Method for reducing corn plant height

Abstract

The invention belongs to the field of molecular genetics, and particularly relates to a method for reducing the plant height of corn. The invention provides a method for reducing the corn plant height through precise point mutation.

Description

Technical Field

[0001] The invention belongs to the field of molecular genetics, and in particular relates to a method for reducing corn plant height. Background Art

[0002] Dwarfing traits have brought about a breakthrough in crop yields, and methods to reduce crop plant height have great application potential. Among the main agronomic traits of corn, plant height and ear height affect corn lodging resistance, photosynthetic efficiency, and harvest index, and are closely related to corn yield. Therefore, plant height and ear height traits are of great value in corn breeding practice and germplasm resource improvement.

[0003] Gibberellin oxidase is the main regulatory site for catalyzing the late stages of GA biosynthesis and catabolism, and plays a key role in regulating the balance of gibberellins in plants. Gibberellin oxidase mainly includes different types such as GA20ox, GA3ox and GA2ox.

[0004] Since changes in the expression of GA2ox genes can affect the content of gibberellins, most GA2ox-related genetic improvement materials will undergo significant changes in plant morphology, and even the fertility of the plants will be affected, which is not conducive to the application of GA2ox genes. Studies have found that rice overexpressing wild-type OsGA2ox6 exhibits complete dwarfing traits, while rice overexpressing GA2ox6 mutants Y123A, E140A, A141E, H143A, and G343A show varying degrees of plant height reduction. Among them, E140A and A141E have the effect of increasing yield, while other mutants can affect plant height but have no positive effect on yield (Plant Biotechnology Journal, 2017, 15: 850–864).

[0005] The mutants E144A and A145E of ZmGA2ox6 in maize (corresponding to E140A and A141E in rice) have the effect of improving drought tolerance in Arabidopsis (CN111778265 B), but it is not yet clear what phenotypic changes will occur when expressed in maize. Summary of the invention

[0006] The technical problem to be solved by the present invention is to develop a method for reducing corn plant height by mutating ZmGA2ox2.

[0007] To solve the above problems, the present invention adopts the following technical solutions:

[0008] The present invention provides a method for reducing corn plant height and / or ear height without reducing yield, characterized in that: the T at position 341 of the protein of the sequence shown in SEQ ID NO.2 in corn is mutated to A.

[0009] In some embodiments, the above method is to mutate the gene with the sequence shown in SEQ ID NO.1 or the gene numbered Zm00001d002999 in corn to G at position 2400.

[0010] In some embodiments, the above-mentioned mutation of A to G is achieved by a guided editing approach targeting AGGAGGACGTCAAGAGGAC or GAAGAAAGATTGGGCTCCC or its reverse complementary sequence.

[0011] In some embodiments, the nuclease used in the above-mentioned gene editing is nSpCas9 fused with M-MLV.

[0012] In some embodiments, the amino acid sequence of the above-mentioned nSpCas9 is shown in SEQ ID NO.4.

[0013] The present invention also provides a kit for reducing corn plant height and / or ear height without reducing yield, characterized in that it comprises any one of the following:

[0014] (1) a pegRNA molecule capable of recognizing the above target;

[0015] (2) a DNA molecule encoding the pegRNA described in (1);

[0016] (3) A vector for expressing the pegRNA described in (1).

[0017] In some embodiments, the sequence of the pegRNA molecule is

[0018] CAGGAGGACGUCAAGAGGACGUUUUAGAGCUAGAAAUAGCAAGUUA

[0019] AAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCG GUGCUCUUUCUUCCGGCCCUCUUGACGUCCUUU.

[0020] In some embodiments, the above-mentioned kit also includes nSpCas9 fused to M-MLV.

[0021] In some embodiments, the amino acid sequence of the nSpCas9 is shown as SEQ ID NO.4, and the amino acid sequence of the M-MLV is shown as SEQ ID NO.6.

[0022] The present invention also provides a method for increasing corn yield, characterized in that: the E at position 144 of the protein of the sequence shown in SEQ ID NO.2 in corn is mutated to A.

[0023] In some embodiments, the above method is to mutate the 555th position A to C of the gene of the sequence shown in SEQ ID NO.1 or the gene numbered Zm00001d002999 in corn.

[0024] In some embodiments, the above-mentioned mutation of A to C is achieved by gene editing targeting CCGCCACCTCTCGTGGTCGG or CGTCCCGCTCGCCAGCATC or its reverse complementary sequence.

[0025] In some embodiments, the nuclease used in the above-mentioned gene editing is nSpCas9 fused with M-MLV.

[0026] In some embodiments, the amino acid sequence of the nSpCas9 is shown as SEQ ID NO.4, and the amino acid sequence of the M-MLV is shown as SEQ ID NO.6.

[0027] The present invention also provides a kit for increasing corn yield, characterized in that it comprises any one of the following:

[0028] (1) an RNA molecule capable of recognizing the above target;

[0029] (2) a DNA molecule encoding the RNA described in (1);

[0030] (3) A vector for expressing the RNA described in (1).

[0031] In some embodiments, the sequence of the RNA molecule is

[0032] CCGCCACCUCUCGUGGUCGGGUUUUAGAGCUAGAAAUAGCAAGUUAA

[0033] AAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUGGAACUCCCGCCGACCACGAGAUUU.

[0034] In some embodiments, the above-mentioned kit also includes nSpCas9 fused to M-MLV.

[0035] In some embodiments, the amino acid sequence of the nSpCas9 is shown as SEQ ID NO.4, and the amino acid sequence of the M-MLV is shown as SEQ ID NO.6.

[0036] The advantages and beneficial effects of the present invention are as follows: the present invention uses the guide editing technology to mutate the maize ZmGA2ox2 gene, and the obtained mutant T341A has reduced plant height and ear height, and the yield is not affected; while the yield of the E144A mutant is significantly increased. The above two mutants have industrial application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 Vector element information for overexpression and knockout of ZmGA2ox2 gene. A: Schematic diagram of T-DNA region elements of overexpression vector. B: Schematic diagram of T-DNA region elements of gene editing knockout vector. C: Target position and sequence of knockout vector. D: Mutation of gene after editing.

[0038] Figure 2 Plant height performance of maize with overexpression and knockout of ZmGA2ox2 gene in the field. WT: wild-type maize; KO: knockout maize; OE: overexpression maize.

[0039] Figure 3 Plant height performance of corn overexpressing ZmGA2ox2 mutant gene in the field. E144A-OE(+): positive E144A overexpression corn; A145E-OE(+): positive A145E overexpression corn; E144A-OE(-): E144A overexpression negative control; A145E-OE(-): A145E overexpression negative control.

[0040] Figure 4 The creation process of E144A and T341A precision editing materials. A: The structure of the T-DNA region of the precision editing vector; B: The location and sequence of the target gene; C: The specific mutation situation. DETAILED DESCRIPTION

[0041] The following definitions and methods are provided to better define this application and guide those of ordinary skill in the art in the practice of this application. Unless otherwise specified, terms are understood according to the conventional usage of those of ordinary skill in the relevant field. All patent documents, academic papers, industry standards and other public publications cited herein are incorporated herein by reference in their entirety.

[0042] As used herein, "corn" is any corn plant and includes all plant varieties that can be bred with corn, including whole plants, plant cells, plant organs, plant protoplasts, plant cell tissue cultures from which plants can be regenerated, plant callus, intact plant cells in plants or plant parts, such as embryos, pollen, ovules, seeds, leaves, flowers, branches, fruits, stems, roots, root tips, anthers, etc. Unless otherwise indicated, nucleic acids are written from left to right in a 5' to 3' direction; amino acid sequences are written from left to right in an amino to carboxyl direction. Amino acids can be represented herein by their commonly known three-letter symbols or by the single-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Similarly, nucleotides can be represented by commonly accepted single-letter codes. Numerical ranges include numbers that limit the range. As used herein, "nucleic acid" includes deoxyribonucleotides or ribonucleotide polymers in single-stranded or double-stranded form, and unless otherwise limited, includes known analogs (e.g., peptide nucleic acids) having the basic properties of natural nucleotides, which hybridize with single-stranded nucleic acids in a manner similar to naturally occurring nucleotides. As used herein, the term "encoding" or "encoded" is used in the context of a specific nucleic acid to refer to the nucleic acid containing the necessary information for directing the translation of the nucleotide sequence into a specific protein. Codons are used to represent information for encoding proteins. As used herein, the "full-length sequence" of a specific polynucleotide or its encoded protein refers to the entire nucleic acid sequence or the entire amino acid sequence with a natural (non-synthetic) endogenous sequence. The full-length polynucleotide encodes the full-length, catalytically active form of the specific protein. The terms "polypeptide" and "protein" are used interchangeably herein to refer to polymers of amino acid residues. The term is used for amino acid polymers in which one or more amino acid residues are artificial chemical analogs of the corresponding naturally occurring amino acids. The term is also used for naturally occurring amino acid polymers. The terms "residue" or "amino acid residue" or "amino acid" are used interchangeably herein to refer to an amino acid that is incorporated into a protein, polypeptide, or peptide (collectively, "protein"). The amino acid may be a naturally occurring amino acid and, unless otherwise limited, may include known analogs of a natural amino acid that may function in a manner similar to that of a naturally occurring amino acid.

[0043] As used herein, the terms "isolated" and "purified" are used interchangeably to refer to a nucleic acid or polypeptide, or biologically active portion thereof, that is substantially or essentially free of components that normally accompany or react with the nucleic acid or polypeptide as found in the environment in which it naturally occurs. Thus, an isolated or purified nucleic acid or polypeptide is substantially free of other cellular material or culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized. An "isolated" nucleic acid is typically free of sequences (such as protein-encoding sequences) that naturally flank the nucleic acid (i.e., sequences located at the 5' and 3' ends of the nucleic acid) in the genomic DNA of the organism from which the nucleic acid is derived. For example, in various embodiments, an isolated nucleic acid may contain less than about 0.5 kb of nucleotide sequences that naturally flank the nucleic acid in the genomic DNA of the cell from which the nucleic acid is derived.

[0044] In this application, the words "comprise", "comprising" or their variants are to be understood as including other elements, numbers or steps in addition to the described elements, numbers or steps. "Test plant" or "test plant cell" refers to a plant or plant cell in which a genetic modification has been effected, or a progeny cell of a plant or cell so modified, which progeny cell comprises the modification. "Control" or "control plant" or "control plant cell" provides a reference point for measuring phenotypic changes in the test plant or plant cell. Control plants or plant cells can include, for example: (a) wild-type plants or cells, i.e., plants or cells having the same genotype as the genetically modified starting material that produced the test plant or cell; (b) plants or plant cells having the same genotype as the starting material but that have been transformed with an empty construct (i.e., a construct with no known effect on the trait of interest, such as a construct comprising a marker gene); (c) plants or plant cells that are non-transformed segregants of the test plant or plant cell; (d) plants or plant cells that are genetically identical to the test plant or plant cell but have not been exposed to conditions or stimuli that would induce expression of the gene of interest; or (e) the test plant or plant cell itself, which is under conditions where the gene of interest is not expressed.

[0045] Those skilled in the art will readily recognize that advances in the field of molecular biology, such as site-specific and random mutagenesis, polymerase chain reaction methods, and protein engineering techniques, provide a wide range of appropriate tools and procedures for modifying or engineering the amino acid sequence and underlying gene sequence of proteins of agricultural interest.

[0046] In some embodiments, the nucleotide sequence of the present application can be changed to perform conservative amino acid substitutions. The principles and examples of conservative amino acid substitutions are further described below. In certain embodiments, the nucleotide sequence of the present application can be replaced without changing the amino acid sequence according to the disclosed monocot codon preference, for example, the codons encoding the same amino acid sequence can be replaced with codons preferred by monocot plants without changing the amino acid sequence encoded by the nucleotide sequence. In some embodiments, a portion of the nucleotide sequence in the present application is replaced with different codons encoding the same amino acid sequence, thereby not changing the amino acid sequence encoded by the nucleotide sequence while changing the nucleotide sequence. Conservative variants include those sequences that encode an amino acid sequence of one of the proteins of the embodiment due to genetic codon degeneracy. In some embodiments, a portion of the nucleotide sequence in the present application is replaced according to monocot plant preference codons. Those skilled in the art will recognize that amino acid additions and / or substitutions are generally based on the relative similarity of amino acid side chain substituents, for example, the hydrophobicity, charge, size, etc. of the substituent. Exemplary amino acid substitution groups with various aforementioned properties considered are well known to those skilled in the art and include arginine and lysine; glutamic acid and aspartic acid; serine and threonine; glutamine and asparagine; and valine, leucine and isoleucine. Guidance on appropriate amino acid substitutions that do not affect the biological activity of the target protein can be found in the model of Dayhoff et al. (1978) Atlas of Protein Sequence and Structure (Natl. Biomed. Res. Found., Washington, DC) (incorporated herein by reference). Conservative substitutions such as replacing one amino acid with another amino acid having similar properties can be performed. Identification of sequence identity includes hybridization techniques. For example, all or part of a known nucleotide sequence is used as a probe for selective hybridization with other corresponding nucleotide sequences, and the other corresponding nucleotide sequences are present in a cloned genomic DNA fragment or cDNA fragment group (i.e., a genomic library or a cDNA library) from a selected organism.

[0047] In some embodiments, a fragment of a nucleotide sequence and an amino acid sequence encoded therein is also included. As used herein, the term "fragment" refers to a portion of the nucleotide sequence of the polynucleotide of the embodiment or a portion of the amino acid sequence of the polypeptide. The fragment of the nucleotide sequence can encode a protein fragment, and the protein fragment retains the biological activity of the natural or corresponding full-length protein, and thus has protein activity. Mutant proteins include biologically active fragments of natural proteins, which contain continuous amino acid residues that retain the biological activity of natural proteins. Some embodiments also include transformed plant cells or transgenic plants, which include the nucleotide sequence of at least one embodiment. In some embodiments, an expression vector is used to transform a plant, and the expression vector includes the nucleotide sequence of at least one embodiment and a promoter that drives expression in a plant cell operably connected thereto. Transformed plant cells and transgenic plants represent plant cells or plants that contain heterologous polynucleotides in the genome. In general, the heterologous polynucleotides are stably integrated in the genome of the transformed plant cell or transgenic plant, so that the polynucleotides are passed to offspring. The heterologous polynucleotides can be integrated into the genome individually or as part of an expression vector. In some embodiments, the plants involved in the present application include plant cells, plant protoplasts, plant cell tissue cultures that can regenerate plants, plant calli, plant masses and plant cells, which are complete plants or parts of plants, such as embryos, pollen, ovules, seeds, leaves, flowers, branches, fruits, kernels, spikes, cobs, shells, stalks, roots, root tips, anthers, etc. The present application also includes plant cells, protoplasts, tissues, calli, embryos, flowers, stems, fruits, leaves and roots derived from the transgenic plants of the present application or their progeny, and thus at least partially comprising the nucleotide sequences of the present application.

[0048] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. Without departing from the spirit and substance of the present invention, the modification or replacement of the inventive method, step or condition, all belong to the scope of the present application. If not otherwise specified, the embodiments are according to conventional experimental conditions, such as Sambrook et al.'s Molecular Cloning Laboratory Manual (Sambrook J & Russell DW, Molecular cloning: alaboratory manual, 2001), or according to the conditions of the manufacturer's instructions. If not otherwise specified, the chemical reagents used in the embodiments are conventional commercial reagents, and the technical means used in the embodiments are conventional means well known to those skilled in the art.

[0049] Example

[0050] Example 1 Effects of overexpression and knockout of ZmGA2ox2 gene on maize phenotype

[0051] In order to clarify whether the ZmGA2ox2 gene (gene number Zm00001d002999) is related to the plant height trait of maize, the inventors first used conventional overexpression and gene editing knockout techniques to overexpress and knockout the ZmGA2ox2 gene in the maize inbred line KN5585. The overexpression used the ubi promoter to drive the gene CDS sequence, and the gene knockout used three sgRNAs to knock out the gene at the same time (see the schematic diagram of the vector T-DNA for overexpression and gene editing). Figure 1 ). After obtaining overexpression and edited corn materials, the plant height and ear height traits were investigated. The results showed that the overexpression corn materials were extremely dwarfed and did not produce fruit, with plant height reduced by 52.53% and ear height reduced by 57.43%. The plant height and ear height of gene-edited corn increased significantly, with plant height increased by 4.71% and ear height increased by 7.97% ( Figure 2 )

[0052] The above results indicate that the ZmGA2ox2 gene has the function of regulating corn plant height, but direct overexpression and knockout cannot produce corn materials with industrial application value.

[0053] Example 2 Trait performance of corn overexpressing ZmGA2ox2 mutant

[0054] Since directly overexpressing the ZmGA2ox2 gene will cause extreme dwarfing of corn and a very low fruiting rate, it has no practical application value. The inventor intends to perform point mutation on ZmGA2ox2 and then overexpress it. The protein mutation site selects three gibberellin binding sites A145E, E144A, and T341A, and the corresponding codons change the original GAG to GCG, GCG to GAG, and ACC to GCC, respectively. Except for the ZmGA2ox2 gene mutation, the other elements of the overexpression vector are the same as those in Example 1.

[0055] The overexpression vector of the mutant gene was transformed into the maize inbred line KN5585 to obtain E144A-OE, A145E-OE, and T341A-OE transgenic plants. Among them, the T341A-OE plants could not grow to harvest, while the E144A-OE and A145E-OE plants were able to complete the growth cycle. The gibberellin content of the E144A-OE and A145E-OE materials increased significantly, and the corresponding plant height and ear height decreased significantly ( Figure 3 ).

[0056] Further field investigation results at the Jilin Province test base showed that compared with the negative control, the plant height and ear height of the A145E-OE material were significantly reduced, with a reduction of 25% to 45%. The plant height and ear height of the E144A-OE material were also significantly reduced, with a reduction of 12% to 30%. The field investigation results at the Hainan Province test base also showed that the plant height and ear height of the A145E-OE and E144A-OE materials were reduced by more than 20% (Table 1). However, the ear length, ear thickness, and yield of the A145E-OE and E144A-OE materials were also significantly reduced (Table 2), which also has no practical application value.

[0057] Table 1 Plant height data of corn materials with overexpressed mutant genes (unit: cm)

[0058]

[0059]

[0060] “+” and “-” indicate overexpression positive and negative controls, respectively.

[0061] Table 2 Yield trait data of corn materials with overexpressed mutant genes

[0062]

[0063] “+” and “-” indicate overexpression positive and negative controls, respectively.

[0064] Example 3: ZmGA2ox2 gene locus precise editing of maize trait expression

[0065] Although overexpression of ZmGA2ox2 gibberellin binding site mutants can reduce plant height, there is also a loss in yield. The inventors further used precise gene editing technology (guided editing) to precisely edit the A145, E144, and T341 sites of the endogenous ZmGA2ox2 gene in corn to obtain A145E, E144A, and T341A mutant materials.

[0066] Finally, the mutant materials of E144A and T341A were successfully obtained. The editing vector structures, target sequences and base editing conditions used in these two mutant materials are shown in Figure 4 The two targets designed for the E144A mutation are CCGCCACCTCTCGTGGTCGG or CGTCCGCTCGCCAGCATC;

[0067] The two targets designed for the T341A mutation are AGGAGGACGTCAAGAGGAC or GAAGAAAGATTGGGCTCCC.

[0068] The pegRNA (prime editing guide RNA) sequence of E144A is: CCGCCACCUCUCGUGGUCGGGUUUUAGAGCUAGAAAUAGCAAGUUAA AAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUGGAACUCCGCCGACCACGAGAUUU;

[0069] The pegRNA (prime editing guide RNA) sequence of T341A is: CAGGAGGACGUCAAGAGGACGUUUUAGAGCUAGAAAUAGCAAGUUA AAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCG GUGCUCUUUCUUCCGGCCCUCUUGACGUCCUUU.

[0070] The nSpCas9 used is a SpCas9 protein containing the H840A mutation, the nucleic acid sequence is shown in SEQ ID NO.3, and the encoded amino acid sequence is shown in SEQ ID NO.4. In addition, the C-terminus of nSpCas9 is also fused with M-MLV reverse transcriptase, the M-MLV nucleic acid sequence is shown in SEQ ID NO.5, and the encoded amino acid sequence is shown in SEQ ID NO.6. Protein tags (such as Flag) or nuclear localization signals can be added to both ends of nSpCas9 or M-MLV as needed.

[0071] The field survey results at the Hainan base showed that compared with the control, the gibberellin content of T341A-PE increased, the plant height and ear height became shorter, and the plant height of the homozygous material decreased significantly, with a change of 12.40%; while the ear height did not decrease significantly, but the change was 7.94%. The gibberellin content of the E144A-PE material decreased, and the plant height increased significantly (Table 3).

[0072] Further investigation of agronomic traits such as ear length, ear diameter, ear weight and grain weight revealed that the plant height and ear height of the T341A-PE homozygous material were reduced, and the above yield traits were not affected. However, the above yield traits were significantly increased when the plant height and ear height of the E144A-PE homozygous material increased (Table 4).

[0073] Table 3 Precision editing of plant height trait data of corn materials

[0074]

[0075] Table 4 Yield trait data of precisely edited corn materials

[0076]

[0077]

[0078] “+” and “-” indicate overexpression positive and negative controls, respectively.

[0079] Although the present invention has been described in detail above with general descriptions and specific embodiments, it is obvious to those skilled in the art that some modifications or improvements may be made thereto based on the present invention. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection claimed by the present invention.

Claims

1. A method for reducing corn plant height and / or ear height without reducing yield, characterized in that: The T at position 341 of the protein of the sequence shown in SEQ ID NO.2 in corn was mutated to A.

2. The method according to claim 1, characterized in that: The gene with the sequence shown in SEQ ID NO.1 or the gene numbered Zm00001d002999 in corn is mutated from A to G at position 2400.

3. The method according to claim 2, characterized in that: The mutation of A to G is achieved by guided editing targeting AGGAGGACGTCAAGAGGAC or GAAGAAAGATTGGGCTCCC or its reverse complementary sequence.

4. The method according to claim 3, characterized in that: The nuclease used in the gene editing is nSpCas9 fused with M-MLV; Optionally, the amino acid sequence of the nSpCas9 is shown as SEQ ID NO.4, and the amino acid sequence of the M-MLV is shown as SEQ ID NO.

6.

5. A kit for reducing corn plant height and / or ear height without reducing yield, characterized in that: Includes any of the following: (1) a pegRNA molecule capable of recognizing the target described in claim 3; (2) a DNA molecule encoding the pegRNA described in (1); (3) a vector expressing the pegRNA described in (1); Optionally, the sequence of the pegRNA molecule is CAGGAGGACGUCAAGAGGACGUUUUAGAGCUAGAAAUAGCAAGUUA AAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCG GUGCUCUUUCUUCCGGCCCUCUUGACGUCCUUU; Optionally, the kit further comprises nSpCas9 fused to M-MLV; Optionally, the amino acid sequence of the nSpCas9 is shown as SEQ ID NO.4, and the amino acid sequence of the M-MLV is shown as SEQ ID NO.

6.

6. A method for increasing corn yield, characterized in that: The E at position 144 of the protein of the sequence shown in SEQ ID NO.2 in corn is mutated to A.

7. The method according to claim 6, characterized in that: The gene with the sequence shown in SEQ ID NO.1 or the gene numbered Zm00001d002999 in corn is mutated from A to C at position 555.

8. The method according to claim 7, characterized in that: The mutation of A to C is achieved by gene editing targeting CCGCCACCTCTCGTGGTCGG or CGTCCCGCTCGCCAGCATC or its reverse complementary sequence.

9. The method according to claim 8, characterized in that: The nuclease used in the gene editing is nSpCas9 fused with M-MLV; Optionally, the amino acid sequence of the nSpCas9 is shown as SEQ ID NO.4, and the amino acid sequence of the M-MLV is shown as SEQ ID NO.

6.

10. A kit for increasing corn yield, characterized in that: Includes any of the following: (1) An RNA molecule capable of recognizing the target described in claim 8; (2) a DNA molecule encoding the RNA described in (1); (3) a vector for expressing the RNA described in (1); Optionally, the sequence of the RNA molecule is CCGCCACCUCUCGUGGUCGGGUUUUAGAGCUAGAAAUAGCAAGUUAA AAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUGGAACUCCGCCGACCACGAGAUUU; Optionally, the kit further comprises nSpCas9 fused to M-MLV; Optionally, the amino acid sequence of the nSpCas9 is shown as SEQ ID NO.4, and the amino acid sequence of the M-MLV is shown as SEQ ID NO.6.

Images