Small nucleic acid composition, application of small nucleic acid composition in preparation of medicine and product

Abstract

The invention provides a small nucleic acid composition, application of the small nucleic acid composition in preparation of a medicine and a product, and belongs to the technical field of biological medicine. The invention designs a small nucleic acid composition ASO133 / 7 / 142 / 30 containing four corresponding antisense oligonucleotide fragments aiming at four regions of miR-133, let-7, miR-142-3p and miR-30 seed sequences contained in a 3 '-terminal untranslated region sequence of ATP2A2 mRNA (messenger ribonucleic acid), and the small nucleic acid composition ASO133 / 7 / 142 / 30 has a nucleotide sequence as shown in SEQ ID NO. 1. By adopting the small nucleic acid composition provided by the invention, the expression level of ATP2A2 in HL-1 cells can be increased, and the expression level of ATP2A2 in heart tissues can be remarkably improved.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to a small nucleic acid composition and its application and product in preparing medicine. Background Art

[0002] The imbalance or disorder of myocardial calcium homeostasis is a common feature and hallmark of various types of cardiovascular diseases, and is also one of their pathogenesis. The maintenance of myocardial calcium homeostasis depends on the fine regulation of a regulatory network composed of a series of calcium regulation-related proteins, ion channels and enzymes. The calcium ion handling protein SERCA2a (sarcoplasmic reticulum calcium ATPase2a, endoplasmic reticulum calcium ion ATPase) is responsible for the Ca2+ entering cells through calcium channels and released from endoplasmic reticulum calcium pools into the cytoplasm during cardiac contraction. 2+ During diastole, it is taken up into the endoplasmic reticulum, reducing the intracytoplasmic Ca 2+ concentration, so that Ca 2+ Dissociate from troponin C, and myocardial cells relax. About 95% of cytoplasmic calcium ions are recycled to the sarcoplasmic reticulum by SERCA2a, which is a key molecule involved in the calcium regulation process of myocardial cells and maintaining the function of the endoplasmic reticulum. Under normal circumstances, most of the Ca 2+ are stored in the endoplasmic reticulum. When the cell contracts, the Ca 2+ Large amounts of cytosolic Ca 2+ The concentration increases instantly, causing the cell to contract; after the cell contracts, SERCA2a reabsorbs Ca 2+ Ca 2+ Concentrations return to normal levels, and SERCA2a is essential for maintaining intracellular Ca 2+ Homeostasis is critical.

[0003] Abnormal function or expression of SERCA2a will damage the contractile function of myocardial cells and thus damage the overall heart function. In various cardiovascular diseases, including acute myocardial infarction, myocardial hypertrophy, heart failure, diabetic cardiomyopathy, etc., SERCA2a expression is downregulated and its function is impaired, which makes the endoplasmic reticulum take up Ca 2+ Decreased cytoplasmic Ca 2+ The concentration decreases slowly and in an insufficient manner, delaying myocardial relaxation; endoplasmic reticulum Ca 2+ Stores decrease, and myocardial contraction releases Ca 2+Decreased, myocardial contractile function declines. Down-regulated expression and impaired function of SERCA2a can cause intracellular calcium overload, activate the apoptosis pathway of myocardial cells, lead to cell death, and thus weaken myocardial contractile function. Intracellular calcium overload caused by down-regulated expression and impaired function of SERCA2a increases the risk of arrhythmias and further weakens myocardial contractile function. It can be seen that restoring the expression and function of SERCA2a is a very potential breakthrough in the treatment of cardiovascular diseases such as acute myocardial infarction. There are two strategies to restore the expression and function of SERCA2a. One is "replacement therapy": directly increasing the expression of SERCA2a and activating protein function; the other is "rescue therapy": preventing the downregulation of SERCA2a expression and loss of function.

[0004] SERCA2a is encoded by the ATP2A2 gene. Previous gene structures and early bioinformatics analysis have shown that ATP2A2 is a molecular target of miR-133, let-7, miR-142-3p, and miR-30, and is highly conserved across species. Moreover, these miRNAs are highly expressed in the myocardium, so their inhibitory effects on ATP2A2 expression are also relatively strong. Therefore, it is an ideal target for implementing microRNA (miRNA) interference technology to rescue ATP2A2 expression levels.

[0005] In cells, each gene or protein-coding messenger RNA (mRNA) may simultaneously pair with multiple microRNAs (miRNAs), which inhibit the translation of the target mRNA into the corresponding protein and degrade the target mRNA, so that its expression level and cell function are inhibited by these microRNAs. If a gene is a pathogenic gene for a certain disease, microRNAs can be used to inhibit the expression and function of the gene, and these microRNAs can be regarded as disease-resistant microRNAs; however, if the gene is a disease-resistant gene, it should be protected, and one of the strategies to protect the gene is to relieve the inhibitory effect of microRNAs on it. The most commonly used specific method is to use microRNA antisense nucleotides (AMO or antimiR or antagomiR) technology to knock down these microRNAs. However, knocking down only one of the many microRNAs that can inhibit the gene may maintain the inhibitory effect on the target mRNA due to the presence of other microRNAs. In other words, interfering with or knocking down any of the many microRNAs involved in inhibiting the same target mRNA is not enough to relieve the inhibitory effect on the target gene. This is a great challenge that still faces in targeting microRNAs to relieve gene repression.

[0006] On the other hand, since microRNA can act on multiple target genes (mRNA) at the same time, including pathogenic genes and disease-resistant genes. Therefore, when AMO technology is used to knock down a certain microRNA, its inhibitory effect on pathogenic genes and disease-resistant genes will be reduced or relieved at the same time. The consequence is that while the harmful effects of the microRNA are reduced, the beneficial functions of the microRNA are also inhibited, so that while treating a certain disease, another disease is triggered. This is not only a "toxic side effect" that is extremely taboo in clinical practice, but also another serious challenge faced by those who intend to target microRNA to treat diseases.

[0007] Patent CN101054576A discloses a miRNA barrier technology, which determines the target gene sequence that binds to miRNA in the 3′UTR of the target nRNA, synthesizes a specific antisense oligomeric barrier sequence that can tightly bind to the target gene sequence, and introduces the specific antisense oligomeric barrier sequence into the cell to form a diploid with the target mRNA, thereby shielding the miRNA that targets the mRNA. The miRNA barrier technology has been regarded by the industry as an important strategy for the discovery and development of new small nucleic acid drugs in the future. However, the weakness of this technology has been exposed, that is, the effect of the above-mentioned barrier single microRNA is often difficult to achieve the best effect, and even cannot achieve the expected drug effect. The main reason is that the single-site miRNA barrier technology cannot relieve the inhibitory effect of other key microRNAs on the same target gene.

[0008] In order to simultaneously resolve the two challenges facing the above-mentioned microRNAs, it is necessary to explore new technologies that can specifically remove the inhibitory effects of multiple key microRNAs on a disease-resistant gene, while avoiding interfering with the inhibitory effects of these microRNAs on other genes, especially on pathogenic genes. In other words, this technology must be able to simultaneously protect the expression and function of disease-resistant genes from being inhibited, while maintaining the inhibition of pathogenic genes. Summary of the invention

[0009] In view of the above shortcomings, the present invention provides a small nucleic acid composition and its application and product for preparing medicine. The present invention designs a small nucleic acid composition ASO133 / 7 / 142 / 30 containing four corresponding antisense oligonucleotide fragments for the four regions of miR-133, let-7, miR-142-3p and miR-30 seed sequences contained in the 3'-terminal untranslated region sequence of ATP2A2 mRNA, having a nucleotide sequence as shown in SEQ ID NO.1. The small nucleic acid composition provided by the present invention can increase the expression level of ATP2A2 in HL-1 cells and significantly improve the expression level of ATP2A2 in cardiac tissue.

[0010] The technical solution of the present invention includes: On the one hand, the present invention provides a small nucleic acid composition, wherein the small nucleic acid composition is ASO133 / 7 / 142 / 30, having a nucleotide sequence as shown in SEQ ID NO.1.

[0011] Specifically, the small nucleic acid composition can interfere with miRNA and prevent miRNA from binding to target mRNA.

[0012] Preferably, the target mRNA is ATP2A2.

[0013] Specifically, the small nucleic acid composition connects the antisense oligonucleotide fragments of multiple miRNA seed sequences through a linker.

[0014] Preferably, the linker has a nucleotide sequence as shown in CCCAG.

[0015] Preferably, the miRNA seed sequence is the seed sequence of miR-133, let-7, miR-142-3p and miR-30.

[0016] Further preferably, the antisense oligonucleotide fragment of the miRNA seed sequence has a nucleotide sequence as shown in SEQ ID NO.2-5.

[0017] Still more preferably, the antisense oligonucleotide fragment of miR-133 has a nucleotide sequence as shown in SEQ ID NO.2.

[0018] Still more preferably, the antisense oligonucleotide fragment of let-7 has a nucleotide sequence as shown in SEQ ID NO.3.

[0019] Still more preferably, the antisense oligonucleotide fragment of miR-142-3p has a nucleotide sequence as shown in SEQ ID NO.4.

[0020] Still more preferably, the antisense oligonucleotide fragment of miR-30 has a nucleotide sequence as shown in SEQ ID NO.5.

[0021] In another aspect, the present invention provides a method for designing the above-mentioned small nucleic acid composition.

[0022] Specifically, the design method comprises the following steps: S1. Design antisense oligonucleotide fragments ASO-133, ASO-let-7, ASO-142-3p and ASO-30 respectively for the seed sequences of miR-133, let-7, miR-142-3p and miR-30 contained in the 3'-terminal untranslated region sequence of ATP2A2 mRNA; S2, using a linker to connect the above ASO-133, ASO-let-7, ASO-142-3p and ASO-30 in sequence to obtain the multi-site miRNA inhibitor ASO133 / 7 / 142 / 30; S3. The designed barrier nucleic acid must be self-folded after the secondary structure is predicted to avoid strong hairpin structures as much as possible. If a hairpin structure exists, the order of several ASOs needs to be readjusted until a barrier nucleic acid with no or the weakest self-folding or hairpin structure is obtained.

[0023] Preferably, the ASO-133 described in step S1 has a nucleotide sequence as shown in SEQ ID NO.2.

[0024] Preferably, the ASO-let-7 described in step S1 has a nucleotide sequence as shown in SEQ ID NO.3.

[0025] Preferably, the ASO-142-3p described in step S1 has a nucleotide sequence as shown in SEQ ID NO.4.

[0026] Preferably, the ASO-30 described in step S1 has a nucleotide sequence as shown in SEQ ID NO.5.

[0027] Preferably, the linker described in step S2 has a nucleotide sequence as shown in CCCAG.

[0028] In another aspect, the present invention provides the use of the above-mentioned small nucleic acid composition in the preparation of drugs for preventing, treating, assisting in the treatment or prognostic treatment of cardiovascular diseases.

[0029] Specifically, the cardiovascular diseases include but are not limited to acute myocardial infarction, myocardial hypertrophy, heart failure, and diabetic cardiomyopathy.

[0030] Preferably, the cardiovascular disease is heart failure.

[0031] In another aspect, the present invention provides a drug for preventing, treating, assisting in the treatment or prognostic treatment of cardiovascular diseases, wherein the drug comprises the above-mentioned small nucleic acid composition.

[0032] Specifically, the medicine also includes a pharmaceutically acceptable carrier and / or excipient.

[0033] Preferably, the vector includes but is not limited to DNA, RNA, viral vector, plasmid, transposon, other gene transfer systems or a combination thereof.

[0034] Preferably, the excipients include but are not limited to solvents, diluents, disintegrants, precipitation inhibitors, surfactants, glidants, adhesives, lubricants, dispersants, suspending agents, isotonic agents, thickeners, emulsifiers, preservatives, stabilizers, hydrating agents, emulsification accelerators, buffers, absorbents, colorants, flavoring agents, sweeteners, ion exchangers, release agents, coating agents, flavoring agents or antioxidants.

[0035] The beneficial effects of the present invention are: (1) The present invention adopts the principles, methods and steps of multi-target microRNA barrier technology to design a small nucleic acid composition ASO133 / 7 / 142 / 30, which can be used to protect the expression level and functional effect of disease resistance gene mRNA from being inhibited by microRNA.

[0036] (2) ASO133 / 7 / 142 / 30 provided by the present invention is superior to single-target drugs in terms of pharmacodynamics and can more thoroughly protect and stimulate disease-resistant genes, thereby more effectively treating heart failure.

[0037] (3) In terms of industrial-scale production, the pharmaceutical cost of ASO133 / 7 / 142 / 30 is much lower than the combination drug strategy using several single-target drugs.

[0038] (4) In clinical applications, a multi-target therapeutic drug can make patients more compliant with medication compared to the combination of multiple single-target drugs. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 is the expression level of ATP2A2 in HL-1 / ISO cells.

[0040] Figure 2 is the expression level of SERCA2a in heart tissue of heart failure mice; * indicates significant difference ( p＜ 0.05). DETAILED DESCRIPTION

[0041] The present invention is described below in conjunction with specific examples. The following examples are not intended to limit the present invention, but are only intended to illustrate the present invention so that the technical solution of the present invention is easier to understand and grasp. The experimental methods described in the following examples are conventional methods unless otherwise specified; the reagents and materials described are all commercially available unless otherwise specified.

[0042] Example 1 Preparation of ASO133 / 7 / 142 / 30 Using the NCBI database, we selected key miRNAs that can inhibit the ATP2A2 target gene: miR-133, let-7, miR-142-3p, and miR-30. These miRNAs are highly expressed in the myocardium, so they have a strong inhibitory effect on the expression of ATP2A2. Therefore, they are ideal targets for implementing miRNA interference technology to rescue the expression level of ATP2A2. However, these miRNAs have been proven to protect the heart, so it is not appropriate to use the usual miRNA antisense inhibitors (AMOs) to interfere with them, but multi-site microRNA barrier technology must be used.

[0043] Antisense oligonucleotide fragments ASO-133, ASO-let-7, ASO-142-3p and ASO-30 were designed for the seed sequences of miR-133, let-7, miR-142-3p and miR-30 contained in the 3'-terminal untranslated region sequence of ATP2A2 mRNA, respectively, having the nucleotide sequences shown in SEQ ID NO.2-5.

[0044] ASO-133 (SEQ ID NO. 2): UACGCUGGUUGAAGGGGACCAUUA.

[0045] ASO-let-7 (SEQ ID NO. 3): CUAAACUAUACAACCUACUACCUCAAC.

[0046] ASO-142-3p (SEQ ID NO. 4): ACUCCAUAAAGUAGGAAACACUACAUC.

[0047] ASO-30 (SEQ ID NO. 5): AAGCUGCAAACAUCCGACUGAAAGCA.

[0048] The above-mentioned ASO-133, ASO-let-7, ASO-142-3p and ASO-30 were connected one by one in sequence using a 5-nucleotide fragment CCCAG as a linker to obtain the multi-site miRNA inhibitor ASO133 / 7 / 142 / 30, which has a nucleotide sequence as shown in SEQ ID NO.1.

[0049] ASO133 / 7 / 142 / 30 (SEQ ID NO.1): UACGCUGGUUGAAGGGGACCAUUACCCAGCUAAACUAUACAACCUACUACCUCAACCCCAGACUCCAUAAAGUAGGAAACACUACAUCCCCAGAAGCUGCAAACAUCCGACUGAAAGCA.

[0050] Example 2 In vitro effects of ASO133 / 7 / 142 / 30 2.1 Recovery of HL-1 cells Take out the frozen HL-1 mouse cardiomyocytes (purchased from Yuanjing Biology, catalog number YC-C100) from liquid nitrogen, put them in a 37℃ constant temperature water bath and shake them quickly to dissolve the cryopreservation solution, pipette the cell-rich cryopreservation solution into a 1.5mL EP tube, and centrifuge at 1000rpm for 5min. During the centrifugation, take 5mL of high-glucose DMEM medium containing 10% fetal bovine serum and place it in a culture dish. After the cell centrifugation is completed, take the supernatant, add 1mL of new DMEM medium and gently blow and mix, then add it to the culture dish, and shake the culture dish in a cross method to arrange the cells evenly in the culture dish. Place the culture dish in a 37℃ constant temperature incubator containing 5% CO2 for culture. Replace the new high-glucose DMEM medium containing 10% fetal bovine serum on the second day and continue to culture.

[0051] 2.2 Passaging of HL-1 cells HL-1 cells are passaged when they grow to about 90%. Take out the cells that need to be passaged from the constant temperature incubator, discard the previous culture medium, and rinse with PBS twice. Add trypsin and shake gently to rinse. Place in a 37℃ constant temperature incubator for 1 minute, observe under a microscope, and after the cells become round, add high-glucose DMEM containing 10% fetal bovine serum in an equal volume to trypsin to obtain a cell suspension. The cell suspension is placed in a 1.5mL sterile centrifuge tube and centrifuged at 1000rpm for 5min. Take 3 culture dishes, add 10mL of high-glucose DMEM culture medium containing 10% fetal bovine serum to each, place the centrifuged cells on a centrifuge rack, discard the culture medium containing trypsin, add 900μL of new high-glucose DMEM culture medium containing 10% fetal bovine serum, gently blow 20-30 times to fully disperse the cells, take 300μL of cell suspension and evenly inoculate it into the culture dish containing culture medium, and shake the culture dish in the cross method. The cells were cultured in a 37°C incubator with 5% CO2. The next day, the cells were cultured in a new high-glucose DMEM medium containing 10% fetal bovine serum.

[0052] 2.3 HL-1 cells simulate heart failure in vitro The drug isoproterenol (ISO) was used to induce HL-1 cell hypertrophy to simulate the process of heart failure. HL-1 cells were observed to grow to about 50-60% under a microscope for ISO stimulation. The intracellular culture medium was replaced with low-sugar DMEM culture medium 16 hours in advance, and the cells that needed to be stimulated by drugs were taken out of the constant temperature incubator, the previous culture medium was discarded, and the cells were gently rinsed twice with sterile high-pressure PBS for even rinsing. ISO was diluted with culture medium to a final drug concentration of 10μM. The culture medium containing ISO was replaced, and the cells were stimulated for 24 hours to construct heart failure HL-1 cells, namely HL-1 / ISO cells.

[0053] 2.4 ATP2A2 expression level after ASO133 / 7 / 142 / 30 treatment According to the instructions, HL-1 / ISO cells were transfected with ASO-133, ASO-let-7, ASO-142-3p, ASO-30 or ASO133 / 7 / 142 / 30 using Lipofectamine 2000 transfection reagent (Thermofisher, 11668019), and the untransfected group was used as a control, and then incubated in a 5% CO2, 37°C incubator for 6 hours. After 6 hours, the medium containing the transfection reagent was discarded, and the medium in each well was replaced with fresh high-glucose DMEM containing 10% fetal bovine serum and incubated for 48 hours.

[0054] After 48 hours, take the plate out of the incubator, discard the supernatant in the well, and wash with PBS 1-2 times. Add TRIzol reagent to the well, blow the cells, and let it stand at room temperature for 5 minutes to fully break the cells and release nucleic acids. Collect the liquid in each well and transfer it to the corresponding 1.5mL enzyme-free EP tube. Add 200μL of chloroform to the EP tube, shake up and down for 15s to mix thoroughly, let it stand at room temperature for 3-5min, and centrifuge at 12000rpm for 15min. Transfer the water layer to a new enzyme-free EP tube, add 400μL of isopropanol, let it stand for 10min to precipitate the RNA in the precipitated water layer, centrifuge at 12000rpm for 10min, discard the solution in the tube, and add 1mL of 75% ethanol to clean the residual isopropanol. Centrifuge at 12000rpm for 10min, discard the ethanol, add 30μL of DEPC water, and heat in a metal bath to dissolve the precipitate. 500 ng of total RNA was reverse transcribed into cDNA using the Quantitect® Reverse Transcription Kit. The primer sequences used in QPCR are shown in Table 1. 2 μL of cDNA was taken and QPCR was performed in a real-time fluorescence quantitative PCR instrument according to the instructions of SYBR Green PCR Master Mix. The reaction conditions were: 95°C activation for 10 min, 95°C for 5 s, 60°C for 1 min, and 35 cycles.

[0055] Table 1 Primer sequences used in QPCR

[0056] Data export: After the qPCR program is completed, the thresholds of the two genes are adjusted, and the Ct value data are exported and sorted and analyzed. GAPDH is used as the internal reference gene, and the relative expression of the target gene ATP2A2 mRNA is calculated according to the ΔΔCt method.

[0057] The results of the test are as follows Figure 1 As shown, the results showed that the ATP2A2 level was the highest in HL-1 / ISO cells transfected with ASO133 / 7 / 142 / 30, and the ATP2A2 level was significantly better than that of ASO-133, ASO-let-7, ASO-142-3p and ASO-30.

[0058] Example 3 In vivo effects of ASO133 / 7 / 142 / 30 3.1 Heart failure mice induced by aortic arch constriction The present invention uses SPF level, 8-10 week old male C57BL / 6 mice for experiments.

[0059] After the mouse is anesthetized, the chest hair is removed, and the mouse is fixed on the small animal heating plate in a lateral position. Under sterile conditions, the skin is cut in the middle of the chest, from the upper part of the sternum to the level of the second rib, and the mouse tissue and muscle are bluntly separated using curved forceps. And along the midline, close to the posterior wall of the sternum from the upper sternal fossa, carefully and bluntly separate the posterior sternal tissue. At this time, the operation should be gentle to prevent damage to the pleura and cause pneumothorax. In the right hand, the straight-headed tissue scissors are held upside down and the sternum is cut from the upper edge of the sternum to the level of the second rib along the midline of the sternum. The thymus can be seen in the middle of the rear field of vision, and the sternum is pulled with a spreader. A 4-6mm wide longitudinal incision is formed. The thymus is separated with microscopic forceps without serrations to fully expose the aortic arch. Bluntly separate the tissue around the aortic arch, and note that the separation site is limited to the left common carotid artery. A homemade mouse-specific lead is used to pass the No. 5 cotton thread from the upper edge of the aorta to the posterior wall and lower edge of the aorta, and the cotton thread head is pulled out with pointed forceps. After that, a homemade 27G pad needle was used for padding, and the aorta and pad needle were double-knotted for ligation. After ligation, the knot was gently lifted with toothless forceps, and the pad needle was pulled out horizontally to form a constriction with the aortic arch with the same diameter as the pad needle. After checking for active bleeding, 6-0 non-damaging thread was applied. The upper edge of the sternum was sutured in an "8" shape, and then the chest was closed layer by layer, the skin was sutured, and the mice were placed on a 37°C constant temperature electric blanket until the mice woke up. The sham operation group did not undergo ligation, and the rest was the same.

[0060] 3.2 Grouping and Dosing Four weeks after surgery, the cardiac function of mice was measured using a small animal ultrasound imaging system. The inclusion criteria were post-constriction blood flow ≥ 2700 and EF = 45 ± 5%. Mice that met the inclusion criteria were randomly divided into three groups: ASO group, model (Mon) group, and sham operation (Con) group. The ASO group was intraperitoneally injected with 10 μL ASO133 / 7 / 142 / 30 (20 μg / mL), and the model group and sham operation group were intraperitoneally injected with an equal volume of normal saline. The drugs were administered once a day for 20 consecutive days.

[0061] 3.3 SERCA2a activity assay After the treatment cycle of mice, the mice were killed by dislocating the neck, the whole heart was removed, and the heart was transferred to a centrifuge tube for use after washing. Weigh 30 mg of heart tissue, cut it into pieces, add 300 μL of sucrose premix (prepare 0.25M sucrose solution, add PMSF at a ratio of 100:1), homogenize on ice using a homogenizer, vortex the homogenate and place it in a 4 ℃ centrifuge, centrifuge at 10000g for 10min. After the centrifugation, take the supernatant and transfer it to a new EP tube, place it in a 4 ℃ centrifuge and centrifuge at 30000g for 90min. After the centrifugation, aspirate the supernatant and store the precipitate at the bottom in a -80 ℃ refrigerator for activity detection.

[0062] Using Ca 2+ ATPase activity detection kit (abbkine, KTB1810), prepare 0.02 μmol / mL phosphorus standard solution and phosphorus fixative in advance. Carry out enzymatic reaction according to the sample volume in Table 2: Table 2 Ca 2+ ATPase activity detection system

[0063] Add reagent 1 to reagent 6 according to the above dosage, vortex mix, put the two EP tubes into a 37°C water bath to react for 10 minutes, then add reagent 7 and the sample to be tested, put the EP tube into a centrifuge, centrifuge at 3500 rpm for 10 minutes, and take 150 μL of the supernatant for phosphorus determination.

[0064] Prepare 4 EP tubes and perform phosphorus determination according to the sample volumes in Table 3 below: Table 3 Phosphorus determination system

[0065] Prepare EP tubes according to the above sample addition amount, add the phosphorus determination application solution, vortex mix, and let stand at room temperature for 2 min. Then add the stop solution, vortex mix, let stand at room temperature for 5 min, set the wavelength parameters to 636nm, the light path to 0.5cm, and use ddH2O to zero, and then measure the absorbance in each EP tube. And calculate the activity of SERCA2a in each group of samples.

[0066] The results of the test are as follows Figure 2 As shown, after treatment with ASO133 / 7 / 142 / 30, the SERCA2a in the heart tissue of mice in the ASO group was significantly increased compared with that in the MON group.

[0067] The above detailed description is a specific description of one of the feasible embodiments of the present invention, and the embodiment is not intended to limit the scope of the present invention. It should be pointed out that any equivalent implementation or change that does not deviate from the present invention should be included in the scope of the technical solution of the present invention. Therefore, the protection scope of the patent of the present invention shall be based on the attached requirements.

Claims

1. A small nucleic acid composition, characterized in that: The small nucleic acid composition is ASO133 / 7 / 142 / 30, having a nucleotide sequence as shown in SEQ ID NO.

1.

2. The small nucleic acid composition according to claim 1, characterized in that The small nucleic acid composition connects the antisense oligonucleotide fragments of multiple miRNA seed sequences through a linker.

3. The small nucleic acid composition according to claim 2, characterized in that The linker has a nucleotide sequence as shown in CCCAG.

4. The small nucleic acid composition according to claim 2, characterized in that The miRNA seed sequences are the seed sequences of miR-133, let-7, miR-142-3p and miR-30.

5. The small nucleic acid composition according to claim 2, characterized in that: The antisense oligonucleotide fragment of the miRNA seed sequence has a nucleotide sequence as shown in SEQ ID NO.2-5.

6. The small nucleic acid composition according to claim 2, characterized in that: The antisense oligonucleotide fragment of miR-133 in the miRNA seed sequence has a nucleotide sequence as shown in SEQ ID NO.2; the antisense oligonucleotide fragment of let-7 has a nucleotide sequence as shown in SEQ ID NO.3; the antisense oligonucleotide fragment of miR-142-3p has a nucleotide sequence as shown in SEQ ID NO.4; and the antisense oligonucleotide fragment of miR-30 has a nucleotide sequence as shown in SEQ ID NO.

5.

7. Use of the small nucleic acid composition according to any one of claims 1 to 6 in the preparation of a drug for the prevention, treatment, adjuvant treatment or prognostic treatment of cardiovascular diseases.

8. The use according to claim 7, characterized in that: The cardiovascular diseases include acute myocardial infarction, myocardial hypertrophy, heart failure or diabetic cardiomyopathy.

9. A drug for preventing, treating, assisting in the treatment or prognostic treatment of cardiovascular diseases, characterized in that: The medicine comprises the small nucleic acid composition according to any one of claims 1 to 6.

10. The drug according to claim 9, characterized in that The medicine also includes a pharmaceutically acceptable carrier or excipient.

Images