according to claim 1, characterized in that: The nucleic acid molecule encoding the protein is a DNA molecule as described in b1) or b2) below: b1) The DNA molecule shown in sequence 1 of the sequence listing; b2) A DNA molecule derived from alfalfa and having more than 75% identity with b1) and encoding the protein thereon.
3. A method for cultivating transgenic plants with reduced plant height and / or smaller leaves and / or increased number of branches, comprising the step of reducing the protein content and / or activity in a recipient plant to obtain the transgenic plant; wherein the transgenic plant has a lower plant height than the recipient plant and / or the leaves of the transgenic plant are smaller than those of the recipient plant and / or the number of branches of the transgenic plant is greater than that of the recipient plant; The protein is any one of the proteins described in a1)-a2) below: a1) The protein shown in sequence 2 of the sequence listing; a2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein described in a1); The plant in question is alfalfa.
4. The method according to claim 3, characterized in that: The method for reducing the content and / or activity of proteins in recipient plants includes the step of introducing a substance that knocks out the gene encoding the protein into the recipient plant.
5. A method for preparing a transgenic plant, comprising either e1) or e2) below: e1) In the recipient plant MINI A DNA molecule as shown in sequence 3 is inserted between the 5th and 6th positions of the gene to obtain a transgenic plant; the transgenic plant is shorter than the recipient plant and / or the leaves of the transgenic plant are smaller than those of the recipient plant and / or the number of branches of the transgenic plant is greater than that of the recipient plant. e2) The recipient plant MINI The "CCTCATCTTCTTATGGCGG" in the gene is replaced with "CCTCATTATGGCGG" to obtain a transgenic plant; the transgenic plant is shorter than the recipient plant and / or the leaves of the transgenic plant are smaller than those of the recipient plant and / or the number of branches of the transgenic plant is greater than that of the recipient plant. The MINI The gene is shown in sequence 1 of the sequence listing; The plant in question is alfalfa.
Citation Information
Patent Citations
Application of MtUNUSUAL FLORAL ORGANS gene to regulation and control on quantity and leaf-stem ratio of leaflet
CN107384939A
Medicago truncatula lour carina flap fusion control gene as well as encoded protein and application thereof
CN116622731A