Application of reagent for intervening circ-ZNF609 expression in preparation of medicine for preventing and / or treating cardiac hypertrophy

Abstract

The invention provides application of a reagent for intervening circ-ZNF609 expression in preparation of a medicine for preventing and / or treating cardiac hypertrophy, and belongs to the technical field of biological medicine. The invention provides application of a reagent for intervening circ-ZNF609 expression in preparation of a medicine for preventing and / or treating cardiac hypertrophy. According to the invention, an adeno-associated virus delivery system is utilized to deliver a reagent targeting circ-ZNF609 into cardiac muscle tissues to interfere the expression of circ-ZNF609, so that cardiomyopathy hypertrophy can be inhibited, the cardiac contraction function can be improved, and pathological ventricular remodeling caused by pressure overload can be resisted at the same time. Therefore, the invention provides a new way for treating cardiac hypertrophy.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to the use of an agent for intervening in the expression of circ-ZNF609 in the preparation of a drug for preventing and / or treating myocardial hypertrophy. Background Art

[0002] Chronic ventricular pressure overload can lead to myocardial hypertrophy, and long-term overload of the heart can lead to pathological ventricular remodeling and heart failure. The typical characteristics of myocardial hypertrophy are myocardial cell hypertrophy, disordered arrangement, and myocardial fibrosis. The adaptation of the heart to external or internal stress involves a series of complex processes. Its initial compensatory hypertrophic response to stress helps maintain the contractile function of the myocardium, but long-term myocardial hypertrophy may induce the occurrence of other cardiovascular diseases. The pathogenesis of pathological myocardial hypertrophy is complex. At present, there is a lack of effective intervention measures for pathological myocardial hypertrophy in clinical practice. Summary of the invention

[0003] In view of this, the present invention provides an application of an agent for intervening in the expression of circ-ZNF609 in the preparation of a drug for preventing and / or treating myocardial hypertrophy. By delivering crRNA targeting circ-ZNF609 to myocardial tissue to interfere with the expression of circ-ZNF609, pathological myocardial hypertrophy can be inhibited, cardiac contractile function can be improved, and pathological ventricular remodeling caused by pressure overload can be resisted.

[0004] In order to achieve the above object, the present invention provides the following technical solutions:

[0005] The present invention provides the use of an agent for intervening in the expression of circ-ZNF609 in the preparation of a drug for preventing and / or treating myocardial hypertrophy.

[0006] Preferably, the agent intervening in the expression of circ-ZNF609 includes crRNA and / or shRNA targeting circ-ZNF609 or gene-derived products of the crRNA and / or shRNA targeting circ-ZNF609.

[0007] Preferably, the nucleotide sequence of the crRNA targeting circ-ZNF609 is shown in SEQ ID NO: 1 or SEQ ID NO: 2.

[0008] Preferably, the nucleotide sequence of the shRNA targeting circ-ZNF609 is shown in SEQ ID NO:3.

[0009] Preferably, the gene-derived products of crRNA and / or shRNA targeting circ-ZNF609 include at least one of the following products containing crRNA and / or shRNA targeting circ-ZNF609: a recombinant vector, a recombinant virus strain, and a drug delivery system.

[0010] Preferably, the myocardial hypertrophy includes pathological myocardial hypertrophy.

[0011] Preferably, the myocardial hypertrophy is induced by pressure overload.

[0012] Preferably, the myocardial hypertrophy has at least one of the following symptoms: decreased cardiac ejection fraction, increased ventricular anterior wall thickness, myocardial cell hypertrophy and heart failure.

[0013] The present invention provides a crRNA targeting circ-ZNF609, the nucleotide sequence of which is shown in SEQ ID NO: 1 or SEQ ID NO: 2.

[0014] The present invention provides a drug for treating myocardial hypertrophy, comprising the crRNA targeting circ-ZNF609 or a gene-derived product of the crRNA targeting circ-ZNF609 in the application and a pharmaceutically acceptable excipient.

[0015] Compared with the prior art, the present invention has the following advantages:

[0016] The present invention provides an application of an agent for intervening the expression of circ-ZNF609 in the preparation of a drug for preventing and / or treating myocardial hypertrophy. The experiments of the present invention show that the expression of circ-ZNF609 in myocardial tissue is closely related to the occurrence and development of pathological myocardial hypertrophy caused by pressure overload. By intervening in the expression of circ-ZNF609 in myocardial tissue, pathological myocardial hypertrophy can be inhibited, cardiac contractile function can be improved, and pathological ventricular remodeling caused by pressure overload can be resisted. It can be seen that the present invention provides a new approach for the treatment of myocardial hypertrophy.

[0017] The present invention provides a drug for treating myocardial hypertrophy, the drug comprising a crRNA targeting circ-ZNF609 or a gene-derived product of the crRNA targeting circ-ZNF609 and a pharmaceutically acceptable excipient. The present invention administers a reagent containing circ-ZNF609 to mice by intravenous injection, and the results show that after injection, the decreased cardiac function caused by pathological myocardial hypertrophy caused by pressure load can be improved, and pathological myocardial hypertrophy caused by pressure load can be effectively treated. It can be seen that the present invention provides a new idea for the treatment of myocardial hypertrophy and enriches the myocardial hypertrophy drug library. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 The results of crRNA screening targeting circ-ZNF609 in Example 1 are shown in Figure 1, wherein A is a schematic diagram of crRNA screening, and B is a result diagram of circ-ZNF609 RNA expression level, NT: control, 1: crRNA-1, 2: crRNA-2, 3: crRNA-3;

[0019] Figure 2 The results of the echocardiogram test 2 weeks after the modeling surgery in Example 2 are shown in Figure 2, wherein A is the echocardiogram, and B is the statistical graph of the ejection fraction and the end-diastolic thickness of the left ventricular anterior wall;

[0020] Figure 3 The results of the echocardiogram test 4 weeks after intravenous injection in Example 3 are shown in Figure A, and the statistical graphs of ejection fraction and left ventricular anterior wall end-diastolic thickness are shown in Figure B;

[0021] Figure 4 This is the result of fluorescence quantitative PCR detection of circ-ZNF609 expression in myocardial tissue 4 weeks after intravenous injection in Example 3;

[0022] Figure 5 The results of WGA staining of myocardial tissue 4 weeks after intravenous injection in Example 3, wherein A is the WGA staining image of myocardial tissue, wherein the scale bar is 20 μm; B is the statistical graph of myocardial cell area;

[0023] Figure 6 The diagram is a diagram of the echocardiographic test results in Example 4, wherein Figure A is an echocardiogram, and Figure B is a statistical diagram of ejection fraction and left ventricular short axis shortening rate;

[0024] Figure 7 The WGA staining result diagram of myocardial tissue in Example 4, wherein Figure A is a WGA staining diagram of myocardial tissue, wherein the scale bar is 20 μm; Figure B is a statistical diagram of myocardial cell area;

[0025] Figure 1 to Figure 7 ** indicates p-value less than 0.01, and * indicates p-value less than 0.05. DETAILED DESCRIPTION

[0026] The present invention provides use of an agent for intervening in circ-ZNF609 expression in preparing a drug for preventing and / or treating myocardial hypertrophy.

[0027] In the present invention, the agent intervening in the expression of circ-ZNF609 preferably includes crRNA and / or shRNA targeting circ-ZNF609 or gene-derived products of the crRNA and / or shRNA targeting circ-ZNF609.

[0028] In the present invention, crRNA and / or shRNA targeting circ-ZNF609 can target circ-ZNF609 RNA, thereby reducing the expression level of circ-ZNF609 RNA.

[0029] In the present invention, when the circ-ZNF609 is derived from human, the gene accession number of the circ-ZNF609 in the circBase database is: hsa_circ_0000615. When the circ-ZNF609 is derived from mouse, the gene accession number of the circ-ZNF609 in the circBase database is: mmu_circ_0001797.

[0030] In an embodiment of the present invention, in order to illustrate the therapeutic efficacy of the reagent targeting circ-ZNF609 on myocardial hypertrophic disease, an experiment was conducted on mice. The nucleotide sequence of the crRNA targeting circ-ZNF609 is preferably as shown in SEQ ID NO: 1 (TCCAGTGGACAACATCATTGCTTTTCAGAC) or SEQ ID NO: 2 (AACATCATTGCTTTTCAGACTTGACTTTCT). In an embodiment of the present invention, the inhibitory effect of different types of crRNA on the expression level of circ-ZNF609 RNA was also screened, and the results showed that the nucleotide sequence of crRNA-2 shown in SEQ ID NO: 1 or crRNA-3 shown in SEQ ID NO: 2 can significantly inhibit the expression level of circ-ZNF609 RNA, while the nucleotide sequence of crRNA-1 shown in SEQ ID NO: 4 (TGGACAACATCATTGCTTTTCAGACTTGAC) cannot effectively inhibit the expression level of circ-ZNF609 RNA.

[0031] In the present invention, the nucleotide sequence of the shRNA targeting circ-ZNF609 is shown in SEQ ID NO: 3 (AGTCAAGTCTGAAAAGCAATGCTCGAGCATTGCTTTTCAGACTTGACTT TTTTG).

[0032] In the present invention, the gene-derived products of crRNA and / or shRNA targeting circ-ZNF609 include at least one of the following products comprising crRNA and / or shRNA targeting circ-ZNF609: a recombinant vector, a recombinant virus strain, and a drug delivery system. The backbone vector of the recombinant vector comprising crRNA targeting circ-ZNF609 preferably includes a CRISPR-Cas vector. The present invention does not specifically limit the type of CRISPR-Cas vector, and any CRISPR-Cas vector commonly used in the art may be used, for example, a CRISPR-Cas9 vector, a CRISPR-Cas12a vector, a CRISPR-Cas13 vector, and a CRISPR-CasRx vector. In an embodiment of the present invention, CRISPR-hfCas13x is used as a backbone vector, and the crRNA targeting circ-ZNF609 is inserted into the backbone vector to obtain a recombinant vector CRISPR-hfCas13x-crRNA. The CRISPR-hfCas13x is obtained by replacing the CasRx in AAV-EFS-NLS-CasRx-U6-DR-sgRNA_LacZ-DR (addgene#154003) with hfCas13x in pCBh_NLS_hfCas13X (Cas13X_M17YY)_NLS-pA-U6-DR-BpiI-BpiI-DR-pSV40-EGFP-pA-pSV40-mCherry-pA (addgene#190033). Using CRISPR-hfCas13x as a backbone vector can effectively inhibit the expression level of crRNA of circ-ZNF609. The backbone vector of the recombinant vector containing shRNA targeting circ-ZNF609 preferably includes a pSilencer1.0 vector. In the embodiment of the present invention, pENN.AAV.U6.ShRLuc.CMV.EGFP.SV40 (p1867) is used as a backbone vector to construct a recombinant vector. The present invention does not specifically limit the method for constructing a recombinant vector, and the commonly used method for constructing a recombinant vector in the art can be used.

[0033] In the present invention, the type of the recombinant virus strain preferably includes at least one of the following: lentivirus, adenovirus, adeno-associated virus and poxvirus. The adeno-associated virus preferably includes adeno-associated virus type 9 (AAV9). In an embodiment of the present invention, a recombinant vector containing crRNA (CRISPR-hfCas13x-crRNA-3) targeting circ-ZNF609 is packaged into a recombinant virus strain (AAV9-CRISPR-hfCas13x-crRNA-3), and a recombinant vector containing shRNA targeting circ-ZNF609 is packaged into a recombinant virus strain (AAV9-shRNA-circZNF609). The obtained recombinant virus strain can deliver crRNA or shRNA targeting circ-ZNF609 to cardiomyocytes to exert the efficacy of treating myocardial hypertrophy. The present invention does not specifically limit the method of virus packaging, and the virus packaging method commonly used in the art can be used. In an embodiment of the present invention, the recombinant vector is packaged into a recombinant virus strain with the assistance of AAV9 capsid plasmid and Helper plasmid. The virus titer of the working solution of the recombinant virus strain is preferably 10^ 13 vg / mL.

[0034] In the present invention, the drug delivery system preferably includes a liposome delivery system and / or a protein cage delivery system. The present invention does not specifically limit the preparation method of the drug delivery system, and the preparation method of the drug delivery system commonly used in the art can be used.

[0035] In the present invention, the myocardial hypertrophy preferably includes pathological myocardial hypertrophy. The myocardial hypertrophy preferably has at least one of the following symptoms: decreased cardiac ejection fraction, increased ventricular anterior wall thickness, myocardial cell hypertrophy and heart failure. The myocardial hypertrophy is preferably caused by pressure overload, and more preferably caused by at least one of the following: hypertension, aortic stenosis and mitral regurgitation. In the embodiment of the present invention, the effect of the reagent intervening circ-ZNF609 expression is illustrated by taking the pathological myocardial hypertrophy induced by aortic arch coarctation as an example. After aortic arch coarctation, the cardiac ejection fraction of mice decreased significantly, the ventricular anterior wall thickness increased significantly, and the myocardial cells increased significantly, indicating that the pathological myocardial hypertrophy model of the present invention was successfully constructed. In the embodiment of the present invention, the therapeutic effect of the reagent intervening circ-ZNF609 expression on the model mice was detected. The results showed that compared with the control, the administration of the reagent intervening circ-ZNF609 expression can significantly reduce the decrease in cardiac ejection fraction and the increase in ventricular anterior wall thickness induced by aortic arch coarctation, and significantly reduce myocardial cell hypertrophy. Therefore, the reagents for intervening in circ-ZNF609 expression of the present invention can inhibit pathological myocardial hypertrophy, improve cardiac contractile function, and resist pathological ventricular remodeling caused by pressure overload.

[0036] The invention provides a crRNA targeting circ-ZNF609, the nucleotide sequence of which is shown in SEQ ID NO: 1 or SEQ ID NO: 2.

[0037] The present invention provides a drug for treating myocardial hypertrophy, comprising the crRNA targeting circ-ZNF609 or a gene-derived product of the crRNA targeting circ-ZNF609 in the application and a pharmaceutically acceptable excipient.

[0038] In the present invention, the method of using the drug is preferably intravenous injection. The dosage form of the drug preferably includes injection solution or injection powder.

[0039] In order to further illustrate the present invention, the application of the reagent for intervening circ-ZNF609 expression provided by the present invention in the preparation of a drug for preventing and / or treating myocardial hypertrophy is described in detail below in combination with the accompanying drawings and examples, but they should not be construed as limiting the scope of protection of the present invention.

[0040] Example 1

[0041] 1. Screening of crRNA targeting circ-ZNF609

[0042] The crRNA was designed based on the RNA sequence of circ-ZNF609 (gene accession number mmu_circ_0001797 in the circBase database, see Figure 1 In A, the specific sequence is as follows:

[0043] crRNA-1: TGGACAACATCATTGCTTTTCAGACTTGAC (SEQ ID NO: 4);

[0044] crRNA-2: TCCAGTGGACAACATCATTGCTTTTCAGAC (SEQ ID NO: 1);

[0045] crRNA-3: AACATCATTGCTTTTCAGACTTGACTTTCT (SEQ ID NO: 2).

[0046] The crRNA sequences were seamlessly cloned into the DR sequences in the backbone plasmid by gene synthesis, wherein the seamless cloning reagent was 2 ×MultiF Seamless Assembly Mix, purchased from Abclonal: RK21020; the backbone plasmid was obtained by replacing CasRx in AAV-EFS-NLS-CasRx-U6-DR-sgRNA_LacZ-DR (addgene #154003) with hfCas13x in pCBh_NLS_hfCas13X (Cas13X_M17YY)_NLS-pA-U6-DR-BpiI-BpiI-DR-pSV40-EGFP-pA-pSV40-mCherry-pA (addgene #190033). The obtained recombinant vector was transferred into Escherichia coli competent cells Stbl3, and after Sanger sequencing, the plasmid of the positive transformant was extracted to obtain CRISPR-hfCas13x-crRNA-1, CRISPR-hfCas13x-crRNA-2, and CRISPR-hfCas13x-crRNA-3.

[0047] 2. Packaging, Isolation and Purification of AAV9 Virus

[0048] 293T cells were seeded in 10 cm cell culture dishes at a density of 4 million cells per dish. After 24 hours, 1 mL of serum-free DMEM medium containing 10 μg CRISPR-hfCas13x-crRNA-3, 10 μg AAV capsid plasmid, 10 μg Helper plasmid, and 90 μL PEI MAX was added to each dish.

[0049] Twelve hours after transfection, the medium was replaced with fresh DMEM complete medium, and cells and viruses in culture were collected 48 hours later.

[0050] To collect the virus in the culture medium: add 25 mL of 40% PEG-8000 per 100 mL of cell supernatant, centrifuge at 2800 g overnight at 4 ° C, and centrifuge for 15 min at 15 ° C. Add 1 mL of cell lysis buffer to the virus pellet and resuspend.

[0051] Virus collection from cells: Cells collected by scraping were resuspended in 5 mL of cell lysis buffer and frozen and thawed three times.

[0052] The virus suspension in the culture medium was mixed with the frozen-thawed cell suspension, and a final concentration of 1 mmol / L magnesium chloride and a final concentration of 250 U / mL Benzonase nuclease (Milipore E1014) were added, and digested at 37°C for 1 hour, followed by centrifugation at 4000 rpm for 4 minutes at 4°C and the supernatant was collected. Finally, the virus was purified by iodixanol gradient density centrifugation to obtain the recombinant virus strain AAV9-CRISPR-hfCas13x-crRNA-3.

[0053] Virus titer detection method: dilute the viral vector plasmid to 1ng / μL, and calculate that the plasmid copy number concentration at this time is: 1.36×10 11 vg / mL. The plasmid was diluted 13 times to obtain standards 1 to 14, and the 2-fold diluted Standard DNA dilution was used to prepare the standard curve.

[0054] Take 5 μL of the purified virus AAV9-CRISPR-hfCas13x-crRNA-3 prepared above, and use the blood / cell / tissue genomic DNA extraction kit (DP304) (TIANGEN Bio) according to the instructions to extract viral gDNA. The gDNA was finally eluted with 50 μL ddH2O, and then the viral gDNA was diluted 100 times and the viral titer was detected by qPCR.

[0055] qPCR reaction system (10 μL): SYBR Green 5 μL, upstream primer F and downstream primer R (10 μM) 0.5 μL each, ddH2O 2 μL, standard DNA diluent or viral genomic DNA 2 μL;

[0056] The sequences of the upstream primer F and downstream primer R used in the qPCR reaction are as follows:

[0057] Upstream primer F: 5'-AAGTACGCCCCCTATTGACG-3' (SEQ ID NO: 5);

[0058] Downstream primer R: 5'-CACGCCCATTGATGTACTGC-3' (SEQ ID NO: 6).

[0059] The qPCR reaction procedure was as follows: pre-denaturation at 95°C for 10 min; denaturation at 95°C for 15 sec, annealing at 60°C for 30 sec, and 40 cycles.

[0060] Since the logarithm of the cycle number and the Standard DNA dilution concentration is linearly related, the virus titer is obtained by linear fitting. After the titer is determined, the AAV9 virus can be directly used for animal experiments or frozen at -80°C.

[0061] The methods for packaging recombinant viruses, isolating and purifying CRISPR-hfCas13x-crRNA-1 and CRISPR-hfCas13x-crRNA-2 are the same as those for CRISPR-hfCas13x-crRNA-3.

[0062] 3. Virus transfection cells and detection of inhibitory effects

[0063] After recombinant viruses packaging different crRNAs were transfected into C2C12 cells, qPCR was used to detect the expression of circ-ZNF609. -(ΔΔCt) The expression changes of circ-ZNF609 were analyzed by computational analysis.

[0064] qPCR reaction system (10 μL): SYBR Green 5 μL, upstream primer F and downstream primer R (10 μM) 0.5 μL each, ddH2O 2 μL, cDNA diluent 2 μL;

[0065] The sequences of the upstream primer F and downstream primer R used in the qPCR reaction are as follows:

[0066] Upstream primer F: 5'-CCTTTGGGAACTAAGCCGGA-3' (SEQ ID NO: 7);

[0067] Downstream primer R: 5'-GTCTCAACCGGGTTTGCATC-3' (SEQ ID NO: 8).

[0068] The qPCR reaction procedure was as follows: pre-denaturation at 95°C for 30 sec; denaturation at 95°C for 15 sec, annealing and extension at 60°C for 30 sec, 40 times.

[0069] The test results of different crRNAs are as follows Figure 1 As shown. Figure 1 It can be seen that crRNA-2 and crRNA-3 can significantly reduce the level of circ-ZNF609 RNA, and crRNA-3 is slightly better than crRNA-2.

[0070] Example 2

[0071] 1. Establishment of a mouse model of pathological myocardial hypertrophy induced by aortic arch constriction surgery

[0072] Preparation for surgery: Before surgery, the surgical instruments were sterilized with high temperature and high pressure, the operating table was wiped and disinfected with 75% alcohol, the constant temperature blanket temperature was set to 34°C, the small animal ventilator frequency was 110-120 times / min, and the tidal volume was 2.0 ml. C57BL / 6J male mice aged 8 to 10 weeks (purchased from Beijing Weitong Lihua Experimental Animal Technology Co., Ltd.) were randomly divided into aortic arch stenosis surgery group (TAC) and sham surgery group (Sham). The mice were weighed, anesthetized with 4% chloral hydrate at a standard of 10 μL / g body weight by intraperitoneal injection, and the mice were fixed in a supine position on a constant temperature pad with medical tape. Cotton swabs were dipped in depilatory cream and applied to the neck and chest skin of the mice. After 1 minute, the hair was shaved off with a blade to expose the skin, and the exposed skin was disinfected with 75% alcohol.

[0073] Surgical procedure:

[0074] The aortic arch stenosis surgery group cut a 0.5 cm small incision in the mouse neck longitudinally under a stereoscope, separated the muscles and tissues covering the trachea, and exposed the trachea. After the trachea was exposed, a small incision was made horizontally with a scalpel, and a tracheal cannula was inserted between the two tracheal cartilage rings under the glottis. After the cannula was fixed, the mouse chest rise and fall was checked to match the ventilator frequency to ensure that the mouse breathed smoothly. Under a stereoscope, the mouse ribs were cut longitudinally from top to bottom, about to the second rib, and the sternum was pulled apart on both sides with a retractor. The thymus was separated with forceps, and the adipose tissue was slowly separated to find the aortic arch. A thin line was used to pass through the aortic arch between the left common carotid artery and the right brachiocephalic artery to tie a knot. Do not pull the knot in first, put the 27G syringe needle in the knot hole, and then tighten the knot to ensure that the knot hole is about the same size as the needle, and then quickly withdraw the needle. The ribs, muscles and skin were sutured layer by layer and the wound was disinfected with iodine. After the mouse has spontaneous breathing, turn off the ventilator and transfer it to a constant temperature blanket for recovery; after the anesthetic wears off and the mouse fully wakes up, put it back into the cage and continue to be raised.

[0075] The sham operation group performed the same steps as the aortic arch stenosis surgery group, except that the ligation was not performed.

[0076] 2. Mouse Heart Ultrasound Detection

[0077] Four weeks later, the mice in the aortic arch coarctation surgery group and the sham surgery group were subjected to cardiac color Doppler ultrasound examination. Specifically, the mice were depilated and wiped clean on their chests, and then anesthetized with isoflurane. The heart rate was stabilized at 450 to 500 beats / min. The small animal cardiac ultrasound detection system (Visual Sonics, Vevo2100) was used to detect the cardiac contractile function of the mice, and the B-mode long-axis image of the left ventricle of the mice was collected, and the M-mode image was collected at the maximum left ventricular diameter. The left ventricular ejection fraction and the end-diastolic thickness of the left ventricular anterior wall were calculated using the LVtrace tool.

[0078] Echocardiographic results Figure 2 and as shown in Table 1. A total of 24 mice were subjected to cardiac ultrasound examination, 12 of which were from the sham operation group and the other 12 were from the aortic arch constriction operation group.

[0079] Table 1 Echocardiographic test results

[0080]

[0081]

[0082] It can be seen that compared with the sham operation group, the cardiac ejection fraction of mice in the aortic arch constriction surgery group was significantly decreased, and the end-diastolic thickness of the left ventricular anterior wall was significantly increased, indicating that the model was successfully constructed.

[0083] Example 3

[0084] AAV9-CRISPR-hfCas13x-crRNA-3 therapeutic experiments in mice

[0085] 1. Intravenous therapy

[0086] Two weeks after the aortic arch constriction surgery or sham surgery, different agents were injected into the tail vein of the mice in Example 2 at a dose of 1.50×10^ 12 vg / mouse, details are as follows.

[0087] The mice in the sham operation group were divided into two groups: Sham AAV9-Control NT: control virus was injected into the tail vein; ShamAAV9-crRNA-3: AAV9-CRISPR-hfCas13x-crRNA-3 was injected into the tail vein;

[0088] The mice in the aortic arch coarctation surgery group were divided into two groups: TAC AAV9-ControlNT: control virus was injected into the tail vein; TAC AAV9-crRNA-3: AAV9-CRISPR-hfCas13x-crRNA-3 was injected into the tail vein;

[0089] The difference between the control virus and AAV9-CRISPR-hfCas13x-crRNA-3 is that the control virus does not contain crRNA-3.

[0090] 2. Mouse Heart Ultrasound Detection

[0091] After 4 weeks of intravenous injection treatment, the method of Example 2 was used to perform cardiac color Doppler ultrasound examination on the mice in each treatment group.

[0092] A total of 24 mice were subjected to cardiac ultrasound examination. Figure 3 , as shown in Table 2 and Table 3.

[0093] Table 2 Ejection fraction results after treatment (%)

[0094]

[0095]

[0096] Table 3 End-diastolic thickness of the left ventricular anterior wall after treatment (mm)

[0097]

[0098] It can be seen that tail vein injection of AAV9-CRISPR-hfCas13x-crRNA-3 can significantly alleviate the decrease in cardiac ejection fraction and increase in ventricular anterior wall thickness induced by aortic arch constriction surgery.

[0099] 3. qPCR detection of circ-ZNF609 expression changes

[0100] After Doppler ultrasound detection, the mice were euthanized and the mouse hearts were dissected. Total RNA in the heart tissue was extracted using Trizol lysis buffer, and cDNA was obtained using a reverse transcription kit. The qPCR method in Example 1 was used to detect the expression of circ-ZNF609.

[0101] qPCR results Figure 4 As shown in Table 4 , a total of 24 mouse hearts were tested for the expression of circ-ZNF609.

[0102] Table 4 Expression results of circ-ZNF609 after treatment

[0103]

[0104]

[0105] It can be seen that tail vein injection of AAV9-CRISPR-hfCas13x-crRNA-3 can significantly reduce the expression of circ-ZNF609 RNA in cardiac tissue (**, P<0.01).

[0106] 5. Mouse Myocardial Tissue Staining

[0107] The myocardial tissues of mice in each treatment group were stained with WGA to observe the myocardial cells in each treatment group.

[0108] The tissue sections produced by frozen tissue sectioning of the myocardial tissue of mice in each treatment group were adhered to glass slides, and the glass slides were stored at -80°C.

[0109] The specific dyeing method is as follows:

[0110] Rewarming: Take the frozen sections out of the -80℃ freezer and rewarm them at room temperature in a humidified box for 10-30 minutes;

[0111] Washing: Place the required slices into a slide staining jar and wash them 3 times with PBS shaker, 5 minutes each time;

[0112] Fixation: Take out the slices and place them on a wet box, wipe off the PBS, draw hydrophobic circles around the tissue with an immunohistochemistry pen, drop 4% paraformaldehyde in each circle, and fix at room temperature for 20 minutes;

[0113] Washing: Place the required slices into a slide staining jar and wash them three times with 1× PBS on a shaker, each time for 5 minutes;

[0114] WGA staining: Prepare WGA working solution according to the volume ratio of WGA-FITC 1mg / mL: 1×PBS = 1:200, wipe the PBS off the slices, add 20μL WGA working solution to each tissue, and incubate at room temperature in the dark for 2 hours;

[0115] Washing: Place the required slices into a slide staining jar and wash them three times with 1× PBS on a shaker, each time for 5 minutes;

[0116] Hoechst staining: Dilute the Hoechst staining solution with 1×PBS to obtain a Hochst working solution with a concentration of 10μg / ml. Clean the slices with PBS, add 20μL of Hochst working solution to each tissue, and incubate at room temperature in the dark for 20min.

[0117] Washing: Place the required slices into a slide staining jar and wash them three times on a shaker with 1× PBS, each time for 5 minutes;

[0118] Sealing: Wipe off PBS from the slices, add two drops of 50% glycerol (the volume ratio of glycerol to ddH2O is 1:1) in the middle of each slice, and gently put the coverslip down from one side. Do not move the glycerol at will after it contacts the tissue. Keep away from light during this process; observe under a laser confocal microscope (Carl Zeiss, Thuringia, Germany) and use Image J for statistics.

[0119] The results are as follows Figure 5 As shown in Table 5, a total of 24 heart tissue sections were subjected to WGA staining. The 24 heart tissue sections were from the above 4 groups of mice, and 6 sections in each group were from different individual mice in the group.

[0120] Table 5 Relative area of ​​myocardial cells after treatment

[0121]

[0122] It can be seen that the area of ​​myocardial cells in mice increased 6 weeks after aortic arch coarctation surgery. Tail vein injection of AAV9-CRISPR-hfCas13x-crRNA-3 for 4 weeks can resist the increase in myocardial cell area caused by aortic arch coarctation surgery and significantly reduce pathological myocardial hypertrophy.

[0123] Example 4

[0124] AAV9-shRNA-circZNF609 therapeutic experiments in mice

[0125] The preparation method of AAV9-shRNA-circZNF609 refers to the patent publication number CN 114504658 A, and the patent name is a drug for treating doxorubicin-induced cardiotoxic injury and the scheme in Example 1. The AAV9-shRNA-circZNF609 can reduce the expression level of circ-ZNF609 in the mouse heart by tail vein injection into the mouse body.

[0126] 1. Tail Vein Injection

[0127] AAV9-shRNA-circZNF609 or control AAV9 was injected into mice via tail vein injection at a dose of 10^ 12 vg / mouse, and one week later, the mice were subjected to aortic arch constriction surgery or sham surgery according to the method of Example 2. The specific groups were as follows.

[0128] Sham AAV9-shScr: sham surgery one week after injection of control AAV9;

[0129] Sham AAV9-sh-circ-ZNF609: sham operation one week after injection of AAV9-shRNA-circZNF609;

[0130] TAC AAV9-shScr: aortic arch constriction surgery one week after injection of control AAV9;

[0131] TAC AAV9-sh-circ-ZNF609: Aortic arch constriction surgery one week after injection of AAV9-shRNA-circZNF609.

[0132] The difference between control AAV9 and AAV9-shRNA-circZNF609 is that the control AAV9 does not contain shRNA targeting circZNF609.

[0133] 2. Mouse Heart Ultrasound Detection

[0134] Four weeks after the aortic arch surgery or sham surgery, the method of Example 2 was used to perform cardiac color Doppler ultrasound examination on the mice in each treatment group.

[0135] A total of 47 mice were subjected to cardiac ultrasound examination. Figure 6 .

[0136] The specific data of left ventricular fractional shortening (FS) are as follows:

[0137] Sham AAV9-shScr (9 mice): 30.27787%, 33.6993%, 28.97795%, 27.42768%, 24.46039%, 27.0092%, 25.78215%, 35.45218% and 29.98858;

[0138] Sham AAV9-sh-circ-ZNF609 (10 animals): 27.72459%, 26.72034%, 26.73345%, 28.52069%, 28.71132%, 26.53587%, 22.55435%, 21.78856%, 25.5001% and 27.15502.

[0139] TAC AAV9-shScr (15 mice): 17.17971%, 10.06305%, 10.95311%, 12.98008%, 10.12894%, 12.70758%, 15.9711%, 19.04397%, 19.42834%, 10.17631%, 11.76664%, 11.47975%, 13.42259%, 11.63106% and 10.91161;

[0140] TAC AAV9-sh-circ-ZNF609 (13 animals): 23.42796%, 31.6938%, 24.58052%, 22.73252%, 22.00015%, 23.1534%, 9.902161%, 17.37062%, 23.04311%, 21.33784%, 27.15502%, 23.25702% and 24.23188.

[0141] The specific data of ejection fraction (EF) are as follows:

[0142] Sham AAV9-shScr (9 mice): 58.39853%, 63.43506%, 56.52364%, 54.28648%, 48.93621%, 53.45324%, 51.24098%, 65.91077% and 58.08457;

[0143] Sham AAV9-sh-circ-ZNF609 (10 animals): 54.34616%, 52.92936%, 52.92626%, 55.84678%, 55.90332%, 52.53153%, 45.88121%, 44.5635%, 50.77566% and 53.52718;

[0144] TAC AAV9-shScr (15 mice): 36.13104%, 22.19088%, 23.95408%, 28.22317%, 22.37828%, 27.31153%, 33.95637%, 39.86974%, 40.65849%, 22.24971%, 26.03389%, 25.24007%, 28.95234%, 25.4668% and 24.18879;

[0145] TAC AAV9-sh-circ-ZNF609 (13 animals): 47.49602%, 60.90065%, 49.47157%, 45.99245%, 45.0641%, 46.36872%, 21.42041%, 36.42859%, 46.76895%, 43.90867%, 53.52718%, 47.29773% and 48.92548.

[0146] It can be seen that tail vein injection of AAV9-shRNA-circZNF609 can significantly reduce the decrease in cardiac ejection fraction and cardiac contractile function induced by aortic arch stenosis surgery, improve cardiac contractile function, and alleviate the abnormal cardiac function caused by aortic arch stenosis surgery.

[0147] 3. Mouse Myocardial Tissue Staining

[0148] The myocardial tissue of mice in each treatment group was stained using the method of Example 3 to observe the myocardial cells in each treatment group. Figure 7 and as shown in Table 6.

[0149] Table 6 Relative area of ​​cardiomyocytes in each treatment group

[0150]

[0151] according to Figure 7 As shown in Table 6, the area of ​​myocardial cells in mice increased after aortic arch constriction surgery, and tail vein injection of AAV9-shRNA-circZNF609 treatment could resist the increase in myocardial cell area caused by aortic arch constriction surgery.

[0152] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. Other embodiments can be obtained based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. Use of reagents that interfere with circ-ZNF609 expression in the preparation of drugs for preventing and / or treating myocardial hypertrophy.

2. The application according to claim 1, characterized in that: The reagents for intervening in the expression of circ-ZNF609 include crRNA and / or shRNA targeting circ-ZNF609 or gene-derived products of the crRNA and / or shRNA targeting circ-ZNF609.

3. The application according to claim 2, characterized in that: The nucleotide sequence of the crRNA targeting circ-ZNF609 is shown in SEQ ID NO: 1 or SEQ ID NO:

2.

4. The application according to claim 2, characterized in that: The nucleotide sequence of the shRNA targeting circ-ZNF609 is shown in SEQ ID NO:

3.

5. The use according to claim 2, characterized in that: The gene-derived products of crRNA and / or shRNA targeting circ-ZNF609 include at least one of the following products containing crRNA and / or shRNA targeting circ-ZNF609: a recombinant vector, a recombinant virus strain, and a drug delivery system.

6. The use according to any one of claims 1 to 5, characterized in that: The myocardial hypertrophy includes pathological myocardial hypertrophy.

7. The use according to any one of claims 1 to 5, characterized in that: The cardiac hypertrophy is induced by pressure overload.

8. The use according to any one of claims 1 to 5, characterized in that: The myocardial hypertrophy has at least one symptom of the following: decreased cardiac ejection fraction, increased ventricular anterior wall thickness, myocardial cell hypertrophy and heart failure.

9. A crRNA targeting circ-ZNF609, characterized in that The nucleotide sequence is shown in SEQ ID NO:1 or SEQ ID NO:

2.

10. A drug for treating myocardial hypertrophy, characterized in that: The drug comprises the crRNA targeting circ-ZNF609 in the application according to any one of claims 2 to 5 or a gene-derived product of the crRNA targeting circ-ZNF609 and a pharmaceutically acceptable excipient.

Images