Recombinant urine modulatory protein fragment with function of inhibiting epidermal growth factor receptor and application of recombinant urine modulatory protein fragment

Abstract

The invention discloses a recombinant urine modulatory protein fragment with an epidermal growth factor receptor inhibiting function and application thereof. The amino acid sequence of the recombinant urine modulin fragment is as shown in SEQ ID No.2. In-vitro experiments prove that the recombinant uromodulin fragment can be combined with EGFR, inhibit EGFR protein expression at a cell culture level, inhibit phosphorylated EGFR, inhibit ERK activity and downstream fibrosis-related factors, and prove that the in-vitro recombinant uromodulin fragment has the effect of inhibiting EGFR. Meanwhile, due to certain modification, the in-vitro recombinant uremodulin fragment exists as a monomer, and a large number of recombinant uremodulin fragments with certain functions can be stably obtained through the preparation method provided by the invention, so that the difficulty of directly extracting a natural uremodulin monomer is avoided; meanwhile, the length of the recombinant uremodulin fragment is shorter than that of natural uremodulin.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to a recombinant uromodulin fragment capable of inhibiting epidermal growth factor receptor function and an application thereof. Background Art

[0002] Uromodulin (UMOD; also known as Tamm-Horsfall protein (THP)) is specifically expressed in renal tubular epithelial cells in the thick ascending limb of the loop of Henle and the proximal distal convoluted tubule. It is secreted into the urine and can be detected in the blood. Mutations in the UMOD gene can cause autosomal dominant chronic tubulointerstitial disease, with renal pathology manifesting as extensive tubular atrophy and interstitial fibrosis, ultimately leading to end-stage renal disease. Studies in genetic diseases and human populations have shown that UMOD is a protective factor against renal injury and is associated with the development and progression of acute kidney injury and chronic kidney disease. In UMOD knockout mice, renal damage is more severe than in controls after ischemia-reperfusion injury, suggesting that UMOD plays a protective role by regulating innate immunity. Uromodulin exists primarily as a monomer in human serum, but at very low concentrations. Micanovic R et al. extracted uromodulin monomers from human urine and injected them intraperitoneally into mice, alleviating the worsening of acute kidney injury in mice with ischemia-reperfusion injury (uromodulin gene knockout), demonstrating for the first time the potential for uromodulin to treat or prevent acute kidney injury. Although Micanovic R et al. extracted uromodulin monomers from urine and exogenously administered them to alleviate the worsening of acute kidney injury, uromodulin in urine is primarily a polymer, making monomer purification very complex and uncertain. Furthermore, due to its low concentration in blood, direct extraction from the blood is difficult, limiting its potential future applications. Summary of the Invention

[0003] The purpose of the present invention is to provide a recombinant uromodulin fragment having the function of inhibiting epidermal growth factor receptor and its application.

[0004] In a first aspect, the present invention protects a recombinant uromodulin fragment, which is named U-EGF.

[0005] The recombinant uromodulin fragment U-EGF protected by the present invention is a protein represented by R1) to R5) as follows:

[0006] R1) amino acid sequence is the protein shown in SEQ ID No. 2;

[0007] R2) A fusion protein having the same function obtained by fusing a tag protein to the carboxyl terminus and / or amino terminus of the protein shown in R1);

[0008] R3) A fusion protein having the same function obtained by fusing a signal peptide to the carboxyl terminus and / or amino terminus of the protein represented by R1) or R2);

[0009] R4) a protein having the same function obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence represented by R1) or R2) or R3);

[0010] R5) A protein having 90% or greater identity with the amino acid sequence represented by R1) or R2) or R3) or R4) and having the same function.

[0011] In R2) above, the tag refers to a polypeptide or protein that is fused and expressed with the target protein using in vitro DNA recombination technology to facilitate the expression, detection, tracing, and / or purification of the target protein. The tag may be a Flag tag, a His tag, an MBP tag, an HA tag, a myc tag, a GST tag, and / or a SUMO tag.

[0012] In the above R3), the recombinant uromodulin fragment consists of a signal peptide, a tag protein, and a protein shown in SEQ ID No. 2 from the amino terminus to the carboxyl terminus. Furthermore, the signal peptide is a signal peptide SP. The tag protein is a 6xHis tag protein.

[0013] In the above R4), the substitution and / or deletion and / or addition of one or several amino acid residues is a substitution and / or deletion and / or addition of no more than 10 amino acid residues, or a substitution and / or deletion and / or addition of no more than 9 amino acid residues, or a substitution and / or deletion and / or addition of no more than 8 amino acid residues, or a substitution and / or deletion and / or addition of no more than 7 amino acid residues, or a substitution and / or deletion and / or addition of no more than 6 amino acid residues, or a substitution and / or deletion and / or addition of no more than 5 amino acid residues, or a substitution and / or deletion and / or addition of no more than 4 amino acid residues, or a substitution and / or deletion and / or addition of no more than 3 amino acid residues, or a substitution and / or deletion and / or addition of no more than 2 amino acid residues, or a substitution and / or deletion and / or addition of no more than 1 amino acid residue.

[0014] In the above R5), the identity includes amino acid sequences having 90% or higher, or 91% or higher, or 92% or higher, or 93% or higher, or 94% or higher, or 95% or higher, or 96% or higher, or 97% or higher, or 98% or higher, or 99% or higher identity with the amino acid sequence shown in SEQ ID No. 2 of the present invention.

[0015] The proteins described in R1) to R5) above can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.

[0016] In a second aspect, the present invention protects a method for preparing the above-mentioned recombinant uromodulin fragment U-EGF.

[0017] The method for preparing the recombinant uromodulin fragment U-EGF protected by the present invention comprises the following steps: expressing the coding gene of the recombinant uromodulin fragment U-EGF in an organism or biological cell to obtain the recombinant uromodulin fragment.

[0018] Furthermore, the method for expressing the recombinant uromodulin fragment U-EGF encoding gene in an organism or biological cell is to introduce the recombinant uromodulin fragment U-EGF encoding gene into the organism or biological cell.

[0019] Furthermore, the coding gene of the recombinant uromodulin fragment U-EGF is a DNA molecule shown by SEQ ID No. 1 or SEQ ID No. 3.

[0020] In a specific embodiment of the present invention, the gene encoding the recombinant uromodulin fragment U-EGF is introduced into an organism or biological cell via the pCAG-SP-6xHis-U-EGF expression vector. The pCAG-SP-6xHis-U-EGF expression vector is obtained by replacing the DNA fragment between the restriction endonuclease sites EcoRI and NotI in the pCAG-GFP plasmid with the DNA molecule represented by SEQ ID No. 3, while keeping the other sequences of the pCAG-GFP plasmid unchanged.

[0021] In a third aspect, the present invention protects a nucleic acid molecule encoding the above-mentioned recombinant uromodulin fragment U-EGF.

[0022] The nucleic acid molecule encoding the recombinant uromodulin fragment U-EGF protected by the present invention is the gene shown in 1) or 2) below:

[0023] 1) The coding sequence is a DNA molecule shown in SEQ ID No. 1 or SEQ ID No. 3;

[0024] 2) A DNA molecule that has more than 75% identity with the DNA molecule defined in 1) and encodes the above-mentioned recombinant uromodulin fragment U-EGF.

[0025] The nucleic acid molecule may be DNA, such as recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA.

[0026] Those skilled in the art can readily mutate the nucleotide sequence encoding the recombinant uromodulin fragment U-EGF of the present invention using known methods, such as directed evolution and point mutagenesis. Artificially modified nucleotide sequences that share 75% or greater identity with the nucleotide sequence encoding the recombinant uromodulin fragment U-EGF are derived from and equivalent to the nucleotide sequence of the present invention, as long as they encode the recombinant uromodulin fragment U-EGF and have the same function.

[0027] In the above 2), the identity refers to sequence similarity with a natural nucleic acid sequence. "Identity" includes nucleotide sequences that are 75% or greater, 80% or greater, 85% or greater, 90% or greater, or 95% or greater identical to the nucleotide sequence of the present invention encoding the protein consisting of the amino acid sequence shown in SEQ ID No. 2. Identity can be assessed visually or with computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to assess the identity between related sequences.

[0028] The aforementioned 75% or greater identity may be 80%, 85%, 90% or 95% or greater identity.

[0029] In a fourth aspect, the present invention protects any one of the following biomaterials S1)-S3):

[0030] S1) an expression cassette containing the above nucleic acid molecule;

[0031] S2) a recombinant vector containing the above nucleic acid molecule;

[0032] S3) A transgenic cell line containing the above nucleic acid molecule.

[0033] In S1) above, the expression cassette refers to DNA capable of expressing the recombinant uromodulin fragment U-EGF in a host cell. This DNA may include not only a promoter for initiating transcription of the recombinant uromodulin fragment U-EGF encoding gene sequence, but also a terminator for terminating transcription of the recombinant uromodulin fragment U-EGF encoding gene sequence. Furthermore, the expression cassette may also include an enhancer sequence.

[0034] In the above S2), the vector may be a plasmid, cosmid, phage or viral vector. Specifically, the plasmid may be a pCAG-GFP plasmid.

[0035] In the above S3), the cell may be a prokaryotic cell or a eukaryotic cell. Specifically, the eukaryotic cell may be a HEK293 cell.

[0036] In a fifth aspect, the present invention protects new uses of the above-mentioned recombinant uromodulin fragment U-EGF or the above-mentioned nucleic acid molecule or the above-mentioned biomaterial.

[0037] The present invention protects the use of the above-mentioned recombinant uromodulin fragment, the above-mentioned nucleic acid molecule, or the above-mentioned biological material in any one of the following T1) to T12):

[0038] T1) inhibiting epidermal growth factor receptor or its ERK1 / 2 pathway;

[0039] T2) Preparation of products that inhibit epidermal growth factor receptor or its ERK1 / 2 pathway;

[0040] T3) as an epidermal growth factor receptor inhibitor;

[0041] T4) preparing epidermal growth factor receptor inhibitors;

[0042] T5) Treatment or prevention of acute renal tubular injury;

[0043] T6) Preparation of products for treating or preventing acute renal tubular injury;

[0044] T7) Treatment of autosomal dominant chronic tubulointerstitial disease;

[0045] T8) Preparation of products for the treatment of autosomal dominant chronic tubulointerstitial disease;

[0046] T9) inhibit renal interstitial fibrosis;

[0047] T10) preparing a product for inhibiting renal interstitial fibrosis;

[0048] T11) Treatment or prevention of diseases mediated by epidermal growth factor receptor or diseases caused by overexpression of epidermal growth factor receptor;

[0049] T12) preparing a product for treating or preventing an epidermal growth factor receptor-mediated disease or a disease caused by overexpression of the epidermal growth factor receptor.

[0050] In a sixth aspect, the present invention protects a product having the function described in any one of the following X1) to X6), wherein the active ingredient is the above-mentioned recombinant uromodulin fragment U-EGF or the above-mentioned nucleic acid molecule or the above-mentioned biological material;

[0051] X1) Inhibit epidermal growth factor receptor or its ERK1 / 2 pathway;

[0052] X2) as an epidermal growth factor receptor inhibitor;

[0053] X3) Treatment or prevention of acute renal tubular injury;

[0054] X4) Treatment of autosomal dominant chronic tubulointerstitial disease;

[0055] X5) inhibit renal interstitial fibrosis;

[0056] X6) Treating or preventing diseases mediated by epidermal growth factor receptor or diseases caused by overexpression of epidermal growth factor receptor.

[0057] In any of the above-mentioned products or applications, the acute renal tubular injury may be acute renal tubular injury caused by chemotherapy drugs.

[0058] The renal interstitial fibrosis may be renal interstitial fibrosis induced by chemotherapy drugs.

[0059] In a specific embodiment of the present invention, the chemotherapy drug may be cisplatin.

[0060] In any of the above products or applications, the disease caused by overexpression of the epidermal growth factor receptor may be a tumor. Furthermore, the tumor may be a tumor with a sensitive mutation in the epidermal growth factor receptor gene, such as non-small cell lung cancer.

[0061] In any of the above products or applications, the amino acid sequence of the epidermal growth factor receptor is shown as SEQ ID No. 4.

[0062] The present invention constructs a fragment (U-EGF) of a specific functional domain of uromodulin that can be recombinantly expressed. In vitro experiments have preliminarily demonstrated that the fragment can bind to the epidermal growth factor receptor (EGFR), inhibiting EGFR protein expression at the cell culture level, while also inhibiting phosphorylated EGFR, ERK activity, and downstream fibrosis-related factors. It has been confirmed that the in vitro recombinant uromodulin fragment (U-EGF) has the effect of inhibiting EGFR, and the preparation method provided by the present invention can stably obtain a large amount of recombinant uromodulin fragments with certain functions, avoiding the difficulty of directly extracting natural uromodulin monomers. At the same time, the molecular weight is much smaller than that of uromodulin monomers, which is convenient for future applications. BRIEF DESCRIPTION OF THE DRAWINGS

[0063] Figure 1 Schematic diagram of the structure of UMOD-pCMV-AC-GPF plasmid.

[0064] Figure 2 Schematic diagram of the structure of pCAG-GFP plasmid.

[0065] Figure 3Schematic diagram of the pCAG-SP-6xHis-U-EGF expression vector. Red boxes indicate restriction endonuclease sites, light blue indicates the CAG promoter, gray indicates the 5' and 3' ends, dark blue indicates the signal peptide, yellow indicates the 6xHis tag, green indicates the GFP on the original plasmid, and blue below indicates the subcloned U-EGF fragment that replaced the GFP insertion.

[0066] Figure 4 The following are the results of Western blot and silver staining of the purified recombinant uromodulin fragment U-EGF. NU: urine-extracted uromodulin; PU: commercial uromodulin; U-EGF: the recombinant uromodulin fragment U-EGF of the present invention.

[0067] Figure 5 The microcalorimetry was used to detect the binding affinity between epidermal growth factor receptor and uromodulin and its recombinant uromodulin fragment U-EGF.

[0068] Figure 6 a: Western blots were used to detect the expression levels of EGFR and its ERK1 / 2 pathway, and fibrosis indicators COL1, VIM, and α-SMA.

[0069] Figure 6 b shows the band intensity of Western blots quantified using ImageJ software. *P < 0.05, comparison between the cisplatin group and the cisplatin plus uromodulin group; #P < 0.05, comparison between the cisplatin group and the cisplatin plus U-EGF group. DETAILED DESCRIPTION

[0070] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.

[0071] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.

[0072] The data statistics used in the following examples are as follows: Numerical variables are expressed as mean ± standard deviation, and categorical variables are expressed as numeric values ​​and percentages. Continuous variables were compared using the independent sample t-test, and categorical variables were analyzed using the chi-square test and Fisher's exact test. Post-hoc multiple-comparison testing was performed to analyze differences between groups. A P value of < 0.05 indicated a statistically significant difference. Data were analyzed using SPSS 22.0.

[0073] Example 1. Preparation and identification of recombinant uromodulin fragment U-EGF

[0074] 1. Construction and identification of the recombinant uromodulin fragment U-EGF expression vector

[0075] 1. PCR amplification of UMOD gene fragment to obtain uromodulin fragment gene

[0076] (1) Amplification template of uromodulin (UMOD) gene

[0077] The UMOD-pCMV-AC-GPF plasmid was used as a template for PCR to obtain the uromodulin (UMOD) fragment.

[0078] (2) Primer design

[0079] Primers were designed using Oligo 7 software. DNA sequences with an appropriate annealing temperature, no primer dimers, and a length of approximately 20 bp were selected before and after each recombinant fragment sequence. The primer sequences are shown in Table 1.

[0080] Table 1. Primers and PCR conditions used for PCR amplification of target fragments

[0081]

[0082] 2. Construction of recombinant uromodulin fragment U-EGF expression vector

[0083] 1) Construction of pCAG-SP-6xHis-GFP expression vector

[0084] Using pCAG-GFP plasmid as the starting plasmid, the GFP sequence in the plasmid was partially replaced with the UMOD gene fragment ( Figure 3 The specific steps are as follows:

[0085] a. UMOD-pCMV-AC-GPF plasmid (Origene, CAT#: RG223787, Origene website: https: / / www.origene.com / catalog / cdna-clones / expression-plasmids / rg223787 / uromuco id-umod-nm_003361-human-tagged-orf-clone, the structure diagram is shown in Figure 1) was used as a template and primers corresponding to the signal peptide SP in Table 1 were used for PCR amplification. The sequence of the UMOD signal peptide (SP) was from the methionine encoded by the start codon ATG to the threonine at position 26 encoded by ACC. At the same time, a 6xHis-tag (for ease of detection and purification) and an AsiSI restriction endonuclease site were added to the C-terminus of the DNA sequence (a new multiple cloning site was introduced because the UMOD gene cDNA contains a SmaI site, so this site cannot be used). The PCR product was obtained, and its nucleotide sequence is as follows: GAATTC (EcoRI)gccacc atg (SP start codon)gggcagccatctctgacttggatgctgatggtggtggtggcctcttggttcatcacaactgcagccactgacacc(SP) ATCATCACCATCACCAC (6xHis)T GCGATCGC (AsiSI) CCCGGG (SmaI)ATCCACCGGTCGCCACC ATGGTG( The GFP part on the original plasmid was subsequently subcloned using the AsiSI site to insert the uromodulin cDNA fragment to replace the original GFP part).

[0086] b. Use restriction enzymes EcoRI and SmaI to clone the pCAG-GFP plasmid (Addgene, catalog number Plasmid#11150, Addgene website: https: / / www.addgene.org / 11150 / , the structure diagram is shown in the figure). Figure 2 The purified PCR product (shown in Figure 2) was digested at 37°C for 2 hours. Separate the fragment using agarose gel electrophoresis, excise the agarose containing the target DNA fragment, and recover the DNA using a kit. The DNA fragment and vector were then ligated using T4 ligase at 16°C. After correct sequencing, pCAG-SP-6xHis-GFP was obtained, and the recombinant protein subsequently had a His-tag at its N-terminus.

[0087] 2) Amplification of the gene encoding the recombinant uromodulin fragment U-EGF

[0088] Using the UMOD-pCMV-AC-GPF plasmid as a template, PCR amplification was performed using the primers corresponding to U-EGF in Table 1 to obtain a PCR product, the nucleotide sequence of which is as follows:

[0089] GCGATCGC(AsiSI)tcagaagcaagatggtgctctgaatgtcacagcaatgccacctgcacggaggatgaggccgttac gacgtgcacctgtcaggagggcttcaccggcgatggcctgacctgcgtggacctggatgagtgcgccattcctggagctcacaactgctccgccaacagcagctgcgtaaacacgccagg ctccttctcctgcgtctgccccgaaggcttccgcctgtcgcccggtctcggctgcacagacgtggatgagtgcgctgagcctgggcttagccactgccacgccctggccacatgtgtcaa tgtggtgggcagctacttgtgcgtatgccccgcgggctaccggggggatggatggcactgtgagtaaGCGGCCGC(NotI).

[0090] 3) Construction of pCAG-SP-6xHis-U-EGF expression vector

[0091] The pCAG-SP-6xHis-GFP expression vector and the purified PCR product were digested with the restriction endonucleases AsiSI and NotI at 37°C for 2 hours. Separate the fragments by agarose gel electrophoresis, excise the agarose containing the target DNA fragment, and recover the DNA using a kit. Ligate the DNA fragment and the vector using T4 ligase at 16°C. Once sequenced correctly, the pCAG-SP-6xHis-U-EGF expression vector was obtained.

[0092] The pCAG-SP-6xHis-U-EGF expression vector is obtained by replacing the GFP sequence between the AsiSI and NotI restriction sites in the pCAG-SP-6xHis-GFP expression vector with the recombinant uromodulin fragment U-EGF encoding gene shown in SEQ ID No. 1, while keeping the other sequences of the pCAG-SP-6xHis-GFP expression vector unchanged.

[0093] 4) Sequencing and identification of the pCAG-SP-6xHis-U-EGF expression vector

[0094] N-terminal sequencing used the pCAG-F sequencing primer, with the sequence: CGGCTCTAGAGCCTCTGCTAAC; C-terminal sequencing used the pCAG-R sequencing primer, with the sequence: CAGTGGTATTTGTGAGCCAG. Bidirectional sequencing was used, and sequences that were consistent in both directions were considered correct.

[0095] Sequencing results indicate that the pCAG-SP-6xHis-U-EGF expression vector is derived by replacing the DNA fragment between the restriction endonuclease sites EcoRI and NotI in the pCAG-GFP plasmid with the DNA molecule shown in SEQ ID No. 3, while maintaining the remaining sequence of the pCAG-GFP plasmid unchanged. The pCAG-SP-6xHis-U-EGF expression vector can express the recombinant uromodulin fragment U-EGF, the amino acid sequence of which is shown in SEQ ID No. 2.

[0096] The plasmids with correct sequencing results were selected for the following cell culture experiments.

[0097] 2. Expression, Purification, and Identification of the Recombinant Uromodulin Fragment U-EGF

[0098] The specific steps for expression, purification and identification of the recombinant uromodulin fragment U-EGF are as follows:

[0099] 1. Cell recovery

[0100] ① Culture medium preparation: 500 ml of DMEM high glucose medium (Corning, 10-013-CVR) + 50 ml of fetal bovine serum (Gibco, 10099141) + 5 ml of double antibody (Lambolide, 03-031-1B).

[0101] ②Preheat culture medium at 37℃.

[0102] ③ Take out HEK293 cells (Invitrogen, CBP60438) from the liquid nitrogen tank and gently shake the cells in a 37°C water bath to quickly melt the cells.

[0103] ④ Add the cell solution to a 15ml centrifuge tube containing 10ml of culture medium and centrifuge at 800-1000rpm for 5min.

[0104] ⑤Discard the supernatant, collect the precipitate, add 10ml of culture medium to the precipitate, mix well by pipetting, and transfer the suspension to a 100mm 2 Sterile culture flasks were placed in a 37°C, 5% CO2 cell incubator overnight.

[0105] ⑥Observe the cell growth on the next day. If the cells adhere well to the wall, discard the old culture medium and add 10 ml of fresh culture medium to continue culturing. Change the medium every other day.

[0106] 2. Cell Passaging

[0107] ①Cells were passaged when they grew to 80%-90% of the culture flask area.

[0108] ②Discard the old culture medium and gently rinse twice with sterile PBS.

[0109] ③ Digest the cells by adding 0.5-1 ml of 0.25% EDTA trypsin and incubating at 37°C for 30 seconds to 1 minute. Under the microscope, the cells can be seen to become round and float. Add 5 ml of culture medium to terminate the digestion. Transfer the mixture into a 50 ml centrifuge tube and centrifuge at 800-1000 rpm for 5 minutes.

[0110] ④Discard the supernatant, collect the precipitate, add 6 ml of fresh culture medium to the precipitate, mix it by pipetting, and add 100 mm tubes containing 8 ml of fresh culture medium at a ratio of 1:3. 2 In culture flask.

[0111] 3. Cell transfection

[0112] 1) Cell counting and plating:

[0113] ① Digest the cells into a single-cell suspension 24-36 hours before transfection (see cell passaging for steps).

[0114] ② Place the coverslips on the two chambers of the hemocytometer.

[0115] ③Pipette 10 μl of single cell suspension at 45°C and quickly inject it into the junction of the coverslip and the counting plate.

[0116] ④Observe and count under a microscope. Record the total number of cells in the four large grids of the cell counting plate. Only count intact cells, and only count the cells on the left and above the line. Then calculate according to the formula: number of cells in cell suspension / ml = total number of cells in 4 large grids / 4*10 4 .

[0117] ⑤In 10cm 2 1×10 6 Before transfection, replace the serum-containing medium with serum-free medium.

[0118] 2) Transfection:

[0119] ① When the cells have grown to 60%-70% of the culture flask area (24-36 hours), transfection can be performed.

[0120] ② Each 10cm 2The cell culture flask was transfected with 10 μg of plasmid (pCAG-SP-6xHis-U-EGF) at a ratio of 1:2 between plasmid and transfection reagent.

[0121] ③ Before use, shake the transfection reagent X-treme GENE HP (Roche, 6365787001), mix the plasmid and transfection reagent with 500 μl serum-free culture medium respectively, shake them separately, then mix the two together, shake and mix them, and let them stand for 15 minutes.

[0122] ④ Add the plasmid and transfection reagent mixture to the culture flask and gently swirl the flask to ensure even distribution. Collect the supernatant after 48-60 hours.

[0123] 4. Purification of recombinant uromodulin fragment U-EGF

[0124] The recombinant uromodulin fragment U-EGF was purified using Ni-beads magnetic beads. The specific steps are as follows:

[0125] (1) Collect the supernatant of transfected cells, centrifuge at 3000 rpm / min for 10 min, and retain the supernatant.

[0126] (2) Sample processing: Filter the supernatant with a 0.2 μm filter to remove cells and debris. Then, concentrate 30 ml of the supernatant to 5 ml using a 30 kD ultrafiltration concentrator. Mix with 5 ml of binding buffer to prepare a crude protein sample.

[0127] (3) Magnetic bead pretreatment: Vortex the magnetic beads and pipette 5 ml into a 15 ml centrifuge tube. Place the tube on a magnetic rack and wait for the beads to separate from the storage solution. Discard the supernatant. Add 5 ml of binding buffer, invert the tube for 1-2 minutes, place the tube on a magnetic rack, and discard the supernatant. Repeat this step twice.

[0128] (4) Binding of target protein to magnetic beads: Mix the crude protein sample obtained in step (2) with the magnetic beads treated in step (3), place on a rotary mixer, and rotate at 4°C for 1-2 hours. Then place on a magnetic stand and keep the supernatant as a control.

[0129] (5) Magnetic bead washing: Take 10 ml of washing buffer and add it to the magnetic beads. Invert the beads upside down for 1-2 minutes to thoroughly wash the beads. Place them on a magnetic rack and discard the supernatant. Repeat this step once.

[0130] (6) Elution of target protein: Take 5 ml of elution buffer with imidazole concentrations of 100 mM, 200 mM and 300 mM, mix with magnetic beads, turn upside down for 1-2 minutes, separate by magnetic separation, and keep the supernatant.

[0131] (7) The eluate containing the target protein was filtered through a 0.2 μm filter membrane, then added to a 14 kD dialysis bag, and then placed in a large amount of deionized water and dialyzed overnight at 4°C.

[0132] (8) The dialyzed protein sample was placed in a 30 kDa ultrafiltration concentrator tube and ultrafiltered at 3000 rpm / min to obtain the target protein solution (the target protein was the recombinant uromodulin fragment U-EGF, and the solvent was deionized water). The protein concentration in the target protein solution was determined using the BCA method.

[0133] (9) The target protein solution obtained in step (8) was mixed with the loading buffer, and Coomassie brilliant blue staining and Western blot detection were performed to detect the purity of the target protein ( Figure 4 ).

[0134] 5. Identification of the recombinant uromodulin fragment U-EGF

[0135] Western blot was used to detect the extracted recombinant uromodulin fragment U-EGF. The specific steps are as follows:

[0136] (1) Glue preparation: Prepare 1.5 mm 10% SDS-PAGE separation gel. Add the separation gel to the green frame of the gel rack and add deionized water to flatten it. After the gel solidifies, pour out the deionized water and add the concentrated gel. Immediately insert the comb and place it at room temperature until the gel solidifies. Without removing the comb, it can be placed at 4°C for one week for future use.

[0137] (2) Sample loading: Take the same mass of protein sample, dilute to volume with appropriate amount of deionized water, add 5× loading buffer, place in a 99℃ metal bath for 10 minutes, cool, mix and load the sample.

[0138] (3) Electrophoresis: First, maintain a constant voltage of 90V. After reaching the separation gel, adjust the voltage to 110V.

[0139] (4) After electrophoresis, remove the gel and cut off and discard the excess part of the gel.

[0140] (5) Transfer: Prepare two sheets of thick filter paper and one polyvinylidene fluoride membrane (PVDF membrane), with the membrane slightly larger than the gel. Moisten the filter paper with transfer buffer and activate the PVDF membrane with anhydrous methanol. Immerse the separation gel in transfer buffer and wash it, then place it on the membrane. Place one sheet of thick filter paper on each side, squeeze out the bubbles in the middle, and transfer the gel side as the negative electrode and the PVDF membrane side as the positive electrode at 4°C or in an ice bath. Constant current 300mA for 90min.

[0141] (6) Blocking: After the transfer is completed, remove the membrane, rinse gently with TBST, and then use TBST containing 5% skim milk powder as a blocking solution and shake at room temperature for 1 hour (the blocking time can be appropriately extended).

[0142] (7) Add primary antibody: dilute sheep anti-human uromodulin monoclonal antibody at a ratio of 1:500 in blocking solution and incubate at 4°C overnight.

[0143] (8) Wash the PVDF membrane with TBST three times, 10 min each time (the time can be extended appropriately).

[0144] (9) Add secondary antibody: Dilute horseradish peroxidase (HRP)-labeled mouse anti-sheep IgG antibody in blocking solution at a ratio of 1:1000 and shake at room temperature for 1 h.

[0145] (10) Wash the PVDF membrane three times with TBST, each time for 10 min (the time can be extended appropriately).

[0146] (11) Use chemiluminescent solution for color development. Mix equal volumes of solution A and solution B and drop them onto the PVDF membrane so that the solution is evenly spread over the entire membrane.

[0147] (12) Color development: Place the membrane in a GE Image Quant LAS4000 chemiluminescence imaging analyzer for exposure and color development, and observe and save the image.

[0148] The results of Western blot analysis of the purified recombinant uromodulin fragment U-EGF are shown in Figure 2. Figure 4 shown.

[0149] Example 2: Microthermophoresis (MST) detection of the binding affinity between epidermal growth factor receptor (EGFR) and uromodulin and its recombinant fragment (recombinant uromodulin fragment U-EGF)

[0150] The present invention uses a microthermophoresis method to detect the binding ability of epidermal growth factor receptor (EGFR) with natural uromodulin and its recombinant fragment (U-EGF), and the specific steps are as follows:

[0151] 1. Recombinant human EGFR active protein (ab155639, Abcam) was labeled with red fluorescence. The concentration was maintained at 23.5 nM during detection. The buffer used was MST buffer containing 0.5% Tween reagent.

[0152] 2. Recombinant human EGF active protein (ab259398, Abcam) was used as a positive control, with dilutions starting at 41.5 μM. Commercial human uromodulin (mybiosource, Catalog No. MBS537268) was diluted starting at 4.55 μM. Recombinant uromodulin fragment U-EGF was diluted starting at 6.45 μM. All three test ligands were diluted 1:1 from their highest concentration through 16 dilutions, then mixed with fluorescently labeled EGFR at a 1:1 volume ratio.

[0153] 3. Aspirate 16 series of solutions into capillaries (Monolith NT.115 Capillaries), load them onto the NanoTamper, and test them using medium-intensity MST energy.

[0154] 4. Data analysis and plotting were performed using MO Affinity Analysis Software (Nano Temper) and MO Affinity Analysis Software (Nano Temper), respectively.

[0155] The results are as follows Figure 5 The results showed that the KD value of the positive reference active epidermal growth factor was 397±94nM, the KD value of natural uromodulin was 176±133nM, and the KD value of the recombinant uromodulin fragment U-EGF was 628±173nM. This indicates that the binding ability of natural uromodulin and recombinant uromodulin fragment U-EGF to epidermal growth factor is similar to that of the positive reference epidermal growth factor.

[0156] Example 3: Cell experiments confirm that uromodulin and its recombinant fragment (recombinant uromodulin fragment U-EGF) regulate the epidermal growth factor pathway

[0157] 1. Human renal cortical proximal tubule epithelial cells HK-2 (ATCC, USA) were cultured in DMEM medium (11330032, Invitrogen) containing 10% fetal bovine serum (10099141, Gibco) and 1% penicillin-streptomycin (15140122, Invitrogen) at a constant temperature of 37°C in an atmosphere of 5% CO2 and 95% air.

[0158] 2. HK-2 cells were cultured at 5×10 5 Each well was evenly plated in a six-well plate, and three replicate wells were set up for each experimental group.

[0159] 3. After culturing for 24 hours, different reagents were added to the culture medium of the six-well plate. According to the different reagents added, the cells were divided into the following groups:

[0160] Cisplatin group: Cisplatin solution (solvent: physiological saline, final concentration: 100 ng / ml) was added to the culture medium of a six-well plate.

[0161] Cisplatin + natural uromodulin (Cisplatin + uromodulin): Add cisplatin solution (solvent: normal saline, final concentration: 100 ng / ml) and commercial human uromodulin (mybiosource, catalog number MBS537268) solution (solvent: deionized water, final concentration: 1 ug / ml) to the culture medium of a six-well plate.

[0162] Cisplatin + recombinant uromodulin fragment (Cisplatin + U-EGF): Add cisplatin solution (solvent: normal saline, final concentration: 100 ng / ml) and recombinant uromodulin fragment U-EGF solution (solvent: deionized water, final concentration: 1 ug / ml) to the culture medium of a six-well plate.

[0163] Normal control group (Control): Add an equal amount of normal saline.

[0164] 4. After 48 hours of co-culture, the culture medium was removed and the cells were washed twice with pre-cooled PBS. 100 μl of cell lysis buffer (P0013, Beyotime) containing protease and phosphatase inhibitors was added to each well to extract total cell protein and measure the concentration.

[0165] 5. After denaturation of total cell protein, Western blots were performed. Primary antibodies used included rabbit anti-EGFR (pY1068) monoclonal antibody (Abcam), rabbit anti-EGFR monoclonal antibody (Abcam), mouse anti-pERK1 / 2 monoclonal antibody (Santa Cruze), mouse anti-ERK1 / 2 monoclonal antibody (Santa Cruze), rabbit anti-VIM monoclonal antibody (CST), rabbit anti-COL1 monoclonal antibody (Abcam), and mouse anti-α-SMA monoclonal antibody (Booster). Secondary antibodies included HRP-goat anti-mouse IgG (Zhongshan Jinqiao) and HRP-goat anti-rabbit IgG (Santa Cruze).

[0166] 6. Use the ImageQuant LAS 4000mini system instrument to take luminescent pictures and use ImageJ software to quantify the band intensity.

[0167] Western Blots detection and semi-quantitative quantification results are as follows Figure 6 Results showed that cisplatin activated the EGFR and ERK1 / 2 pathways, and increased expression of fibrotic markers COL1, VIM, and α-SMA in renal tubular epithelial cells. Addition of native uromodulin during cisplatin incubation reduced activation of the EGFR and ERK1 / 2 pathways, as well as expression of fibrotic markers in renal tubular epithelial cells. Addition of the recombinant uromodulin fragment, U-EGF, significantly decreased activation of the EGFR and ERK1 / 2 pathways (p < 0.05), as well as expression of fibrotic markers in renal tubular epithelial cells (p < 0.05). These results suggest that uromodulin and its recombinant fragment, U-EGF, may inhibit cisplatin-induced expression of fibrotic factors in renal tubular epithelial cells by inhibiting the epidermal growth factor and ERK1 / 2 pathways, thereby inhibiting renal interstitial fibrosis.

[0168] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be practiced over a wide range of parameters, concentrations, and conditions without departing from the spirit and scope of the present invention and without unnecessary experimentation. Although specific embodiments have been given herein, it should be understood that further modifications may be made to the present invention. In summary, this application is intended to encompass any variations, uses, or improvements to the present invention, including those made by conventional techniques known in the art that depart from the scope of the present invention. Applications of the essential features may be made within the scope of the following claims.

Claims

1. The recombinant uromodulin fragment U-EGF is a protein shown in R1)-R5) below: R1) The amino acid sequence is the protein shown in SEQ ID No. 2; R2) A fusion protein having the same function obtained by fusing a tag protein to the carboxyl terminus and / or amino terminus of the protein shown in R1); R3) A fusion protein having the same function obtained by fusing a signal peptide to the carboxyl terminus and / or amino terminus of the protein shown in R1) or R2); R4) a protein having the same function obtained by replacing and / or deleting and / or adding one or more amino acid residues in the amino acid sequence shown in R1) or R2) or R3); R5) is a protein having 90% or more identity with the amino acid sequence represented by R1) or R2) or R3) or R4) and having the same function.

2. The recombinant uromodulin fragment U-EGF according to claim 1, characterized in that: The recombinant uromodulin fragment U-EGF is composed of a signal peptide, a tag protein and a protein shown in SEQ ID No. 2 in sequence from the amino end to the carboxyl end.

3. A method for preparing the recombinant uromodulin fragment U-EGF according to claim 1 or 2, characterized in that: The method comprises the following steps: expressing the coding gene of the recombinant uromodulin fragment U-EGF according to claim 1 or 2 in an organism or biological cell to obtain the recombinant uromodulin fragment U-EGF according to claim 1 or 2.

4. The method according to claim 3, characterized in that: The method for expressing the coding gene of the recombinant uromodulin fragment U-EGF according to claim 1 or 2 in an organism or biological cell is to introduce the coding gene of the recombinant uromodulin fragment U-EGF according to claim 1 or 2 into the organism or biological cell.

5. The method according to claim 3 or 4, characterized in that: The coding gene of the recombinant uromodulin fragment U-EGF is a DNA molecule shown in SEQ ID No.1 or SEQ ID No.

3.

6. A nucleic acid molecule encoding the recombinant uromodulin fragment U-EGF according to claim 1 or 2.

7. The nucleic acid molecule according to claim 6, characterized in that: The nucleic acid molecule is the gene shown in 1) or 2) below: 1) The coding sequence is a DNA molecule shown in SEQ ID No. 1 or SEQ ID No. 3; 2) A DNA molecule which has 75% or more identity with the DNA molecule defined in 1) and encodes the recombinant uromodulin fragment U-EGF according to claim 1 or 2.

8. Any biological material in S1)-S3) below: S1) an expression cassette containing the nucleic acid molecule according to claim 6 or 7; S2) a recombinant vector containing the nucleic acid molecule according to claim 6 or 7; S3) A transgenic cell line containing the nucleic acid molecule according to claim 6 or 7.

9. Use of the recombinant uromodulin fragment according to claim 1 or 2, the nucleic acid molecule according to claim 6 or 7, or the biomaterial according to claim 8 in any one of the following T1) to T12): T1) inhibit epidermal growth factor receptor or its ERK1 / 2 pathway; T2) Preparation of products that inhibit epidermal growth factor receptor or its ERK1 / 2 pathway; T3) as an epidermal growth factor receptor inhibitor; T4) preparing epidermal growth factor receptor inhibitors; T5) Treatment or prevention of acute renal tubular injury; T6) Preparation of products for treating or preventing acute renal tubular injury; T7) Treatment of autosomal dominant chronic tubulointerstitial disease; T8) Preparation of products for the treatment of autosomal dominant chronic tubulointerstitial disease; T9) inhibits renal interstitial fibrosis; T10) preparing products for inhibiting renal interstitial fibrosis; T11) Treatment or prevention of diseases mediated by epidermal growth factor receptor or diseases caused by overexpression of epidermal growth factor receptor; T12) Preparation of products for treating or preventing diseases mediated by epidermal growth factor receptor or diseases caused by overexpression of epidermal growth factor receptor.

10. A product having any of the functions described in X1) to X6), wherein the active ingredient is the recombinant uromodulin fragment described in claim 1 or 2, or the nucleic acid molecule described in claim 6 or 7, or the biomaterial described in claim 8; X1) Inhibit epidermal growth factor receptor or its ERK1 / 2 pathway; X2) as an epidermal growth factor receptor inhibitor; X3) Treat or prevent acute renal tubular injury; X4) Treatment of autosomal dominant chronic tubulointerstitial disease; X5) inhibit renal interstitial fibrosis; X6) Treating or preventing diseases mediated by epidermal growth factor receptor or diseases caused by overexpression of epidermal growth factor receptor.

Images