Research method of microtubule positive end TBCB and EB molecular binding mode

Abstract

The invention discloses a research method of a microtubule positive end TBCB and EB molecular binding mode, and relates to the technical field of neurobiology. Comprising the following steps: constructing expression vectors: respectively constructing expression vectors containing TBCB, EB1 and EB3 gene sequences; the vectors should comprise appropriate promoters, enhancers and other necessary regulatory elements to ensure efficient expression of target genes in host cells; transfecting a host cell: selecting a proper cell line as the host cell, and transfecting the constructed expression vector into the host cell independently or in a combined manner; transfection may be performed by electroporation, liposomal mediation, or other potent methods. Through detailed step division and implementation, the interaction between TBCB and EB1 / EB3 can be systematically researched, and each step aims at comprehensively revealing a binding mechanism among molecules from construction of an expression vector to final data analysis.

Description

Technical Field

[0001] The invention relates to the technical field of neurobiology, and in particular to a method for studying the binding mode between TBCB and EB molecules at the positive end of a microtubule. Background Art

[0002] Microtubules are key components of the cytoskeleton and are essential for maintaining cell structure, participating in cell division, and transporting substances. The basic unit of microtubules is tubulin, which mainly includes α-tubulin and β-tubulin. These protein subunits polymerize to form long tubular structures, and their functions are regulated by a variety of microtubule-related proteins.

[0003] End-binding proteins (EBs), especially EB1 and EB3, play a crucial role in the dynamic instability of microtubules. They regulate the polymerization of microtubules by recognizing and binding to the positive (growing) ends of microtubules. In addition, EBs serve as scaffolds for a variety of microtubule-associated proteins and signaling molecules, facilitating the recruitment of these proteins to the positive ends of microtubules and the local regulation of microtubule dynamics.

[0004] Tubulin Folding Cofactor B (TBCB) is a recently discovered molecular chaperone protein that has important effects on microtubule structure and function. It is involved in the folding and stability maintenance of tubulin and plays a key role in neural development and disease. Although TBCB is known to affect the growth and stability of microtubules, its exact mechanism of action has not been clarified, especially the details of how it interacts with the positive ends of microtubules through EB1 and EB3 remain unknown.

[0005] Although existing research methods such as co-immunoprecipitation (Co-IP) and Western blot have revealed the interaction between proteins to a certain extent, they lack in-depth analysis of the fine interaction patterns between TBCB and EBs. In addition, these methods often have difficulty in accurately revealing the specific domains of interaction, which limits our understanding of the function of TBCB and its potential role in neurological diseases.

[0006] Therefore, developing a new research method that can accurately describe and analyze the binding mode of TBCB and EB molecules at the positive end of microtubules is of great significance for advancing the research on microtubule biology, neuroscience and treatment strategies for related diseases. Summary of the invention

[0007] The purpose of the present invention is to solve the shortcomings of the prior art and to propose a method for studying the binding mode of TBCB and EB molecules at the positive end of microtubules.

[0008] In order to achieve the above object, the present invention adopts the following technical solutions:

[0009] A method for studying the binding mode of TBCB and EB molecules at the positive end of microtubules, comprising the following steps:

[0010] S1: Construction of expression vectors: Construct expression vectors containing TBCB, EB1 and EB3 gene sequences respectively. These vectors should contain appropriate promoters, enhancers and other necessary regulatory elements to ensure efficient expression of the target genes in host cells.

[0011] S2: Transfection of host cells: Select a suitable cell line (such as HT22 cells) as a host cell, and transfect the constructed expression vectors into the host cell alone or in combination. Transfection can be performed by electroporation, liposome-mediated or other effective methods.

[0012] S3: Protein expression and purification: After transfection, the host cells are cultured for a period of time to allow protein expression. The cells are then harvested, lysed and the target protein is purified using methods such as affinity chromatography, gel filtration chromatography, etc.

[0013] S4: CO-IP experiments: Co-immunoprecipitation (CO-IP) experiments were performed using specific antibodies to detect the interaction between TBCB and EB1 / EB3. This involved incubation of the antibody with cell extracts, followed by capture of the antibody-antigen complex with an appropriate matrix and removal of unbound proteins by washing.

[0014] S5: Western blot analysis: CO-IP samples were subjected to SDS-PAGE electrophoresis, and then the proteins were transferred to a membrane for Western blot analysis. Specific antibodies against TBCB, EB1, and EB3 were used to detect the presence and relative amount of target proteins.

[0015] S6: Domain mutation experiments: To further identify the specific binding sites between TBCB and EB1 / EB3, a series of mutants with deletion or replacement of specific domains can be constructed. These mutants can be transfected into host cells and the above CO-IP and Western blot experiments can be repeated to determine which domains are critical for protein interaction.

[0016] S7: Data Analysis: Collect and analyze experimental data, use statistical software to assess the significance of the results, and adjust experimental conditions as needed.

[0017] Preferably, the construction of the expression vector of S1 specifically comprises the following steps:

[0018] S11: design primers;

[0019] S12: Gene cloning;

[0020] S13: enzyme digestion and ligation;

[0021] S14: transform host cells;

[0022] S15: Screening and identification.

[0023] Preferably, the transfection of the host cell of S2 specifically comprises the following steps:

[0024] S21: Preparation of plasmid DNA: Extract and purify high-purity plasmid DNA from the screened positive bacterial clones.

[0025] S22: Cell culture: Host cells, such as HT22 cells, are cultured under appropriate culture conditions to a confluence of 70-80%.

[0026] S23: Transfection reaction: Use transfection reagent (such as liposome) to transfect plasmid DNA into host cells. Optimize the ratio of DNA to transfection reagent according to the reagent instructions.

[0027] S24: Change medium: 4-6 hours after transfection, replace with fresh complete medium to remove the transfection reagent and reduce cell stress.

[0028] Preferably, the protein expression and purification of S3 specifically comprises the following steps:

[0029] S31: Induced expression: Add inducer (such as IPTG) at an appropriate time after transfection to induce protein expression under optimized conditions;

[0030] S32: Collect cells: After an appropriate expression time, collect cells and obtain cell pellets by centrifugation;

[0031] S33: Lyse cells: Use physical or chemical methods (such as ultrasonic disruption or lysis buffer) to lyse cells and release total protein;

[0032] S34: Protein purification: Purify the target protein by affinity chromatography, ion exchange chromatography or gel filtration chromatography.

[0033] Preferably, the CO-IP experiment of S4 specifically comprises the following steps:

[0034] S41: Prepare antibodies: Select specific antibodies against TBCB, EB1 and EB3;

[0035] S42: Cell lysis: Cells transfected and expressing the target protein are lysed using mild non-denaturing conditions;

[0036] S43: Immunoprecipitation: Cell lysate is incubated with specific antibodies, and then protein A / G agarose beads are added to capture the antibody-antigen complex;

[0037] S44: Washing and elution: Non-specifically bound proteins are removed by multiple washes, and finally the target protein complex is eluted from the beads with elution buffer.

[0038] Preferably, the Western blot analysis of S5 specifically comprises the following steps:

[0039] S51: electrophoretic separation: the CO-IP samples were separated by SDS-PAGE gel electrophoresis;

[0040] S52: Transfer: Transfer the separated proteins from the gel to a solid support (such as PVDF or nitrocellulose membrane);

[0041] S53: Antibody incubation: incubation with specific primary antibodies against the target protein, followed by detection with labeled secondary antibodies;

[0042] S54: Development and imaging: The labeled secondary antibodies are developed and images are acquired using a chemiluminescent detection system.

[0043] Preferably: the data analysis specifically comprises the following steps:

[0044] S61: Quantitative analysis: Use image processing software (such as ImageJ) to quantify the intensity of Western blot bands;

[0045] S62: Statistical analysis: Use statistical methods (such as t-test or ANOVA) to compare the significance of differences between different sample groups;

[0046] S63: Structure-function correlation analysis: Compare the results of mutation experiments with those of wild-type proteins to determine the impact of key domains on function;

[0047] S64: Organize data.

[0048] The beneficial effects of the present invention are:

[0049] 1. The present invention can systematically study the interaction between TBCB and EB1 / EB3 through detailed step division and implementation. From the construction of expression vector to the final data analysis, each step is aimed at comprehensively revealing the binding mechanism between these molecules.

[0050] 2. The present invention uses specific antibodies to perform CO-IP experiments and Western Blot analysis, ensuring the accuracy and repeatability of the experimental results; in addition, by performing mutation experiments on the domains, the key regions that affect protein interactions can be accurately identified.

[0051] 3. The basic framework provided by the present invention can be adjusted and optimized according to different research needs; for example, different host cell lines, expression vectors or mutation strategies can be selected to suit specific experimental purposes. BRIEF DESCRIPTION OF THE DRAWINGS

[0052] Figure 1 A flow chart of a method for studying the binding mode between TBCB and EB molecules at the positive end of microtubules proposed by the present invention;

[0053] Figure 2 The graphs are the expression results of overexpressing Flag-TBCB, His-EB1, Myc-EB3, His-ΔEB1, and Myc-ΔEB3 in mouse hippocampal neuron HT22 cells respectively according to the present invention;

[0054] Figure 3 The present invention found that TBCB, EB1 and EB3 were co-expressed in HT22 cells;

[0055] Figure 4 This is a diagram showing the co-expression of TBCB of the present invention with EB1 and EB3 lacking the EEY / FCOO domain, and the co-expression result of EB1 and EB3 lacking the EEY / FCOO domain. DETAILED DESCRIPTION

[0056] The technical solution of the present invention is further described in detail below in conjunction with specific implementation methods.

[0057] Embodiment 1:

[0058] A method for studying the binding mode of TBCB and EB molecules at the positive end of microtubules, which is divided into two parts of experiments:

[0059] The first part of the experiment: clarify the binding relationship between TBCB and EB1 / EB3, and between EB1 and EB3.

[0060] First, normal TBCB and EB1, TBCB and EB3, EB1 and EB3 protein plasmids were transfected into HT22 cells, or the three plasmids were transfected into HT22 cells at the same time. Then, TBCB and EB1, TBCB and EB3, EB1 and EB3 protein antibodies or antibodies of the three proteins were used to perform CO-IP experiments, and the expression effect was detected by Western blot to determine whether the two or three proteins in the experiment can bind.

[0061] The second part of the experiment: clarify the binding sites of TBCB, EB1, and EB3.

[0062] On the basis of the first part of the experiment, according to the determined protein domains of TBCB, EB1, and EB3, protein mutant plasmids with the relevant domains removed were constructed. Then, the constructed TBCB and EB1, TBCB and EB3, EB1 and EB3, or the constructed protein mutant plasmids were transfected into HT22 cells together, and the proteins were collected within a certain period of time. The CO-IP experiment was performed with separate protein antibodies, and the protein expression effect was detected by Western blot to determine the specific domains of TBCB, EB1, and EB3 binding, and to clarify the binding mode between the three.

[0063] The method specifically comprises the following steps:

[0064] S1: Construction of expression vectors: Construct expression vectors containing TBCB, EB1 and EB3 gene sequences respectively. These vectors should contain appropriate promoters, enhancers and other necessary regulatory elements to ensure efficient expression of the target genes in host cells.

[0065] S2: Transfection of host cells: Select a suitable cell line (such as HT22 cells) as a host cell, and transfect the constructed expression vectors into the host cell alone or in combination. Transfection can be performed by electroporation, liposome-mediated or other effective methods.

[0066] S3: Protein expression and purification: After transfection, the host cells are cultured for a period of time to allow protein expression. The cells are then harvested, lysed and the target protein is purified using methods such as affinity chromatography, gel filtration chromatography, etc.

[0067] S4: CO-IP experiments: Co-immunoprecipitation (CO-IP) experiments were performed using specific antibodies to detect the interaction between TBCB and EB1 / EB3. This involved incubation of the antibody with cell extracts, followed by capture of the antibody-antigen complex with an appropriate matrix and removal of unbound proteins by washing.

[0068] S5: Western blot analysis: CO-IP samples were subjected to SDS-PAGE electrophoresis, and then the proteins were transferred to a membrane for Western blot analysis. Specific antibodies against TBCB, EB1, and EB3 were used to detect the presence and relative amount of target proteins.

[0069] S6: Domain mutation experiments: To further identify the specific binding sites between TBCB and EB1 / EB3, a series of mutants with deletion or replacement of specific domains can be constructed. These mutants can be transfected into host cells and the above CO-IP and Western blot experiments can be repeated to determine which domains are critical for protein interaction.

[0070] S7: Data Analysis: Collect and analyze experimental data, use statistical software to assess the significance of the results, and adjust experimental conditions as needed.

[0071] The construction of the expression vector of S1 specifically comprises the following steps:

[0072] S11: design primers;

[0073] S12: Gene cloning;

[0074] S13: enzyme digestion and ligation;

[0075] S14: transform host cells;

[0076] S15: Screening and identification.

[0077] The S2 transfection host cell specifically comprises the following steps:

[0078] S21: Preparation of plasmid DNA: Extract and purify high-purity plasmid DNA from the screened positive bacterial clones.

[0079] S22: Cell culture: Host cells, such as HT22 cells, are cultured under appropriate culture conditions to a confluence of 70-80%.

[0080] S23: Transfection reaction: Use transfection reagent (such as liposome) to transfect plasmid DNA into host cells. Optimize the ratio of DNA to transfection reagent according to the reagent instructions.

[0081] S24: Change medium: 4-6 hours after transfection, replace with fresh complete medium to remove the transfection reagent and reduce cell stress.

[0082] The protein expression and purification of S3 specifically includes the following steps:

[0083] S31: Induced expression: Add inducer (such as IPTG) at an appropriate time after transfection to induce protein expression under optimized conditions;

[0084] S32: Collect cells: After an appropriate expression time, collect cells and obtain cell pellets by centrifugation;

[0085] S33: Lyse cells: Use physical or chemical methods (such as ultrasonic disruption or lysis buffer) to lyse cells and release total protein;

[0086] S34: Protein purification: Purify the target protein by affinity chromatography, ion exchange chromatography or gel filtration chromatography.

[0087] The CO-IP experiment of S4 specifically includes the following steps:

[0088] S41: Prepare antibodies: Select specific antibodies against TBCB, EB1 and EB3;

[0089] S42: Cell lysis: Cells transfected and expressing the target protein are lysed using mild non-denaturing conditions;

[0090] S43: Immunoprecipitation: Cell lysate is incubated with specific antibodies, and then protein A / G agarose beads are added to capture the antibody-antigen complex;

[0091] S44: Washing and elution: Non-specifically bound proteins are removed by multiple washes, and finally the target protein complex is eluted from the beads with elution buffer.

[0092] The Western blot analysis of S5 specifically includes the following steps:

[0093] S51: electrophoretic separation: the CO-IP samples were separated by SDS-PAGE gel electrophoresis;

[0094] S52: Transfer: Transfer the separated proteins from the gel to a solid support (such as PVDF or nitrocellulose membrane);

[0095] S53: Antibody incubation: incubation with specific primary antibodies against the target protein, followed by detection with labeled secondary antibodies;

[0096] S54: Development and imaging: The labeled secondary antibodies are developed and images are acquired using a chemiluminescent detection system.

[0097] The data analysis specifically includes the following steps:

[0098] S61: Quantitative analysis: Use image processing software (such as ImageJ) to quantify the intensity of Western blot bands;

[0099] S62: Statistical analysis: Use statistical methods (such as t-test or ANOVA) to compare the significance of differences between different sample groups;

[0100] S63: Structure-function correlation analysis: Compare the results of mutation experiments with those of wild-type proteins to determine the impact of key domains on function;

[0101] S64: Organize data.

[0102] like Figure 2-4 As shown in the previous study, TBCB, EB1, and EB3 were co-expressed in mouse neurons and astrocytes, and knocking down any one of the three would lead to reduced expression of the other two proteins. In order to study the connection between the three, we designed His-ΔEB1 plasmid and Myc-ΔEB3 plasmid with EEY / FCOO domain knockout, and constructed TBCB with Flag tag, EB1 with His tag, and EB3 overexpression plasmid with Myc tag.

[0103] like Figure 2 , we overexpressed Flag-TBCB, His-EB1, Myc-EB3, His-ΔEB1, and Myc-ΔEB3 in mouse hippocampal neuron HT22 cells, respectively, and verified the overexpression efficiency of the plasmids.

[0104] Subsequently, TBCB+EB1, TBCB+EB3, EB1+EB3, TBCB+ΔEB1, TBCB+ΔEB3, ΔEB1+EB3, and EB1+ΔEB3 were co-transfected into HT22 cells. CO-IP experiments were then performed, as Figure 3 It was found that TBCB was co-expressed with EB1 and EB3 in HT22 cells, and EB1 and EB3 were also co-expressed; Figure 4 , while TBCB cannot interact with EB1 and EB3 lacking the EEY / FCOO domain, and EB1 and EB3 lacking the EEY / FCOO domain cannot bind to each other.

[0105] in conclusion:

[0106] 1. TBCB binds to EB1 and EB3 and acts on the positive end of microtubules through interaction with them.

[0107] 2. TBCB mainly interacts with the EEY / FCOO domains of EB1 and EB3, helping TBCB bind to microtubules.

[0108] Regarding the biological materials involved in the present invention:

[0109] Flag-TBCB, His-EB1, Myc-EB3, His-ΔEB1, and Myc-ΔEB3 were purchased from Beijing Qingke Biotechnology Co., Ltd.

[0110] <110> Applicant Name: Chongqing Medical University

[0111] <120> Invention title: A method for studying the binding mode of TBCB and EB molecules at the positive end of microtubules

[0112] <160> Number of sequences in the sequence list: 5

[0113] <210> Sequence identifier: Flag-TBCB

[0114] <211> Length of sequence: 777

[0115] <212> Type of sequence: DNA

[0116] <213> Organism: E. coli chitin (chitinase gene)

[0117] ▲ represents the missing target sequence EEY / F-COO

[0118] Flag-TBCB

[0119] GCTAGCGCCACCATGGAGGTGACGGGGGTGTCGGCACCCACGGTGACCGTTTTCATCAGCAGCTCCCTCAACACCTTCCGCTCCGAGAAGCGATACAGCCGCAGCCTCACCATCGCTGAGTTCAAGTGTAAACTGGAGTTGCTGGTGGGCAGCCCTGCTTCCTGCATGGAACTGGAGCTGTATGGAGTTGACGACAAGTTCTACAGCAAGCTGGATCAAGAGGATGCGCTCCTGGGCTCCTACCCTGTAGATGACGGCTGCCGCATCCACGTCATTGACCACAGTGGCGCCCGCCTTGGTGAGTATGAGGACGTGTCCCGGGTGGAGAAGTACACGATCTCACAAGAAGCCTACGACCAGAGGCAAGACACGGTCCGCTCTTTCCTGAAGCGCAGCAAGCTCGGCCGGTACAACGAGGAGGAGCGGGCTCAGCAGGAGGCCGAGGCCGCCCAGCGCCTGGCCGAGGAG AAGGCCCAGGCCAGCTCCATCCCCGTGGGCAGCCGCTGTGAGGTGCGGGCGGCGGGACAATCCCCTCGCCGGGGCACCGTCATGTATGTAGGTCTCACAGATTTCAAGCCTGGCTACTGGATTGGTGTCCGCTATGATGAGCCACTGGGGAAAAATGATGGCAGTGTGAATGGGAAACGCTACTTCGAATGCCAGGCCAAGTATGGCGCCTTTGTCAAGCCAGCAGTCGTGACGGTGGGGGACTTCCCGGAGGAGGACTACGGGTTGGACGAGATAGATTACAAGGACGACGATGACAAGTGACTCGAG

[0120] 6xHIS EB1

[0121] GCTAGCGCCACCATGCATCATCACCATCACCATGCAGTGAACGTATACTCAACGTCAGTGACCAGTGATAACCTAAGTCGACATGACATGCTGGCCTGGATCAATGAGTCTCTGCAGTTGAATCTGACAAAGATCGAACAGTTGTGCTCAGGGGCTGCGTATTGTCAGTTTATGGACATGCTGTTCCCTGGCTCCATTGCCTTGAAGAAAGTGAAATTCCAAGCTAAGCTAGAACACGAGTACATCCAGAACTTCAAAATACTACAAGCAGGTTTTAAGAGAATGGGTGTTGACAAAATAATTCCTGTGGACAAATTAGTAAAAGGAAAGTTTCAGGACAATTTTGAATTCGTTCAGTGGTTCAAGAAGTTTTTCGATGCAAACTATGATGGAAAAGACTATGACCCTGTGGCTGCCAGACAAGGTCAAGAAACTGCAGTGGCTCCTTCCCTTGTTGCTCCAGCTCTGAATAAACCGAAGAAACCTCTCACTTCTAGCAGTGCAGCTCCCCAGAGGCCCATCTCAACACAGAGAACCGCTGCGGCTCCTAAGGCTGGCCCTGGTGTGGTGCGAAAGAACCCTGGTGTGGGCAACGGAGACGACGAGGCAGCTGAGTTGATGCAGCAGGTCAACGTATTGAAACTTACTGTTGAAGACTTGGAGAAAGAGAGGGATTTCTACTTCGGAAAGCTACGGAACATTGAATTGATTTGCCAGGAGAACGAGGGGGAAAACGACCCTGTATTGCAGAGGATTGTAGACATTCTGTATGCCACAGATGAAGGCTTTGTGATACCTGATGAAGGGGGCCCACAGGAGGAGCAAGAAGAGTATTAACTCGAG

[0122] MYC-EB3

[0123] GCTAGCGCCACCATGGAGCAGAAACTCATCTCTGAAGAGGATCTGGCCGTCAATGTGTACTCCACATCTGTGACCAGTGAAAATCTGAGTCGCCATGATATGCTTGCATGGGTCAACGACTCCCTGCACCTCAACTATACCAAGATAGAACAGCTTTGTTCAGGGGCAGCCTACTGCCAGTTCATGGACATGCTCTTCCCCGGCTGTGTGCACTTGAGGAAAGTGAAGTTCCAGGCCAAACTAGAGCATGAATACATCCACAACTTCAAGGTGCTGCAAGCAGCTTTCAAGAAGATGGGTGTTGACAAAATCATTCCTGTAGAGAAATTAGTGAAAGGAAAATTCCAAGATAATTTTGAGTTTATTCAGTGGTTTAAGAAATTCTTTGACGCAAACTATGATGGAAAGGATTACAACCCTCTGCTGGCGCGGCAGGGCCAGGACGTAGCGCCACCTCCTAACCCAGGTGATCAGATCTTCAACAAATCCAAGAAACTCATTGGCACAGCAGTTCCACAGAGGACGTCCCCCACAGGCCCAAAAAACATGCAGACCTCTGGCCGGCTGAGCAATGTGGCCCCCCCCTGCATTCTCCGGAAGAATCCTCCATCAGCCCGAAATGGCGGCCATGAGACTGATGCCCAAATTCTTGAACTCAACCAACAGCTGGTGGACTTGAAGCTGACAGTGGATGGGCTGGAGAAGGAACGTGACTTCTACTTCAGCAAACTTCGTGACATCGAGCTCATCTGCCAGGAGCATGAAAGTGAAAACAGCCCTGTTATCTCAGGCATCATTGGCATCCTCTATGCCACAGAGGAAGGATTCGCACCCCCTGAGGACGATGAGATTGAAGAGCATCAACAAGAAGACCAGGACGAGTACTGACTCGAG

[0124] 6xHIS EB1▲

[0125] GCTAGCGCCACCATGCATCATCACCATCACCATGCAGTGAACGTATACTCAACGTCAGTGACCAGTGATAACCTAAGTCGACATGACATGCTGGCCTGGATCAATGAGTCTCTGCAGTTGAATCTGACAAAGATCGAACAGTTGTGCTCAGGGGCTGCGTATTGTCAGTTTATGGACATGCTGTTCCCTGGCTCCATTGCCTTGAAGAAAGTGAAATTCCAAGCTAAGCTAGAACACGAGTACATCCAGAACTTCAAAATACTACAAGCAGGTTTTAAGAGAATGGGTGTTGACAAAATAATTCCTGTGGACAAATTAGTAAAAGGAAAGTTTCAGGACAATTTTGAATTCGTTCAGTGGTTCAAGAAGTTTTTCGATGCAAACTATGATGGAAAAGACTATGACCCTGTGGCTGCCAGACAAGGTCAAGAAACTGCAGTGGCTCCTTCCCTTGTTGCTCCAGCTCTGAATAAACCGAAGAAACCTCTCACTTCTAGCAGTGCAGCTCCCCAGAGGCCCATCTCAACACAGAGAACCGCTGCGGCTCCTAAGGCTGGCCCTGGTGTGGTGCGAAAGAACCCTGGTGTGGGCAACGGAGACGACGAGGCAGCTGAGTTGATGCAGCAGGTCAACGTATTGAAACTTACTGTTGAAGACTTGGAGAAAGAGAGGGATTTCTACTTCGGAAAGCTACGGAACATTGAATTGATTTGCCAGGAGAACGAGGGGGAAAACGACCCTGTATTGCAGAGGATTGTAGACATTCTGTATGCCACAGATGAAGGCTTTGTGATACCTGATGAAGGGGGCCCACAGGAGGAGCAATAACTCGAG

[0126] MYC-EB3▲

[0127] GCTAGCGCCACCATGGAGCAGAAACTCATCTCTGAAGAGGATCTGGCCGTCAATGTGTACTCCACATCTGTGACCAGTGAAAATCTGAGTCGCCATGATATGCTTGCATGGGTCAACGACTCCCTGCACCTCAACTATACCAAGATAGAACAGCTTTGTTCAGGGGCAGCCTACTGCCAGTTCATGGACATGCTCTTCCCCGGCTGTGTGCACTTGAGGAAAGTGAAGTTCCAGGCCAAACTAGAGCATGAATACATCCACAACTTCAAGGTGCTGCAAGCAGCTTTCAAGAAGATGGGTGTTGACAAAATCATTCCTGTAGAGAAATTAGTGAAAGGAAAATTCCAAGATAATTTTGAGTTTATTCAGTGGTTTAAGAAATTCTTTGACGCAAACTATGATGGAAAGGATTACAACCCTCTGCTGGCGCGGCAGGGCCAGGACGTAGCGCCACCTCCTAACCCAGGTGATCAGATCTTCAACAAATCCAAGAAACTCATTGGCACAGCAGTTCCACAGAGGACGTC CCCCACAGGCCCAAAAAACATGCAGACCTCTGGCCGGCTGAGCAATGTGGCCCCCCCCTGCATTCTCCGGAAGAATCCTCCATCAGCCCGAAATGGCGGCCATGAGACTGATGCCCAAATTCTTGAACTCAACCAACAGCTGGTGGACTTGAAGCTGACAGTGGATGGGCTGGAGAAGGAACGTGACTTCTACTTCAGCAAACTTCGTGACATCGAGCTCATCTGCCAGGAGCATGAAAGTGAAAACAGCCCTGTTATCTCAGGCATCATTGGCATCCTCTATGCCACAGAGGAAGGATTCGCACCCCCTGAGGACGATGAGATTGAAGAGCATCAACAAGAAGACCAGTGACTCGAG

[0128] The above description is only a preferred specific implementation manner of the present invention, but the protection scope of the present invention is not limited thereto. Any technician familiar with the technical field can make equivalent replacements or changes according to the technical scheme and inventive concept of the present invention within the technical scope disclosed by the present invention, which should be covered by the protection scope of the present invention.

Claims

1. A method for studying the binding mode between TBCB and EB molecules at the positive end of microtubules, characterized in that: The steps include: S1: Construction of expression vectors: Construction of expression vectors containing TBCB, EB1 and EB3 gene sequences respectively; S2: Transfection of host cells: HT22 is selected as the host cell, and the constructed expression vectors are transfected into the host cells alone or in combination; S3: Protein expression and purification: After transfection, the host cells are cultured to allow protein expression; the cells are then harvested, lysed, and the target protein is purified using affinity chromatography or gel filtration chromatography; S4: CO-IP experiment: Co-immunoprecipitation experiments were performed using antibodies to detect the interaction between TBCB and EB1 / EB3; the antibody-antigen complex was then captured with a matrix and unbound proteins were removed by washing; S5: Western blot analysis: CO-IP samples were subjected to SDS-PAGE electrophoresis, and then the proteins were transferred to a membrane for Western blot analysis; specific antibodies against TBCB, EB1, and EB3 were used to detect the presence and relative amount of target proteins; S6: Domain mutation experiment: construct mutants that delete or replace specific domains; transfect these mutants into host cells and repeat steps S4 and S5 to determine the importance of each domain for protein-protein interactions; S7: Data Analysis: Collect and analyze experimental data, use statistical software to assess the significance of the results, and adjust experimental conditions as needed.

2. The method for studying the binding mode between TBCB and EB molecules at the positive end of microtubules according to claim 1, characterized in that: In the S1, the expression vector comprises a promoter, an enhancer and a regulatory element; in the S2, the transfection is performed by electroporation or liposome mediation.

3. The method for studying the binding mode between TBCB and EB molecules at the positive end of microtubules according to claim 1, characterized in that: The construction of the expression vector of S1 specifically comprises the following steps: S11: design primers; S12: Gene cloning; S13: enzyme digestion and ligation; S14: transform host cells; S15: Screening and identification.

4. The method for studying the binding mode between TBCB and EB molecules at the positive end of microtubules according to claim 3, characterized in that: The S2 transfection host cell specifically comprises the following steps: S21: Preparation of plasmid DNA: Extract and purify high-purity plasmid DNA from the screened positive bacterial clones; S22: culturing host cells; S23: Transfection reaction: transfect plasmid DNA into host cells using transfection reagent; S24: Change medium: 4-6 hours after transfection, replace with fresh complete medium to remove the transfection reagent and reduce cell stress.

5. The method for studying the binding mode between TBCB and EB molecules at the positive end of microtubules according to claim 4, characterized in that: The protein expression and purification of S3 specifically includes the following steps: S31: Induced expression: Add inducer at appropriate time after transfection to induce protein expression under optimized conditions; S32: Collect cells: After an appropriate expression time, collect cells and obtain cell pellets by centrifugation; S33: Lysis of cells: Use physical or chemical methods to lyse cells and release total protein; S34: Protein purification: Purify the target protein by affinity chromatography, ion exchange chromatography or gel filtration chromatography.

6. The method for studying the binding mode between TBCB and EB molecules at the positive end of microtubules according to claim 5, characterized in that: In S33, cells are lysed by ultrasonic disruption or lysis buffer.

7. The method for studying the binding mode between TBCB and EB molecules at the positive end of microtubules according to claim 5, characterized in that: The CO-IP experiment of S4 specifically includes the following steps: S41: Prepare antibodies: Select specific antibodies against TBCB, EB1 and EB3; S42: Cell lysis: Cells transfected and expressing the target protein are lysed using mild non-denaturing conditions; S43: Immunoprecipitation: Cell lysate is incubated with specific antibodies, and then protein A / G agarose beads are added to capture the antibody-antigen complex; S44: Washing and elution: Non-specifically bound proteins are removed by multiple washes, and finally the target protein complex is eluted from the beads with elution buffer.

8. The method for studying the binding mode between TBCB and EB molecules at the positive end of microtubules according to claim 7, characterized in that: The Western blot analysis of S5 specifically includes the following steps: S51: electrophoretic separation: the CO-IP samples were separated by SDS-PAGE gel electrophoresis; S52: Transfer: transfer the separated proteins from the gel to the solid support; S53: Antibody incubation: incubation with specific primary antibodies against the target protein, followed by detection with labeled secondary antibodies; S54: Development and imaging: The labeled secondary antibodies are developed and images are acquired using a chemiluminescent detection system.

9. The method for studying the binding mode between TBCB and EB molecules at the positive end of microtubules according to claim 8, characterized in that: The data analysis specifically includes the following steps: S61: Quantitative analysis: quantify the intensity of Western blot bands using image processing software; S62: Statistical analysis: Apply statistical methods to compare the significance of differences between different sample groups; S63: Structure-function correlation analysis: Compare the results of mutation experiments with those of wild-type proteins to determine the impact of key domains on function; S64: Organize data.

Images