Bursaphelenchus xylophilus Esg18 gene, dsRNA and interference vector thereof, and application in prevention and control of bursaphelenchus xylophilus

Abstract

The invention discloses an application of a pine wood nematode Esg18 gene and dsRNA thereof in prevention and treatment of pine wood nematode. The invention firstly discloses the application of the pine wood nematode Esg18 gene in prevention and treatment of pine wood nematode, and the nucleotide sequence of CDS of the pine wood nematode Esg18 gene is as shown in SEQ ID No.1. The invention further provides dsRNA designed by taking the Esg18 gene as a target gene and an interference vector containing the dsRNA. The dsRNA obtained through design is applied to prevention and treatment of pine wood nematodes, and the result shows that the fatality rate of the dsRNA for prevention and treatment of the pine wood nematodes reaches 88.37%.

Description

Technical Field

[0001] The invention relates to a new use of pine wood nematode genes, in particular to the use of pine wood nematode Esg18 genes and dsRNA thereof in preventing and controlling pine wood nematodes, and belongs to the field of new genes for resisting pine wood nematodes. Background Art

[0002] RNA interference (RNAi) is a post-transcriptional gene regulation phenomenon that specifically silences target genes mediated by double-stranded RNA (dsRNA). Current studies have shown that there are three main types of RNA molecules that can induce gene silencing in organisms: dsRNA / siRNA (small-interfering RNAs), miRNA (micro-RNA), and piRNA (PIWI-interacting RNA). Among them, dsRNA / siRNA is exogenous dsRNA produced in the body by exogenous virus replication or the expression of RNA and DNA virus genes. These dsRNA molecules are recognized and cut by Dicer-like enzymes (DCL) in the body to form siRNA. Then the siRNA molecules begin to recruit AGO proteins to form RNA-induced silencing complexes (RISC), in which one chain of siRNA acts as a guide chain to recognize and target specific endogenous RNAs for degradation through the principle of base complementary pairing (Rosa C., Kuo Y.W., Wuriyanghan H., et al. RNA interference mechanisms and applications inplant pathology [J]. Annual Review of Phytopathology, 2018, 56: 581-610.). RNA-dependent RNA polymerases (RdRP) exist in organisms, which use siRNA as a template to regenerate dsRNA to produce secondary cascade reactions, thereby amplifying the RNAi effect (Voinnet O. Use, tolerance and avoidance of amplified RNA silencing by plants [J]. Trends in Plant Science, 2008, 13 (7): 317-328.). Since its inception, RNAi technology has been widely used and has great application prospects in gene function research, pest control, and pathogen control.

[0003] At present, RNAi has been very successfully applied to coleopteran insects. For example, the expression of hpRNAs in corn to resist Diabrotica virgifera has achieved very good application results. Some insects in Lepidoptera can also be successfully controlled using RNAi technology (Baum JA, Bogaert T., Clinton W., et al. Control of coleopteran insect pests through RNA interference [J]. Nature Biotechnology, 2007, 25 (11): 1322-1326.). For example, expressing dsRNA targeting the detoxification functional gene cytochrome P450 in cotton bollworm in cotton successfully led to the downregulation of the expression level of this gene in the larvae of cotton bollworm. Subsequently, the larvae of cotton bollworm became more sensitive to gossypol in cotton leaves, thereby hindering the normal growth of the larvae (Mao YB, Cai WJ, Wang JW, et al. Silencing a cotton bollworm P450 monooxygenase gene by plant mediated RNAi impairs larval tolerance of gossypol [J]. Nature Biotechnology, 2007, 25 (11): 1307-1313.).

[0004] In 1998, double-stranded RNA (dsRNA) was injected into the intestine of Caenorhabditis elegans to silence homologous genes, proving for the first time that RNAi existed in nematodes (Fire A., Xu S., Montgomery MK, et al. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans [J]. Nature, 1998, 391 (6669): 806-811.). In 2002, a study proved that plant parasitic nematodes also have RNAi (Urwin PE, Lilley CJ, Atkinson H J. Ingestion of double-stranded RNA by preparasitic juvenile cystnematodes leads to RNA interference [J]. Molecular Plant-Microbe Interaction, 2002, 15 (8): 747-752). Subsequently, the same treatment method was widely used in the study of pine wood nematodes. Some scholars have explored the role of Bxpel1 gene (pectate lyase 1 gene) in the infection process of pine wood nematode by dsRNA immersion method and found that after the gene expression was downregulated, the migration speed and reproductive capacity of pine wood nematode in pine trees decreased, indicating that this gene is an important pathogenic factor of pine wood nematode (Qiu X, Wu X, Huang L, et al. Influence of Bxpel1 gene silencing by dsRNA interference on the development and pathogenicity of the pine wood nematode, Bursaphelenchus xylophilus [J] International Journal of Molecular Science, 2016, 17 (1): 125.).In addition, pine wood nematodes feeding on transgenic Fusarium oxysporum were used to prove that the Bx-dpy-2, 4, 10, and 11 genes in pine wood nematodes are related to the regulation of nematode development (Wang M, Wang D, Zhang X, et al. Double-stranded RNA-mediated interference of dumpy genes in Bursaphelenchus xylophilus by feeding onfilamentous fungal transformants[J]. International Journal for Parasitology, 2016, 46(5-6): 351-360).

[0005] If the key target gene essential for the function of pine wood nematode is screened from the gene of pine wood nematode and the dsRNA that is effective in controlling pine wood nematode is designed and screened based on the target gene, it will have important application prospects in the biological control of pine wood nematode. Summary of the invention

[0006] The main purpose of the present invention is to provide the application of the pine wood nematode Esg18 gene and its dsRNA in preventing and controlling the pine wood nematode.

[0007] The above object of the present invention is achieved through the following technical solutions:

[0008] One aspect of the present invention provides the use of the pine wood nematode Esg18 gene as a dsRNA target gene in controlling pine wood nematodes, wherein the nucleotide sequence of the CDS of the pine wood nematode Esg18 gene is shown in SEQ ID No.1.

[0009] Another aspect of the present invention is to provide a dsRNA designed with the pine wood nematode Esg18 gene as a target gene, wherein the dsRNA is selected from any one of the following (1)-(7):

[0010] (1) The dsRNA consists of a sense strand and an antisense strand that is reverse complementary to the sense strand, and the nucleotide sequence of the sense strand of the dsRNA is shown in SEQ ID No. 2;

[0011] (2) The dsRNA consists of a sense strand and an antisense strand that is reverse complementary to the sense strand, and the nucleotide sequence of the sense strand of the dsRNA is shown in SEQ ID No. 3;

[0012] (3) The dsRNA consists of a sense strand and an antisense strand that is reverse complementary to the sense strand, and the nucleotide sequence of the sense strand of the dsRNA is shown in SEQ ID No. 4;

[0013] (4) The dsRNA consists of a sense strand and an antisense strand that is reverse complementary to the sense strand, and the nucleotide sequence of the sense strand of the dsRNA is shown in SEQ ID No. 5;

[0014] (5) The dsRNA consists of a sense strand and an antisense strand that is reverse complementary to the sense strand, and the nucleotide sequence of the sense strand of the dsRNA is shown in SEQ ID No. 6;

[0015] (6) The dsRNA consists of a sense strand and an antisense strand that is reverse complementary to the sense strand, and the nucleotide sequence of the sense strand of the dsRNA is shown in SEQ ID No. 7;

[0016] (7) The dsRNA consists of a sense strand and an antisense strand that is reverse complementary to the sense strand, and the nucleotide sequence of the sense strand of the dsRNA is shown in SEQ ID No.8.

[0017] Another aspect of the present invention is to apply the dsRNA to control pine wood nematodes, including treating pine wood nematodes with the dsRNA to interfere with or reduce the expression of the Esg18 gene in pine wood nematodes.

[0018] Another aspect of the present invention is to provide an expression vector containing the dsRNA. Preferably, the expression vector is an RNA interference vector.

[0019] Another aspect of the present invention provides a pesticide composition for controlling pine wood nematodes, wherein the pesticide composition contains an effective amount of dsRNA for controlling pine wood nematodes or a vector system containing the dsRNA.

[0020] The present invention applies the dsRNA to the prevention and treatment of pine wood nematodes. The results show that the mortality rate of dsRNA for the prevention and treatment of pine wood nematodes reaches 88.37%, indicating that the dsRNA provided by the present invention has certain application prospects in the prevention and treatment of pine wood nematodes. DETAILED DESCRIPTION

[0021] The present invention will be further described below in conjunction with specific embodiments, and the advantages and features of the present invention will become clearer as the description proceeds. However, these embodiments are exemplary only and do not constitute any limitation to the scope of the present invention. It should be understood by those skilled in the art that the details and forms of the present invention may be modified or replaced without departing from the spirit and scope of the present invention, but these modifications and replacements all fall within the scope of protection of the present invention.

[0022] Example 1 Analysis and identification of pine wood nematode Esg18 gene as an insect resistance target gene

[0023] Through the genome analysis of pine wood nematode, four possible essential genes Esg18 of pine wood nematode were screened (GenBank accession number in NCBI: CAG9108384.1). Currently, there is no report on the function of this gene.

[0024] This experiment conducted the first sequence analysis and dsRNAs design for this target gene. Esg 18 is 2846 bp in length, contains 9 introns, and encodes a 475aa protein; the nucleotide sequence of the CDS of the pine wood nematode Esg18 gene is shown in SEQ ID No. 1:

[0025] ATGGAAGAAGAGGGTACTTCTTCGAATCCGTTATCAGACGACATCC

[0026] ATTGGAGGTTTTCTCAAGTTAAAGGGATCATAGAAACCGACGAACA

[0027] ACCGACTGATGTAGACCTAATATCATGCGTGGAGTTCTCGGACGAC

[0028] GGAGAACTACTGGCAACTGGAGACAAAGGTGGACGAGTCGTTATTT

[0029] TTCAAAGGAATCAGTCGTGGAATTATTCTGGAAACAGAAGCAGTGA

[0030] ATACAACGTCTACTCCACTTTCCAGTCACACGAACCGGAATTCGACT

[0031] ACTTAAAATCTCCGAAATCGAAGAAAAAATCAACCAGATAAGATG

[0032] GCTGAAGAAGAAAAATGCAGCCAACTTTATCATCTCCACGAATGAT

[0033] AAGACTGTCAAGTTGTGGAAGATCTCAGAACGCGAAAGGAAGGTGG

[0034] CCGATGGCAGTTACAATATCCAGAACGGATCCAGGATACGGAATGA

[0035] AGACCTCATTCTACCCAGGCTCGAACCCATGGAGCTGGTGGTGGAA

[0036] GCTTCGCCAAGGAGAGTATACGCAAATGCCCACACTTATCACATAA

[0037] ACTCTATTAGCATAAACGCCGATCAGGAAACATTTATCTCCGCTGAT

[0038] GACTTGAGGATCAATCTGTGGCATCATGAGATCACAAATCAGAGCT

[0039] TCAATATCGTCGATATAAAGCCCGTTAATATGGAGGAATTAACCGA

[0040] AGTCATCACTGCCGCACAATACCACCCATCCGAAGGGAATCTTTTCT

[0041] CCTACAGTTCTTCCAAGGGCATTATTCGACTTTGTGATACACGAACT

[0042] TCTGCCCTCTGTGATCACGCTGCAAGAGTTTTCGAAGAGAAAGAAG

[0043] ACCCTGCAACTAGATCCTTCTTCTCCGAGATCATCTCATCCATATCA

[0044] GACATCAAGTTCTCAAATAATGGCAGATATATAATGACCAGGGATT

[0045] ACCTTACAGTAAATGTATGGGATCTGAATATGGAAAACAAGCCCTT

[0046] GGAAACATACTATGTGCACGACTACTTAAGATCAAAATTATGCACT

[0047] CTATATGAAAATGATTCCATTTTTGACAAATTTGAATGCTGTTGGAG

[0048] TGGGGATGACACGCACATTGTCACCGGATCGTATAACAACTTCTTCC

[0049] GTACATTTAAACGTGGATTTGGAATCGAATCGACCTACGAAGCCAG

[0050] CCTTGATCTCTGTAAATTACCAGCTATGTATCGGCAAAAGAAAAAC

[0051] AACAGTGGATTGATGGGACGCAAACGGAAGGAAGACATATACATC

[0052] GACCATCTCGACTTCTCTAAGAAGATATTGCATTGTGCATGGCACCC

[0053] CACGTCTAATATTGTCGCTTTAGCCGCCACTAATAACCTTTATATCTT

[0054] CGAAGCCAATCGATCTGTGCGATGGCTTCAGTCTAAACTCCCAAGGGTGTCAACGAACATTGTGAGATACAGTCACTCACGATGA (SEQ ID No. 1).

[0055] Example 2 Design of dsRNA with the pine wood nematode Esg18 gene as an insect-resistant target gene

[0056] The pine wood nematode Esg18 (CAG9108384.1) gene was used as the insect-resistant target gene to design a dsRNA. The primers for amplifying the dsRNA and the nucleotide sequence of the amplified positive strand are as follows:

[0057] 1. Left primer:

[0058] TAATACGACTCACTATAGGGACGAACTTCTGCCCTCTGTG;

[0059] Right Primer:

[0060] TAATACGACTCACTATAGGGCGTTTGCGTCCCATCAATCC;

[0061] The nucleotide sequence of the amplified positive strand (450 bp):

[0062] ACGAACTTCTGCCCTCTGTGATCACGCTGCAAGAGTTTTCGAAGAGA

[0063] AAGAAGACCCTGCAACTAGATCCTTCTTCTCCGAGATCATCTCATCC

[0064] ATATCAGACATCAAGTTCTCAAATAATGGCAGATATATAATGACCA

[0065] GGGATTACCTTACAGTAAATGTATGGGATCTGAATATGGAAAACAA

[0066] GCCCTTGGAAACATACTATGTGCACGACTACTTAAGATCAAAATTAT

[0067] GCACTCTATATGAAAATGATTCCATTTTTGACAAATTTGAATGCTGT

[0068] TGGAGTGGGGATGACACGCACATTGTCACCGGATCGTATAACAACT

[0069] TCTTCCGTACATTTAAACGTGGATTTGGAATCGAATCGACCTACGAA

[0070] GCCAGCCTTGATCTCTGTAAATTACCAGCTATGTATCGGCAAAAGAAAAACAACAGTGGATTGATGGGACGCAAACG(SEQ ID No.2).

[0071] 2. Left primer: TCCACTTTCCAGTCACACGA;

[0072] Right primer: GCGTATACTCTCCTTGGCGA;

[0073] Nucleotide sequence of the sense strand obtained by amplification (287bp):

[0074] TCCACTTTCCAGTCACACGAACCGGAATTCGACTACTTAAAATCTCT

[0075] CGAAATCGAAGAAAAAATCAACCAGATAAGATGGCTGAAGAAGAA

[0076] AAATGCAGCCAACTTTATCATCTCCACGAATGATAAGACTGTCAAGT

[0077] TGTGGAAGATCTCAGAACGCGAAAGGAAGGTGGCCGATGGCAGTTA

[0078] CAATATCCAGAACGGATCCAGGATACGGAATGAAGACCTCATTCTA

[0079] CCCAGGCTCGAACCCATGGAGCTGGTGGTGGAAGCTTCGCCAAGGAGAGTATACGC (SEQ ID No. 3).

[0080] 3. Left primer: CTCTGTGATCACGCTGCAAG;

[0081] Right primer: ATCCCCACTCCAACAGCATT;

[0082] The nucleotide sequence of the amplified positive strand (279 bp):

[0083] CTCTGTGATCACGCTGCAAGAGTTTTCGAAGAGAAAGAAGACCCTG

[0084] CAACTAGATCCTTCTTCTCCGAGATCATCTCATCCATATCAGACATC

[0085] AAGTTCTCAAATAATGGCAGATATATAATGACCAGGGATTACCTTA

[0086] CAGTAAATGTATGGGATCTGAATATGGAAAACAAGCCCTTGGAAAC

[0087] ATACTATGTGCACGACTACTTAAGATCAAAATTATGCACTCTATATG

[0088] AAAATGATTCCATTTTTGACAAATTTGAATGCTGTTGGAGTGGGGAT (SEQ ID No. 4).

[0089] 4. Left primer: GGACGACGGAGAACTACTGG;

[0090] Right primer: TCGCGTTCTGAGATCTTCCA;

[0091] The nucleotide sequence of the amplified positive strand (273 bp):

[0092] GGACGACGGAGAACTACTGGCAACTGGAGACAAAGGTGGACGAGT

[0093] CGTTATTTTTCAAAGGAATCAGTCGTGGAATTATTCTGGAAACAGAA

[0094] GCAGTGAATACAACGTCTACTCCACTTTCCAGTCACACGAACCGGA

[0095] ATTCGACTACTTAAAATCTCTCGAAATCGAAGAAAAAATCAACCAG

[0096] ATAAGATGGCTGAAGAAGAAAAATGCAGCCAACTTTATCATCTCCA

[0097] CGAATGATAAGACTGTCAAGTTGTGGAAGATCTCAGAACGCGA(SEQ ID No.5).

[0098] 5. Left primer: TCCACTTTCCAGTCACACGA;

[0099] Right primer: AACTCTTGCAGCGTGATCAC;

[0100] The nucleotide sequence of the sense strand obtained by amplification (573bp):

[0101] TCCACTTTCCAGTCACACGAACCGGAATTCGACTACTTAAAATCTCT

[0102] CGAAATCGAAGAAAAAATCAACCAGATAAGATGGCTGAAGAAGAA

[0103] AAATGCAGCCAACTTTATCATCTCCACGAATGATAAGACTGTCAAGT

[0104] TGTGGAAGATCTCAGAACGCGAAAGGAAGGTGGCCGATGGCAGTTA

[0105] CAATATCCAGAACGGATCCAGGATACGGAATGAAGACCTCATTCTA

[0106] CCCAGGCTCGAACCCATGGAGCTGGTGGTGGAAGCTTCGCCAAGGA

[0107] GAGTATACGCAAATGCCCACACTTATCACATAAACTCTATTAGCATA

[0108] AACGCCGATCAGGAAACATTTATCTCCGCTGATGACTTGAGGATCA

[0109] ATCTGTGGCATCATGAGATCACAAATCAGAGCTTCAATATCGTCGAT

[0110] ATAAAGCCCGTTAATATGGAGGAATTAACCGAAGTCATCACTGCCG

[0111] CACAATACCACCCATCCGAAGGGAATCTTTTCTCCTACAGTTCTTCC

[0112] AAGGGCATTATTCGACTTTGTGATACACGAACTTCTGCCCTCTGTGATCACGCTGCAAGAGTT(SEQ ID No.6).

[0113] 6. Left primer: CTCAGAACGCGAAAGGAAGG;

[0114] Right primer: ATCCCCACTCCAACAGCATT;

[0115] Nucleotide sequence of the sense strand obtained by amplification (679bp):

[0116] CTCAGAACGCGAAAGGAAGGTGGCCGATGGCAGTTACAATATCCAG

[0117] AACGGATCCAGGATACGGAATGAAGACCTCATTCTACCCAGGCTCG

[0118] AACCCATGGAGCTGGTGGTGGAAGCTTCGCCAAGGAGAGTATACGC

[0119] AAATGCCCACACTTATCACATAAACTCTATTAGCATAAACGCCGATC

[0120] AGGAAACATTTATCTCCGCTGATGACTTGAGGATCAATCTGTGGCAT

[0121] CATGAGATCACAAATCAGAGCTTCAATATCGTCGATATAAAGCCCG

[0122] TTAATATGGAGGAATTAACCGAAGTCATCACTGCCGCACAATACCA

[0123] CCCATCCGAAGGGAATCTTTTCTCCTACAGTTCTTCCAAGGGCATTA

[0124] TTCGACTTTGTGATACACGAACTTCTGCCCTCTGTGATCACGCTGCA

[0125] AGAGTTTTCGAAGAGAAAGAAGACCCTGCAACTAGATCCTTCTTCTC

[0126] CGAGATCATCTCATCCATATCAGACATCAAGTTCTCAAATAATGGCA

[0127] GATATATAATGACCAGGGATTACCTTACAGTAAATGTATGGGATCT

[0128] GAATATGGAAAACAAGCCCTTGGAAACATACTATGTGCACGACTAC

[0129] TTAAGATCAAAATTATGCACTCTATATGAAAATGATTCCATTTTTGACAAATTTGAATGCTGTTGGAGTGGGGAT(SEQ ID No.7).

[0130] 7. Left primer: GGAGACAAAGGTGGACGAGT;

[0131] Right primer: TCGCGTTCTGAGATCTTCCA;

[0132] Nucleotide sequence of the sense strand obtained by amplification (248bp):

[0133] GGAGACAAAGGTGGACGAGTCGTTATTTTTCAAAGGAATCAGTCGT

[0134] GGAATTATTCTGGAAACAGAAGCAGTGAATACAACGTCTACTCCAC

[0135] TTTCCAGTCACACGAACCGGAATTCGACTACTTAAAATCTCTCGAAA

[0136] TCGAAGAAAAAATCAACCAGATAAGATGGCTGAAGAAGAAAAATG

[0137] CAGCCAACTTTATCATCTCCACGAATGATAAGACTGTCAAGTTGTGGAAGATCTCAGAACGCGA (SEQ ID No. 8).

[0138] Experimental Example 1: Application of dsRNA designed with pine wood nematode Esg18 gene as target gene in the control of pine wood nematode

[0139] 1 Test method

[0140] Soaking system: mixed insect-like pine nematodes (10 heads / μL); 2 mg / mL dsRNA (the dsRNA designed and amplified in Example 2) solution; 1 mg / mL FITC; 1×M9 buffer solution (43.6M Na2HPO4, 22mM KH2PO4, 2.1mMNaCl, 4.7m M NH4Cl). Soaking conditions: 25°C in the dark with shaking at 180rpm for 24h. The control group was free of dsRNA and soaked in gfp dsRNA. After soaking, it was washed 5 times with ddH2O, 7×10 3 The pine nematodes were collected by centrifugation at 400 g for 5 min to detect the RNAi effect, and the dsRNA immersion effect and the survival rate of pine nematodes were observed using a fluorescence microscope (Zeiss Axio Imager A1, Germany).

[0141] Nematodes were marked as alive if they were wavy, curved, S-shaped, or spiral, or were still moving. Nematodes were considered dead if they were immobile and appeared stiff and needle-like, or had a J- or C-shaped body wall with no refractive properties and did not respond to mechanical stimulation with the needle tip.

[0142] The adjusted mortality rate of PWN was calculated according to the following formula: adjusted mortality rate (%) = (mortality rate of treatment group - mortality rate of control group) / (100 - mortality rate of control group) × 100

[0143] 2 Test results

[0144] Table 2 Mortality of pine wood nematodes after dsRNA immersion treatment

[0145] dsRNA Pine wood nematode mortality (%) The positive chain is the sequence shown in SEQ ID No.2 88.37 The positive chain is the sequence shown in SEQ ID No.3 51.80 The positive chain is the sequence shown in SEQ ID No.4 49.27 The positive chain is the sequence shown in SEQ ID No.5 38.38 The positive chain is the sequence shown in SEQ ID No.6 50.45 The positive chain is the sequence shown in SEQ ID No.7 54.90 The positive chain is the sequence shown in SEQ ID No.8 46.65

[0146] According to the test results in Table 2, the mortality rate of pine wood nematodes after immersion treatment with dsRNA whose positive chain is the sequence shown in SEQ ID No. 2 is 88.370%, which is significantly higher than the mortality rate of pine wood nematodes after immersion treatment with other dsRNAs.

Claims

1. Application of pine wood nematode Esg18 gene as dsRNA target gene in the control of pine wood nematode.

2. The use according to claim 1, characterized in that: The nucleotide sequence of the CDS of the pine wood nematode Esg18 gene is shown in SEQ ID No.

1.

3. dsRNA designed with the pine wood nematode Esg18 gene as the target gene.

4. The dsRNA according to claim 3, characterized in that The dsRNA is selected from any one of the following (1)-(7): (1) The dsRNA consists of a sense strand and an antisense strand that is reverse complementary to the sense strand, and the nucleotide sequence of the sense strand of the dsRNA is shown in SEQ ID No. 2; (2) The dsRNA consists of a sense strand and an antisense strand that is reverse complementary to the sense strand, and the nucleotide sequence of the sense strand of the dsRNA is shown in SEQ ID No. 3; (3) The dsRNA consists of a sense strand and an antisense strand that is reverse complementary to the sense strand, and the nucleotide sequence of the sense strand of the dsRNA is shown in SEQ ID No. 4; (4) The dsRNA consists of a sense strand and an antisense strand that is reverse complementary to the sense strand, and the nucleotide sequence of the sense strand of the dsRNA is shown in SEQ ID No. 5; (5) The dsRNA consists of a sense strand and an antisense strand that is reverse complementary to the sense strand, and the nucleotide sequence of the sense strand of the dsRNA is shown in SEQ ID No. 6; (6) The dsRNA consists of a sense strand and an antisense strand that is reverse complementary to the sense strand, and the nucleotide sequence of the sense strand of the dsRNA is shown in SEQ ID No. 7; (7) The dsRNA consists of a sense strand and an antisense strand that is reverse complementary to the sense strand, and the nucleotide sequence of the sense strand of the dsRNA is shown in SEQ ID No.

8.

5. An expression vector containing the dsRNA according to claim 3 or 4.

6. The expression vector according to claim 5, characterized in that The expression vector is an RNA interference vector.

7. Use of the dsRNA according to claim 3 or 4 in controlling pine wood nematodes.

8. Use of the expression vector according to claim 5 in controlling pine wood nematodes.

9. A pesticide composition for controlling pine wood nematodes, comprising dsRNA, a pesticide for controlling pine wood nematodes and auxiliary materials, characterized in that: The dsRNA is the dsRNA according to claim 3 or 4.

10. A pesticide composition for controlling pine wood nematodes, characterized in that: Containing the expression vector according to claim 5.