Quadruple fluorescent PCR primer-probe combination, reaction system, method and application for identifying wild-type and vaccine strains of Mycoplasma gallisepticum.

By designing a quadruple fluorescent PCR primer-probe combination and reaction system, the problem of existing technologies being unable to simultaneously detect wild-type Mycoplasma gallisepticum strains and three vaccine strains in the same reaction tube was solved, achieving efficient, sensitive, and specific multiplex detection, which is suitable for the prevention and eradication of Mycoplasma gallisepticum in chicken flocks.

CN119552994BActive Publication Date: 2025-11-14广西壮族自治区动物疫病预防控制中心(广西壮族自治区屠宰技术中心)
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202510074627.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-01-17
Publication Date
2025-11-14
Estimated Expiration
2045-01-17

AI Technical Summary

Technical Problem

Existing fluorescent PCR detection methods cannot detect and distinguish between wild-type Mycoplasma gallisepticum (MG) strains and three vaccine strains (F-36, TS-11, and 6/85) in the same reaction tube at the same time, making it difficult to diagnose mixed infections in chicken flocks and failing to meet the current technical requirements for MG prevention and control.

Method used

A quadruple fluorescent PCR primer-probe combination and reaction system was designed, including universal and vaccine strain-specific primers and probes. The system can simultaneously detect and distinguish MG wild-type virus strain and its three vaccine strains in the same tube through multiple fluorescent PCR reaction. The system adopts a multi-SNP site difference optimization design and combines multiple fluorescence signal monitoring to achieve efficient identification.

Benefits of technology

It enables efficient, economical, and convenient detection and differentiation of MG wild-type virus strain and its three vaccine strains in the same reaction tube. It has high sensitivity, good specificity, and is not affected by cross-reaction with other avian pathogens. It also has a fast detection speed and is suitable for simultaneous detection of large batches of samples.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119552994B_ABST
    Figure CN119552994B_ABST
Patent Text Reader

Abstract

This invention relates to the field of molecular biology detection technology, specifically disclosing a quadruple fluorescent PCR primer-probe combination, reaction system, and detection method for identifying wild-type and vaccine strains of Mycoplasma gallisepticum. The quadruple fluorescent PCR primer-probe combination for identifying wild-type and vaccine strains of Mycoplasma gallisepticum includes a universal primer-probe set for detecting Mycoplasma gallisepticum and specific primer-probe sets targeting three vaccine strains, F-36, TS-11, and 6 / 85, respectively. The quadruple fluorescent PCR primer-probe combination, reaction system, and method of this invention for identifying wild-type and vaccine strains of Mycoplasma gallisepticum can simultaneously detect and differentiate the DNA of wild-type Mycoplasma gallisepticum and its three different vaccine strains (F-36, TS-11, and 6 / 85), making detection and differential diagnosis more efficient, economical, and convenient; it has advantages such as high sensitivity, good specificity, rapid high throughput, and simple operation.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular biology detection technology, and in particular to a quadruple fluorescent PCR primer-probe combination, reaction system, method and application for identifying wild-type and vaccine strains of Mycoplasma gallisepticum. Background Technology

[0002] Mycoplasma gallisepticum (MG), also known as chicken septicemic mycoplasma, is a member of the genus Mycoplasma in the family Mycoplasmatidae of the class Mycoplasmacetes. As early as the 1950s, scholars demonstrated the correlation between MG and the economic harm caused by respiratory diseases, decreased egg production, and reduced hatchability in chickens. MG is distributed globally, with high infection rates and rapid spread, causing serious damage. MG is also widespread in my country, with positive cases found in Guangdong, Guangxi, Beijing, Shanghai, Qinghai, Sichuan, Inner Mongolia, and other regions, with average infection rates ranging from 36.2% to 89.5%. MG infection can cause chronic respiratory diseases in chickens, manifested as coughing, rales, and other chronic respiratory symptoms, affecting broiler carcass quality and breeder chicken production performance, increasing flock mortality. After infection, the pathogen can spread vertically and horizontally, circulating throughout the flock, severely reducing the flock's resistance, making them susceptible to secondary or concurrent infections with other pathogens, exacerbating symptoms, and even causing outbreaks of other diseases, resulting in more severe losses. It is estimated that MG infection can reduce flock productivity by 10% to 20%, increase embryo mortality by 5% to 10%, and significantly increase disease prevention and control costs. Currently, MG infection has become one of the most important diseases restricting the healthy development of my country's poultry industry, and since 2023, it has been listed as one of the diseases to be eradicated in breeding farms in my country.

[0003] Control of Mycobacterium sarcoma (MG) primarily relies on vaccination, drug treatment, isolation and culling of positive chickens, and eradication. Vaccination is the most common and effective method. Currently, the main domestic and imported attenuated live vaccine strains used in my country are F-36, TS-11, and 6 / 85. Unlike the prevalent wild-type MG strains, which can cause disease and outbreaks, inoculation with attenuated live MG vaccines allows the corresponding strain to colonize the chickens, resulting in carrier status without clinical symptoms, thus providing immune protection. Traditional detection methods, such as classic PCR recommended by the World Organisation for Animal Health (WOAH), cannot distinguish between infected and immunized animals. Furthermore, investigations have revealed irregularities and even overuse of vaccines in some domestic chicken farms, leading to mixed infections of prevalent wild-type strains and vaccine strains (or even multiple vaccine strains) in flocks, posing significant challenges to disease control and eradication. Conducting detection and differential diagnosis is a prerequisite and foundation for timely and scientific control measures, effectively controlling the disease and minimizing losses. Therefore, research on wild-type and vaccine strains of MG, as well as differential diagnostic methods for different vaccine strains, will provide necessary technical tools for MG control and eradication.

[0004] Currently, molecular biological diagnostic technologies, including PCR, fluorescent PCR, LAMP, RAA-CRISPR, and RAA, are widely used in MG detection and diagnosis due to their speed, accuracy, and clinical applicability. While RAA and LAMP technologies offer advantages such as faster and more sensitive detection, simpler equipment, and suitability for on-site testing, they also have limitations, including immaturity and difficulty in achieving multi-target detection. Therefore, their clinical application and adoption rate are lower compared to traditional fluorescent PCR methods. Currently, all primary-level testing institutions are equipped with fluorescent PCR instruments, while LAMP and RAA testing require additional equipment purchases. Fluorescent PCR, especially TaqMan real-time fluorescent PCR, offers numerous advantages such as high specificity, high sensitivity, good repeatability, high stability, ease of multi-target detection, and widespread availability of equipment, making it the preferred molecular biological diagnostic method. TaqMan real-time fluorescent PCR methods for MG have been established both domestically and internationally, but most only detect one strain at a time, or use dual quantitative PCR to detect two mycoplasma strains simultaneously. Chinese patent application CN 118813835A discloses a real-time quantitative PCR kit for identifying wild-type Mycoplasma gallisepticum strains from strains F, TS-11S, and 6 / 85. This kit is used to identify MG isolates that have been isolated, cultured, and purified. It can also be used to assess the in vivo replication efficiency of live attenuated vaccines (F strain, TS-11 strain, and 6 / 85 strain) in chicken flocks and to monitor wild-type virus infection. However, this patent application only uses a wild-type virus identification system and the three vaccine strain identification systems, combining them in pairs to form a dual real-time quantitative PCR system for mixed testing. A single test can only identify one wild-type virus strain and one vaccine strain, failing to achieve the goal of distinguishing between wild-type virus strains and three vaccine strains in a single reaction tube. With the increasing harm of mycoplasma disease to my country's chicken industry in recent years, the country has prioritized the control and eradication of MG. Since 2023, the disease has been listed as a disease to be eradicated in national animal disease eradication farms. Given the current widespread prevalence of MG in chicken flocks in my country and the serious mixed infections caused by vaccine overuse, existing detection methods are no longer adequate to meet the current and future technical needs for MG diagnosis and control. There is an urgent need to further develop a rapid identification and detection method that can simultaneously detect and distinguish between wild-type MG strains and the three existing vaccine strains. This is of great significance for chicken farms to formulate and implement targeted prevention and control strategies. Summary of the Invention

[0005] To address the above shortcomings, this invention provides a quadruple fluorescent PCR primer-probe combination, reaction system, and method for identifying wild-type Mycoplasma gallisepticum (MG) strains and vaccine strains. This method enables the simultaneous detection and differentiation of MG wild-type strains and their three different vaccine strains (F-36, TS-11, and 6 / 85). The specific technical solution is as follows:

[0006] A quadruple fluorescent PCR primer-probe combination for identifying wild-type and vaccine strains of Mycoplasma gallisepticum (MG), comprising the following primer-probe set:

[0007] A universal primer and probe set for detecting Mycoplasma gallisepticum (MG) includes: the forward primer MG-U_F as shown in SEQ ID NO:1, the reverse primer MG-U_R as shown in SEQ ID NO:2, and the probe MG-U_P as shown in SEQ ID NO:9;

[0008] The primer and probe set for detecting MG vaccine strain F-36 includes: the forward primer MGF-36_F as shown in SEQ ID NO:3, the reverse primer MG F-36_R as shown in SEQ ID NO:4, and the probe MG F-36_P as shown in SEQ ID NO:10;

[0009] The primer and probe set for detecting the MG vaccine strain TS-11 includes: the forward primer MGTS-11_F as shown in SEQ ID NO:5, the reverse primer MGTS-11_R as shown in SEQ ID NO:6, and the probe MGTS-11_P as shown in SEQ ID NO:11;

[0010] The primer and probe set for detecting MG vaccine strain 6 / 85 includes: the forward primer MG6 / 85_F as shown in SEQ ID NO:7, the reverse primer MG6 / 85_R as shown in SEQ ID NO:8, and the probe MG6 / 85_P as shown in SEQ ID NO:12.

[0011] The universal primer and probe set in the above quadruple fluorescent PCR primer and probe combination can detect all known MG strains, including wild-type and vaccine strains.

[0012] Preferably, in the above-mentioned quadruple fluorescent PCR primer-probe combination, the probes MG-U_P, MG F-36_P, MG TS-11_P and MG 6 / 85_P are labeled with different fluorescent groups.

[0013] On the other hand, the present invention also provides a quadruple fluorescent PCR reaction system for identifying MG wild-type strains and vaccine strains, the reaction system comprising the primer-probe combination described above. Preferably, in the above quadruple fluorescent PCR reaction system, the concentrations of the forward primer MG-U_F and the reverse primer MG-U_R are 0.2–0.3 μmol / μL, and the concentration of the probe MG-U_P is 0.05–0.15 μmol / μL;

[0014] The concentrations of the forward primer MG F-36_F and the reverse primer MG F-36_R are 0.1–0.2 μmol / μL, and the concentration of the probe MG F-36_P is 0.03–0.08 μmol / μL.

[0015] The concentrations of the forward primer MG TS-11_F and the reverse primer MG TS-11_R are 0.1–0.2 μmol / μL, and the concentration of the probe MG TS-11_P is 0.03–0.08 μmol / μL.

[0016] The concentrations of the forward primer MG 6 / 85_F and the reverse primer MG 6 / 85_R are 0.1–0.2 μmol / μL, and the concentration of the probe MG 6 / 85_P is 0.03–0.08 μmol / μL.

[0017] Preferably, in the above-mentioned quadruple fluorescent PCR reaction system, the concentrations of the forward primer MG-U_F and the reverse primer MG-U_R are 0.25 μmol / μL, and the concentration of the probe MG-U_P is 0.1 μmol / μL;

[0018] The concentrations of the forward primer MG F-36_F and the reverse primer MG F-36_R are 0.15 μmol / μL, and the concentration of the probe MG F-36_P is 0.05 μmol / μL.

[0019] The concentrations of the forward primer MG TS-11_F and the reverse primer MG TS-11_R are 0.15 μmol / μL, and the concentration of the probe MG TS-11_P is 0.05 μmol / μL.

[0020] The concentrations of the forward primer MG 6 / 85_F and the reverse primer MG 6 / 85_R are 0.15 μmol / μL, and the concentration of the probe MG 6 / 85_P is 0.05 μmol / μL.

[0021] On the other hand, the present invention also provides the application of the above-described quadruple fluorescent PCR primer-probe combination in the preparation of products that simultaneously identify MG wild-type strains and vaccine strains.

[0022] On the other hand, the present invention also provides the application of the above-mentioned quadruple fluorescent PCR primer-probe combination and fluorescent PCR reaction system in the simultaneous detection and identification of wild-type Mycoplasma gallisepticum strains and vaccine strains for non-disease diagnosis or treatment purposes.

[0023] Preferably, in the above applications, the vaccine strain is MG F-36, TS-11, or MG 6 / 85.

[0024] On the other hand, the present invention also provides a quadruple fluorescent PCR detection method for identifying MG wild-type virus strains and vaccine strains for non-disease diagnosis or treatment purposes, comprising the following steps:

[0025] (1) Preparation of fluorescent PCR reaction system: Add the corresponding DNA template and the quadruple fluorescent PCR primer and probe combination as described in any one of claims 1 to 2 to prepare the quadruple fluorescent PCR reaction system;

[0026] (2) Amplification using the fluorescent PCR reaction system;

[0027] (3) Result determination: The threshold setting principle is based on the threshold line just exceeding the highest point of the amplification curve of the normal negative control. If the sample to be tested has no Ct value or a Ct value > 35 and no specific amplification curve, the result is judged as MG negative. If the Ct value of the MG-U channel of the sample to be tested is ≤ 35 and a specific amplification curve appears, the result is judged as MG positive. At the same time, if the Ct value of any one or more channels of vaccine strains such as F-36, TS-11 or 6 / 85 is ≤ 35 and a specific amplification curve appears, it is judged as MG vaccine strain positive. The appearance of a specific amplification curve in the corresponding channel indicates the existence of the corresponding vaccine strain. If the channels of 3 vaccine strains have no Ct value or a Ct value > 35 and no specific amplification curve appears, it is judged as MG wild-type strain positive.

[0028] Preferably, in the detection method described above, the detection reaction conditions in step (2) are set as follows: 95°C pre-denaturation for 30s; 95°C denaturation for 15s; 48°C annealing for 30s, for a total of 40 cycles; and fluorescence signals are collected at the end of each cycle.

[0029] Compared with the prior art, the beneficial effects of the present invention are:

[0030] 1. This invention enables the simultaneous detection and differentiation of MG wild-type virus and its three different MG vaccine strains (F-36, TS-11, 6 / 85) DNA through a single reaction in the same reaction tube, making identification, detection, and diagnosis more efficient, economical, and convenient.

[0031] 2. High sensitivity: The quadruple fluorescent PCR detection method provided by this invention achieves a limit of detection of 8.7344 × 10⁻⁶ for MG-U, F-36, TS-11, and 6 / 85 nucleic acids. 1 copies / μL, 9.0396×10 1 copies / μL, 9.0144×10 1 copies / μL and 10.2380×10 1 copies / μL.

[0032] 3. High specificity: The quadruple fluorescent PCR detection method provided by this invention only generates corresponding fluorescent amplification signals for the genomes of MG and its vaccine strains F-36, TS-11, and 6 / 85. It shows no cross-reactivity with other avian pathogens such as Newcastle disease virus lasota strain, chicken synoviae MS-H strain, chicken typhoid salmonella ATCC54003 strain, avian Escherichia coli O78 SH strain, H9 subtype avian influenza virus SS strain, chicken infectious bronchitis virus H120 strain, and avian pasteurellosis inactivated vaccine (1502 strain), as well as blood, saliva, and skin samples from SPF chickens.

[0033] 4. High detection speed and high throughput: The quadruple fluorescence PCR detection method provided by this invention can complete the entire amplification and detection process within 1 hour after the sample is added, and depending on the number of detection wells of the fluorescence quantitative PCR instrument, it can simultaneously detect 96 to 384 samples at one time.

[0034] 5. Simple operation: The quadruple fluorescence PCR detection method provided by this invention only requires placing the prepared reaction system in a fluorescence quantitative PCR instrument to complete the entire amplification and result determination process, without the need for identification by agarose gel electrophoresis; at the same time, the probe set used is optimized based on the differences of multiple SNP sites, resulting in low detection background values ​​and easier result determination. Attached Figure Description

[0035] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0036] Figure 1 This is a schematic diagram of the MG-U primer and probe design region in this invention;

[0037] Figure 2 This is a schematic diagram of the MG F-36 primer and probe design region in this invention;

[0038] Figure 3 This is a schematic diagram of the MG TS-11 primer and probe design region in this invention;

[0039] Figure 4 This is a schematic diagram of the MG 6 / 85 primer and probe design region in this invention;

[0040] Figure 5The image shows the electrophoresis results of the preparation of the positive plasmid of this invention. Lane 1: 2000bp Marker lane; Lane 2: MG-U lane (175bp); Lane 3: MG F-36 lane (99bp); Lane 4: MG TS-11 lane (551bp); Lane 5: MG 6 / 85 lane (83bp).

[0041] Figure 6 This is a graph showing the results of a quadruple Taqman fluorescence PCR sensitivity assay (MG-U), where 1: working standard 1; 2: working standard 2; 3: working standard 3; 4: working standard 4; 5: working standard 5; 6: working standard 6; 7: working standard 7; 8: working standard 8; 9: working standard 9; 10: negative control;

[0042] Figure 7 The image shows the results of the quadruple Taqman fluorescence PCR standard curve (MG-U).

[0043] Figure 8 The image shows the results of a quadruple Taqman fluorescence PCR sensitivity assay (MG F-36), where 1: working standard 10; 2: working standard 11; 3: working standard 12; 4: working standard 13; 5: working standard 14; 6: working standard 15; 7: working standard 16; 8: working standard 17; 9: working standard 18; 10: negative control;

[0044] Figure 9 The results of the quadruple Taqman fluorescence PCR standard curve (MG F-36) are shown.

[0045] Figure 10 The image shows the results of a quadruple Taqman fluorescence PCR sensitivity assay (MG TS-11), where 1: working standard 19; 2: working standard 20; 3: working standard 21; 4: working standard 22; 5: working standard 23; 6: working standard 24; 7: working standard 25; 8: working standard 26; 9: working standard 27; 10: negative control;

[0046] Figure 11 The image shows the results of the quadruple Taqman fluorescence PCR standard curve (MG TS-11).

[0047] Figure 12 The image shows the results of a quadruple Taqman fluorescence PCR sensitivity assay (MG 6 / 85), where 1: working standard 28; 2: working standard 29; 3: working standard 30; 4: working standard 31; 5: working standard 32; 6: working standard 33; 7: working standard 34; 8: working standard 35; 9: working standard 36; 10: negative control;

[0048] Figure 13 The results of the quadruple Taqman fluorescence PCR standard curve (MG 6 / 85) are shown.

[0049] Figure 14 Comparison of results from quadruple Taqman fluorescence PCR sensitivity assays (MG-U, MG F-36, MG TS-11, MG6 / 85);

[0050] Figure 15 A diagram illustrating the applicability of universal MG-U primer and probe combinations for validating DNA templates of wild-type and vaccine strains;

[0051] Figure 16 A diagram validating the specificity of this method using wild-type DNA templates;

[0052] Figure 17 The image shows the results of a quadruple Taqman fluorescent PCR specificity assay, where: 1: MG-U positive control; 2: MG F-36 positive control; 3: MG TS-11 positive control; 4: MG 6 / 85 positive control; 5: Newcastle disease virus lasota strain; 6: Mycoplasma synoviae MS-H strain; 7: Salmonella typhi ATCC54003 strain; 8: Escherichia coli O78 SH strain; 9: H9 subtype avian influenza virus SS strain; 10: Infectious bronchitis virus H120 strain; 11: Avian Pasteurella multocida inactivated vaccine (strain 1502); 12: SPF chicken-derived skin tissue; 13: SPF chicken-derived blood; 14: SPF chicken-derived saliva; 15: Negative control. Detailed Implementation

[0053] The specific embodiments of the present invention are described in detail below, but it should be understood that the scope of protection of the present invention is not limited to the specific embodiments. Unless otherwise defined, all technical terms used below have the same meaning as commonly understood by those skilled in the art. The technical terms used herein are for the purpose of describing specific embodiments only and are not intended to limit the scope of protection of the present invention. Unless otherwise specifically stated, all raw materials, reagents, instruments, and equipment used in the present invention are commercially available or can be prepared by existing methods.

[0054] This invention is based on multiplex Taqman-probe-based real-time PCR technology. It uses conserved sites of MG in the TS-11 strain genome (218132–218306), specific sites of F-36 strain genome (598305–598403), specific sites of TS-11 strain genome (879213–886977), and specific sites of 6 / 85 strain genome (526057–526140) as molecular markers. Primers and probes are designed, and detection methods are established. The identification and detection of MG F-36, MG TS-11, MG 6 / 85 vaccine strains, and wild-type strains are achieved by real-time monitoring of the fluorescence signals of different markers.

[0055] Example 1: Construction of a quadruple fluorescent PCR primer-probe combination, reaction system, and method for identifying wild-type and vaccine strains of Mycoplasma gallisepticum.

[0056] 1.1 Primer and probe screening and design

[0057] The various MG strains exhibit high genomic homology. To effectively distinguish between wild-type MG strains and various vaccine strains, the whole genome sequences of prevalent MG strains and vaccine strains included in the GenBank database were downloaded. Sequence analysis and comparison were performed using MEGA 6 software to screen conserved sites from 218132 to 218306 of the MG TS-11 genome (GenBank accession number: CP044225.1). Specific primer pairs MG-U_F / MG-U_R and probe MG-U_P were designed using Primer Premier 5 software, which can detect the genomic nucleic acids of all currently known MG strains (including vaccine strains and wild-type strains). Meanwhile, the Genious software was used to analyze and compare the whole genome sequences of MG F-36 (GenBank accession number CP001873.1), MG TS-11 (GenBank accession number: CP044225.1), and MG 6 / 85 (GenBank accession number: NZ_CP044224.1), and specific sequences of the three vaccine strains located at positions 598305–598403, 879213–886977, and 526057–526140 in their genomes, respectively.

[0058] Taking into account factors such as the conservation of vaccine strain specific sequences, base composition, GC content, formation of secondary structures, and Tm value, a quadruple Taqman fluorescent PCR primer-probe scheme for identifying and detecting MG F-36, TS-11, and 6 / 85 was designed using Primer Premier 5 software (Table 1).

[0059] Table 1. Design of Primer Pairs and Probe Sets for MG Universal, F-36, TS-11, and 6 / 85 Identification

[0060]

[0061] Primer and probe design region MG-U (see) Figure 1 MGF-36 Figure 2 MGTS-11 Figure 3 MG6 / 85 Figure 4 The specific sequence of the design is as follows:

[0062] (1) Universal primer and probe set for detecting MG wild-type virus strains and vaccine strains:

[0063] Forward primer MG-U_F: 5'-GAAGGTGAAACTAAYTCC-3' (SEQ ID NO:1)

[0064] Reverse primer MG-U_R: 5'-CTTGGATCATCATTCTTTC-3' (SEQ ID NO:2)

[0065] Probe MG-U_P: 5'-AATCCCAATCCCTAAACCCAAGAGT-3' (SEQ ID NO: 9).

[0066] (2) Primer and probe set for detecting MG vaccine strain F-36:

[0067] Forward primer MG F-36_F: 5'-GCTCCATCTAGTAGTTATCA-3' (SEQ ID NO:3)

[0068] Reverse primer MG F-36_R: 5'-TGCACTTAAGAAATCTACAAA-3' (SEQ ID NO:4)

[0069] Probe MG F-36_P: 5'-CATCCATTCCACCTAATTGACTAGCA-3' (SEQ ID NO:10).

[0070] (3) Primer and probe set for detecting MG vaccine strain TS-11:

[0071] Forward primer MG TS-11_F: 5'-AGCACTGTACAATACTTG-3' (SEQ ID NO:5)

[0072] Reverse primer MG TS-11_R: 5'-CGACATCAATAGCTACAC-3' (SEQ ID NO:6)

[0073] Probe MG TS-11_P: 5'-ACACACCCTAAATATCAAACTCGAACA-3' (SEQ ID NO:11).

[0074] (4) Primer and probe set for detecting MG vaccine strain 6 / 85:

[0075] Forward primer MG 6 / 85_F: 5'-GCTGAGTGATTGTTTTAATC-3' (SEQ ID NO:7)

[0076] Reverse primer MG 6 / 85_R: 5'-ACCTGATTATGTGAATCCTA-3' (SEQ ID NO:8)

[0077] Probe MG 6 / 85_P: 5'-AAACACCCGCTCCATTGCTTT-3' (SEQ ID NO:12).

[0078] The detection probes were labeled with the following at their 5' ends: MG-U_P with HEX (hexachlorofluorochrome), MG F-36_P with FAM (carboxyfluorescein), MG TS-11_P with CY5 (indole-2-carbon cyanine), and MG 6 / 85_P with ROX (carboxy-X-rhodamine). The 3' ends of MG-U_P, MG F-36_P, MG TS-11_P, and MG 6 / 85_P were labeled with BHQ1, BHQ3, and BHQ2, respectively. Primers and probes were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0079] 1.2 Optimization of primer and probe concentrations, determination of reaction procedure and reaction system

[0080] The upstream and downstream primers and probes of each MG were diluted to 10 μmol / μL using ddH2O. The final primer concentration ranges in the reaction system were set to 0.10, 0.15, 0.20, 0.25, 0.30, 0.35, and 0.40 μmol / μL, and the final probe concentration ranges were set to 0.05, 0.10, 0.15, 0.20, 0.25, 0.30, and 0.35 μmol / μL. Various combinations were obtained through permutations and combinations. Singleton fluorescent PCR was performed on each primer and probe pair combination, and the primer-probe combination with the lowest Ct value and the best amplification curve was screened to determine the optimal primer and probe concentrations.

[0081] The reaction program was determined by setting the annealing temperatures to 40, 44, 48, 52, 56, and 60°C, and setting up 6 experimental groups. At the same time, the number of cycles was optimized under the condition of determining the annealing temperature, and the number of cycles was set to 30, 35, 40, and 45 to determine the optimal singlet fluorescent PCR reaction program.

[0082] Optimization of reaction conditions: Based on the optimal singlet fluorescent PCR reaction conditions, a multiplex fluorescent PCR reaction system and procedure were established and optimized. The corresponding primers and probes of the optimized singlet fluorescent PCR system were mixed and added to the same system for fluorescent PCR reaction. Based on the Ct value, fluorescence intensity, and amplification curve changes in the quadruple fluorescent PCR amplification results, the ratio of primer pairs in the mixed primers and the probe concentration were adjusted. The optimized reaction system and procedure were then used for multiplex fluorescent PCR amplification.

[0083] Optimized results: Multiplex fluorescent PCR reaction system: MG-U_F / R 0.5μL (0.25μmol / μL), MG-U_P 0.2μL (0.10μmol / μL); MG F-36_F / R 0.3μL (0.15μmol / μL), MG F-36_P 0.10μL (0.05μmol / μL); MGTS-11_F / R 0.3μL (0.15μmol / μL), MG TS-11_P 0.10μL (0.05μmol / μL); MG 6 / 85_F / R 0.3μL (0.15μmol / μL), MG 6 / 85_P 0.10μL (0.05μmol / μL); 2×Premix Ex Taq TM (Probe qPCR) 10.0 μL, DNA template 2.0 μL, and finally add ddH2O to make up to 20.0 μL.

[0084] Reaction program: 95℃ for 30s; 95℃ for 15s, 48℃ for 30s, 40 cycles.

[0085] 1.3 Quadruple fluorescent PCR detection method for differentiating wild-type and vaccine strains of Mycoplasma gallisepticum

[0086] A quadruple fluorescent PCR detection method for identifying wild-type and vaccine strains of Mycoplasma gallisepticum includes the following steps:

[0087] (1) Sample processing: Nucleic acid was directly extracted using a commercial DNA extraction kit on a fully automated nucleic acid extractor, and the obtained nucleic acid samples were stored at -20℃ for later use;

[0088] (2) Preparation of fluorescent PCR reaction system: The upstream and downstream primers and probes of each MG were diluted to 10 μmol / μL using ddH2O. Multiplex fluorescence PCR reaction system: 0.5 μL each of MG-U_F / R (final concentration 0.25 μmol / μL), 0.2 μL of MG-U_P (final concentration 0.10 μmol / μL); 0.3 μL each of MG F-36_F / R (final concentration 0.15 μmol / μL), 0.10 μL of MG F-36_P (final concentration 0.05 μmol / μL); 0.3 μL each of MG TS-11_F / R (final concentration 0.15 μmol / μL), 0.10 μL of MG TS-11_P (final concentration 0.05 μmol / μL); 0.3 μL each of MG 6 / 85_F / R (final concentration 0.15 μmol / μL), 0.10 μL of MG 6 / 85_P (final concentration 0.05 μmol / μL); 2×Premix Ex Taq TM (Probe qPCR) 10.0 μL, DNA template 2.0 μL, and finally add ddH2O to make up to 20.0 μL.

[0089] (3) Fluorescent PCR amplification: Set the reaction program: 95℃ pre-denaturation for 30s; 95℃ denaturation for 15s; 48℃ annealing for 30s, for a total of 40 cycles; and collect the fluorescence signal at the end of each cycle.

[0090] (4) Result determination: The threshold setting principle is based on the threshold line just exceeding the highest point of the amplification curve of the normal negative control. If the sample to be tested has no Ct value or a Ct value > 35 and no specific amplification curve, the result is judged as MG negative. If the Ct value of the MG-U channel of the sample to be tested is ≤ 35 and a specific amplification curve appears, the result is judged as MG positive. At the same time, if the Ct value of any one or more channels of vaccine strains such as F-36, TS-11, or 6 / 85 is ≤ 35 and a specific amplification curve appears, the result is judged as positive for that MG vaccine strain. If the channels of 3 vaccine strains have no Ct value or a Ct value > 35 and no specific amplification curve appears, the result is judged as positive for MG wild-type virus strain.

[0091] Example 2: Sensitivity of the selected primers and probes

[0092] 2.1 Preparation of positive plasmid standards

[0093] (1) Preparation of positive plasmids

[0094] MG F-36 was derived from a commercially available vaccine manufactured by Qingdao Yibang Biotechnology Co., Ltd.; MG-U and MGTS-11 were derived from commercially available vaccines manufactured by Australian Bioresources Ltd.; MG 6 / 85 was derived from a commercially available vaccine manufactured by Intervet USA. DNA templates for MG-U, MG F-36, MG TS-11, and MG 6 / 85 were extracted using a commercially available DNA extraction kit according to the instructions, and then subjected to routine PCR amplification. The specific steps are as follows:

[0095] Reaction system preparation: Each tube contains 25 μL of reaction solution and PremixTaq. TM (Ex Taq TM Version 2.0 plus dye) 12.5 μL, 10 pmol / μL MG-U or (MG F-36, MG TS-11, MG 6 / 85) fluorescent PCR_F and MG-U or (MG F-36, MG TS-11, MG 6 / 85) fluorescent PCR_R each 0.5 μL, and finally add ddH2O to make up to 25 μL. Add 2 μL of MG-U or (MG F-36, MG TS-11, MG 6 / 85) DNA template to different reaction tubes according to the corresponding system. PremixTaq TM (ExTaq TM Version 2.0 plus dye) test reagent (Cat#:RR902A) was purchased from TaKaRa Biotechnology Co., Ltd. The MG-U, MG F-36, MG TS-11, and MG 6 / 85 primer pairs were synthesized by Sangon Biotech (Shanghai) Co., Ltd. Reaction conditions were set as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 45℃ annealing for 30 s, 72℃ extension for 30 s, 40 cycles; final extension at 72℃ for 5 min; storage at 4℃.

[0096] PCR products were subjected to 1.5% agarose gel electrophoresis (see...). Figure 5 The target fragment was recovered and ligated into the pMD19-T vector, transformed into DH5α Escherichia coli, and positive strains identified by PCR were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The sequencing results were consistent with expectations, confirming the strain as a positive case, and its plasmid was extracted as the positive plasmid.

[0097] Plasmid pTMG-U contains a gene fragment from the MG TS-11 genome, ranging from 218132 to 218306 nt. The sequence of this fragment is as follows:

[0098] GAAGGTGAAACTAATTCCGTTGGTCCAAGAAAGATTACCTCTGAACCCTGATTTTATCCAGTAGTGGGTGCAGGTGCTGGGTTGATTGTTGTTTCTTTACTCTTGGGTTTAGGGATTGGGATTCCGATCGCTAAGAAAAAAGAAAGAATGATGATCCAAGAACGTGAAGAACACC;

[0099] The plasmid pTMG F-36 contains a gene fragment from 598305 to 598403 nt of the MG F-36 genome, the sequence of which is as follows:

[0100] 5'-TGCACTTAAGAAATCTACAAAAGCATCCATTCCACCTAATTGACTAGCAACATCACAA TAATTTATTACATCATAGCCATGATAACTACTAGATGGAGC-3';

[0101] Plasmid pTMG TS-11 contains a gene fragment from 879213 to 886977 nt of the MG TS-11 genome, the sequence of which is as follows:

[0102] 5'-GCAATAACAACACCGTTAGTGTTTTGTGGTTTGTTAATGTTTTAGCACTGTACAATACT TGTGTAAGCAATAACACCCTAAATATCAAACTCGAACAAGTTGGTTTTAGCACTGTAC AATACTTGTGTAAGCAATAACTGTTTTGTGTAGCTATTGATGTCGTAAAG-3':

[0103] Plasmid pTMG 6 / 85 contains a gene fragment from 526057 to 526140 nt of the MG 6 / 85 genome, the sequence of which is as follows:

[0104] 5'-

[0105] GCTGAGTGATTGTTTTAATCTTTAGTTTTTCAAACACCCGCTCCATTGCTTTTTTTAGTTTTTTAGGATTCACATAATCAGGT-3':

[0106] (2) Preparation of positive plasmid standards

[0107] The OD260 / OD280 ratio and concentration (unit: ng / μL) of the positive plasmid were determined using an ultra-micro UV spectrophotometer. The formula was: Plasmid copy number (copies / μL) = (Plasmid concentration × 10⁻⁶) / (Copies / μL) -9 ×6.02×10 23 Calculate the copy number by taking the number of copies of plasmids by calculating (660 × plasmid length).

[0108] μmol / μL

[0109] The OD260 / OD280 ratio of the MG-U positive plasmid was determined to be 2.01, the initial concentration was 277.1 ng / μL, and the copy number was 8.7344 × 10⁻⁶. 10 The MG F-36 positive plasmid had an OD260 / OD280 ratio of 2.00, an initial concentration of 276.8 ng / μL, and a copy number of 9.0396 × 10⁻⁶. 10 The MG TS-11 positive plasmid had an OD260 / OD280 ratio of 2.02, an initial concentration of 320.7 ng / μL, and a copy number of 9.0144 × 10⁻⁶. 10 The MG 6 / 85 positive plasmid had an OD260 / OD280 ratio of 2.00, an initial concentration of 311.7 ng / μL, and a copy number of 10.238 × 10⁻⁶. 10 copies / μL. Standards were prepared by serially diluting the four plasmids 10-fold:

[0110] Working standard sample 1 contains 8.7344 × 10 8 copies / μL of positive plasmid MG-U non-infectious DNA fragment;

[0111] Working standard sample 2 contains 8.7344 × 10 7 copies / μL of positive plasmid MG-U non-infectious DNA fragment;

[0112] Working standard sample 3 contains 8.7344 × 10 6 copies / μL of positive plasmid MG-U non-infectious DNA fragment;

[0113] Working standard sample 4 contains 8.7344 × 10 5 copies / μL of positive plasmid MG-U non-infectious DNA fragment;

[0114] Working standard sample 5 contains 8.7344 × 10 4 copies / μL, non-infectious DNA fragment of positive plasmid MG-U;

[0115] Working standard sample 6 contains 8.7344 × 10 3 Copies / μl of the positive plasmid MG-U non-infectious DNA fragment;

[0116] Working standard sample 7 contains 8.7344 × 10 2 copies / μL of positive plasmid MG-U non-infectious DNA fragment;

[0117] Working standard sample 8 contains 8.7344 × 10⁸ 1 copies / μL of positive plasmid MG-U non-infectious DNA fragment;

[0118] Working standard 9 contains 8.7344 × 10 0 copies / μL of positive plasmid MG-U non-infectious DNA fragment;

[0119] Working standard 10 contains 9.0396 × 10⁻⁶. 8 Copies / μL of the positive plasmid MG F-36 non-infectious DNA fragment;

[0120] Working standard sample 11 contains 9.0396 × 10⁻⁶. 7 Copies / μL of the positive plasmid MG F-36 non-infectious DNA fragment;

[0121] Working standard 12 contains 9.0396 × 10⁻⁶. 6 Copies / μL of the positive plasmid MG F-36 non-infectious DNA fragment;

[0122] Working standard 13 contains 9.0396 × 10⁻⁶. 5 copies / μL, non-infectious DNA fragment of positive plasmid MG F-36;

[0123] Working standard 14 contains 9.0396 × 10 4 Copies / μl of the positive plasmid MG F-36 non-infectious DNA fragment;

[0124] Working standard sample 15 contains 9.0396 × 10⁻⁶. 3 Copies / μL of the positive plasmid MG F-36 non-infectious DNA fragment;

[0125] Working standard sample 16 contains 9.0396 × 10⁻⁶. 2 Copies / μL of the positive plasmid MG F-36 non-infectious DNA fragment;

[0126] Working standard sample 17 contains 9.0396 × 10⁻⁶. 1Copies / μL of the positive plasmid MG F-36 non-infectious DNA fragment;

[0127] Working standard sample 18 contains 9.0396 × 10⁻⁶. 0 Copies / μL of the positive plasmid MG F-36 non-infectious DNA fragment;

[0128] Working standard sample 19 contains 9.0144 × 10⁻⁶. 8 Copies / μL of the positive plasmid MG TS-11 non-infectious DNA fragment;

[0129] Working standard sample 20 contains 9.0144 × 10⁻⁶. 7 Copies / μL of the positive plasmid MG TS-11 non-infectious DNA fragment;

[0130] Working standard sample 21 contains 9.0144 × 10⁻⁶. 6 Copies / μL of the positive plasmid MG TS-11 non-infectious DNA fragment;

[0131] Working standard sample 22 contains 9.0144 × 10⁻⁶. 5 Copies / μL of the positive plasmid MG TS-11 non-infectious DNA fragment;

[0132] Working standard sample 23 contains 9.0144 × 10⁻⁶. 4 Copies / μL of the positive plasmid MG TS-11 non-infectious DNA fragment;

[0133] Working standard sample 24 contains 9.0144 × 10⁻⁶. 3 Copies / μL of the positive plasmid MG TS-11 non-infectious DNA fragment;

[0134] Working standard sample 25 contains 9.0144 × 10⁻⁶. 2 Copies / μL of positive plasmid MG TS-11 non-infectious DNA fragment;

[0135] Working standard sample 26 contains 9.0144 × 10⁻⁶. 1 Copies / μL of the positive plasmid MG TS-11 non-infectious DNA fragment;

[0136] Working standard sample 27 contains 9.0144 × 10⁻⁶. 0 Copies / μL of the positive plasmid MG TS-11 non-infectious DNA fragment;

[0137] Working standard sample 28 contains 10.238 × 10 8Copies / μL of positive plasmid MG 6 / 85 non-infectious DNA fragment;

[0138] Working standard sample 29 contains 10.238 × 10 7 Copies / μL of positive plasmid MG 6 / 85 non-infectious DNA fragment;

[0139] Working standard sample 30 contains 10.238 × 10⁻⁶. 6 Copies / μL of positive plasmid MG 6 / 85 non-infectious DNA fragment;

[0140] Working standard 31 contains 10.238 × 10 5 Copies / μL of positive plasmid MG 6 / 85 non-infectious DNA fragment;

[0141] Working standard 32 contains 10.238 × 10 4 Copies / μL of positive plasmid MG 6 / 85 non-infectious DNA fragment;

[0142] Working standard 33 contains 10.238 × 10 3 Copies / μL of positive plasmid MG 6 / 85 non-infectious DNA fragment;

[0143] Working standard sample 34 contains 10.238 × 10 2 Copies / μL of positive plasmid MG 6 / 85 non-transmissible DNA fragment;

[0144] Working standard 35 contains 10.238 × 10 1 Copies / μL of positive plasmid MG 6 / 85 non-infectious DNA fragment;

[0145] Working standard 36 contains 10.238 × 10 0 Copies / μL of positive plasmid MG 6 / 85 non-infectious DNA fragment.

[0146] 2.2 Sensitivity Test

[0147] The reaction system was prepared using the primers and probes screened in Example 1. A series of working standards and negative controls (composed of nuclease-free water) were tested, and a standard curve was plotted. The specific steps are as follows:

[0148] 1) Preparation of the fluorescent PCR reaction system: Dilute each forward primer, reverse primer, and probe to 10 μmol / μL using ddH2O; each reaction tube contains 20 μL of 2×Premix Ex Taq. TM(Probe qPCR) 10.0 μL, MG-U_F 0.5 μL, MG-U_R 0.5 μL, MG F-36_F 0.3 μL, MG F-36_R 0.3 μL, MG TS-11_F 0.3 μL, MG TS-11_R 0.3 μL, MG 6 / 85_F 0.3 μL, MG 6 / 85_R 0.3 μL, MG-U_P 0.2 μL, MG F-36_P 0.1 μL, MG TS-11_P 0.1 μL, MG 6 / 85_P 0.1 μL, MG-U DNA template 1 μL, MG F-36 DNA template 1 μL, MG TS-11 DNA template 1 μL, MG 6 / 85 DNA template 1 μL, and finally add ddH2O to make up to 20.0 μL;

[0149] 2) Fluorescent PCR reaction system amplification: 95℃ pre-denaturation for 30s; 95℃ denaturation for 15s, 48℃ annealing for 30s (at the same time, HEX, FAM, CY5, and ROX fluorescence signals were collected at the end of each cycle, for a total of 40 cycles;

[0150] 3) Result Interpretation: The threshold setting principle is based on the threshold line just exceeding the highest point of the amplification curve of the normal negative control. If the sample to be tested has no Ct value or a Ct value > 35 and no specific amplification curve, the result is judged as negative. If the sample to be tested has a Ct value ≤ 35 and a specific amplification curve appears, the result is judged as positive. Specifically, when the signal is HEX, it is judged as MG-U nucleic acid positive; when the signal is FAM, it is judged as MG F-36 nucleic acid positive; when the signal is CY5, it is judged as MG TS-11 nucleic acid positive; and when the signal is ROX, it is judged as MG 6 / 85 nucleic acid positive.

[0151] The sensitivity of this method for detecting MG-U was evaluated using working standards 1–9 and a negative control. The results are as follows: Figure 6 As shown in the figure, working standards 1-8 exhibited typical amplification curves with HEX signals, while working standard 9 and the negative control showed no amplification curves. The results indicate that the limit of detection for MG-U using this method is working standard 8, and the sensitivity is 8.7344 × 10⁻⁶. 1 copies / μL. A standard curve was plotted using working standards 1-8, as shown. Figure 7 As shown, the linear equation of the standard curve is: y = -3.264x + 39.301, R0 2 =0.999, amplification efficiency E = 102.458%.

[0152] The sensitivity of this method for detecting MG F-36 was evaluated using working standards 10–18 and a negative control. The results are as follows: Figure 8As shown in the figure, working standards 10–17 exhibited typical amplification curves with only ROX signals, while working standard 18 and the negative control showed no amplification curves. The results indicate that the limit of detection for MG F-36 is working standard 17, and the sensitivity is 9.0396 × 10⁻⁶. 1 Copies / μL. A standard curve was plotted using 10–17 working standards, as shown below. Figure 9 As shown, the linear equation of the standard curve is: y = -3.375x + 38.116, R0 2 =0.999, amplification efficiency E = 97.824%.

[0153] The sensitivity of this method for detecting MG TS-11 was evaluated using working standards 19–27 and a negative control. The results are as follows: Figure 10 As shown, working standards 19–26 exhibited typical amplification curves with CY5 signals, while working standard 27 and the negative control did not show typical amplification curves. These results indicate that the limit of detection for MG TS-11 is working standard 26, and the sensitivity is 9.0144 × 10⁻⁶. 1 copies / μL. A standard curve was plotted using working standards 19–26, as shown below. Figure 11 As shown, the linear equation of the standard curve is: y = -3.379x + 38.052, R0 2 =0.998, amplification efficiency E = 97.664%.

[0154] The sensitivity of this method for detecting MG 6 / 85 was evaluated using working standards 28–36 and a negative control. The results are as follows: Figure 12 As shown, working standards 28–35 exhibited typical amplification curves with ROX signals, while working standard 36 and the negative control did not show typical amplification curves. These results indicate that the limit of detection for MG 6 / 85 is working standard 35, and the sensitivity is 10.238 × 10⁻⁶. 1 Copies / μL. A standard curve was plotted using working standards ranging from 28 to 36 μL. Figure 13 As shown, the linear equation of the standard curve is: y = -3.266x + 37.83, R0 2 =0.999, amplification efficiency E = 102.406%.

[0155] The above results indicate that this method has high sensitivity in detecting four mycoplasma species: MG-U, MG F-36, MG TS-11, and MG 6 / 85. Figure 14 Furthermore, within the detection range, there is a good linear relationship between template concentration and detection value.

[0156] Example 3: Repeatability Test

[0157] Using the primer and probe preparation system designed in Example 1, five replicate fluorescence PCR tests were performed on the working standards 3–7, 12–16, 21–25, and 30–34 prepared in Example 2. The inter-batch coefficient of variation (Ct) was calculated. For each replicate fluorescence PCR test, the results were repeated three times to calculate the intra-batch coefficient of variation. The Ct values ​​for inter-batch and intra-batch replicates were calculated using the formula: Ct% = (Standard Deviation SD / Mean) × 100%. The specific steps are as follows:

[0158] 1) Preparation of the fluorescent PCR reaction system: Dilute each forward primer, reverse primer, and probe to 10 μmol / μL using ddH2O; each tube contains 20 μL of reaction solution, 2×Premix Ex Taq. TM (Probe qPCR) 10.0 μL, MG-U_F / R 0.5 μL, MGF-36_F / R 0.3 μL, MG TS-11_F / R 0.3 μL, MG 6 / 85_F / R 0.3 μL, MG-U_P 0.2 μL, MG F-36_P 0.1 μL, MG TS-11_P 0.1 μL, MG 6 / 85_P 0.1 μL, MG-U DNA template 1 μL, MG F-36 DNA template 1 μL, MG TS-11 DNA template 1 μL, MG 6 / 85 DNA template 1 μL, and finally add ddH2O to make up to 20.0 μL;

[0159] 2) Fluorescent PCR reaction system amplification: 95℃ pre-denaturation for 30s; 95℃ denaturation for 15s, 48℃ annealing for 30s (at the same time, HEX, FAM, CY5, and ROX fluorescence signals were collected at the end of each cycle, for a total of 40 cycles;

[0160] 3) Result Interpretation: The threshold setting principle is based on the threshold line just exceeding the highest point of the amplification curve of the normal negative control. If the sample to be tested has no Ct value or a Ct value > 35 and no specific amplification curve, the result is judged as negative. If the sample to be tested has a Ct value ≤ 35 and a specific amplification curve appears, the result is judged as positive. Specifically, when the signal is HEX, it is judged as MG-U nucleic acid positive; when the signal is FAM, it is judged as MG F-36 nucleic acid positive; when the signal is CY5, it is judged as MG TS-11 nucleic acid positive; and when the signal is ROX, it is judged as MG 6 / 85 nucleic acid positive.

[0161] Repeated testing of working standards 3–7, 12–16, 21–25, and 30–34 yielded results shown in Table 2. The intra-batch and inter-batch repeatability of working standards 3–7, 12–16, 21–25, and 30–34 showed coefficients of variation of 0.19% ≤ intra-batch ≤ 1.68% and 0.25% ≤ inter-batch ≤ 2.41%, indicating that this method has good repeatability.

[0162] Table 2. Intra-assay and inter-assay repeatability tests for the quadruple qPCR method.

[0163]

[0164]

[0165] Example 4: Specificity Test

[0166] 4.1 Verification of the applicability of the universal MG-U primer and probe combination using wild-type and vaccine strain DNA templates. Four reaction tubes were prepared, each using the MG-U primers and probes designed in Example 1 to prepare a fluorescent PCR reaction system: 2×Premix ExTaq. TM (Probe qPCR) 10.0 μL; MG-U_F / R 0.5 μL (0.25 μmol / μL), MG-U_P 0.2 μL (0.10 μmol / μL); Add 2.0 μL of the prepared MG-R, MG F-36, MG TS-11, and MG 6 / 85 DNA templates to each tube respectively, and finally add ddH2O to make up to 20.0 μL.

[0167] 4.2 Validation of the specificity of this method using wild-type DNA templates. A fluorescent PCR reaction system was prepared using the MG-U, MG F-36, MG TS-11, and MG 6 / 85 primers and probes designed in Example 1: 2×Premix Ex Taq. TM (Probe qPCR) 10.0μL; MG-U_F / R 0.5μL (0.25μmol / μL), MG-U_P 0.2μL (0.10μmol / μL); MG F-36_F / R 0.3μL (0.15μmol / μL), MG F-36_P 0.10μL (0.05μmol / μL); MG TS-11_F / R 0.3μL (0.15μmol / μL), MG TS-11_P 0.10μL (0.05μmol / μL); MG 6 / 85_F / R 0.3μL (0.15μmol / μL), MG 6 / 85_P 0.10μL (0.05μmol / μL); containing prepared MG-R Add 2.0 μL of DNA template and then add ddH2O to bring the total volume to 20.0 μL.

[0168] 4.3 Verification of the specificity of this method using avian-related pathogens. The primers and probes designed in Example 1 were used to prepare the reaction system for detecting Newcastle disease virus (Lasota strain), Mycoplasma synoviae MS-H strain, Salmonella typhi ATCC54003 strain, Escherichia coli O78 SH strain, H9 subtype avian influenza virus SS strain, Infectious bronchitis virus H120 strain, avian pasteurellosis inactivated vaccine (1502 strain), SPF chicken-derived blood, SPF chicken-derived saliva, SPF chicken-derived skin tissue, as well as a positive control (composed of a mixture of MG-U, MG F-36, MG TS-11, and MG 6 / 85 DNA templates) and a negative control (composed of nuclease-free water). Fluorescent PCR reaction system preparation: 2×Premix Ex Taq TM (Probe qPCR) 10.0 μL, MG-U_F / R 0.5 μL, MG F-36_F / R 0.3 μL, MG TS-11_F / R 0.3 μL, MG 6 / 85_F / R 0.3 μL, MG-U_P 0.2 μL, MG F-36_P 0.1 μL, MG TS-11_P 0.1 μL, MG 6 / 85_P 0.1 μL, add 2 μL of the DNA template from the sample to be tested, and finally add ddH2O to make up to 20.0 μL;

[0169] 4.4 Material Sources: MG F-36 strain and virulent strain MG-R, and chicken infectious bronchitis virus strain H120 were derived from commercially available vaccines produced by Qingdao Yibang Biotechnology Co., Ltd.; MG TS-11 strain and chicken mycoplasma synoviae MS-H strain were derived from commercially available vaccines produced by Australian Bioresources Ltd.; MG 6 / 85 strain was derived from commercially available vaccines produced by Intervet USA; avian pasteurellosis inactivated vaccine (strain 1502) and Newcastle disease virus lasota strain were derived from commercially available vaccines; blood, saliva, and skin tissue samples from SPF chickens were provided by Guangxi Lichengdong Biotechnology Co., Ltd.; avian Escherichia coli O78 SH strain was derived from commercially available vaccines produced by Pulike Biotechnology Co., Ltd.; H9 subtype avian influenza virus SS strain was derived from commercially available vaccines produced by Zhaoqing Dahua Agricultural Biopharmaceutical Co., Ltd.; and chicken typhoid salmonella ATCC54003 strain was preserved by Guangxi Animal Disease Prevention and Control Center.

[0170] 4.5 The specific steps are as follows:

[0171] 4.5.1 Preparation of Specific Samples: Whole blood, saliva, skin tissue, bacteria, and viruses were processed and then manually extracted using the commercially available TaKaRa MiniBEST Viral RNA / DNA Extraction kit Ver. 5.0. The kit was sourced from Baori Biotechnology Co., Ltd. (Code No. 9766). The obtained nucleic acid samples were stored at -20℃ for later use. MG-U, MG F-36, MG TS-11, and MG 6 / 85 DNA templates were prepared and diluted appropriately for positive controls.

[0172] 4.5.2 Detection of specific samples:

[0173] 1) The reaction solution is prepared as described in Example 4, 4.1, 4.2, and 4.3 for the preparation of the fluorescent PCR reaction system;

[0174] 2) Fluorescent PCR reaction system amplification: 95℃ pre-denaturation for 30s, 95℃ denaturation for 15s, 48℃ annealing for 30s (at the same time, HEX, FAM, CY5, ROX fluorescence signals were collected at the end of each cycle, for a total of 40 cycles;

[0175] 3) Result Interpretation: The threshold setting principle is based on the threshold line just exceeding the highest point of the amplification curve of the normal negative control. If the sample to be tested has no Ct value or a Ct value > 35 and no specific amplification curve, the result is judged as MG negative. If the Ct value of the MG-U channel of the sample to be tested is ≤ 35 and a specific amplification curve appears, the result is judged as MG positive. At the same time, if the Ct value of any one or more channels of vaccine strains such as F-36, TS-11, or 6 / 85 is ≤ 35 and a specific amplification curve appears, the result is judged as positive for that MG vaccine strain. If all three vaccine strain channels have no Ct value or a Ct value > 35 and no specific amplification curve appears, the result is judged as positive for the wild-type MG strain.

[0176] The results are as follows Figure 15 The Ct values ​​of the four tubes containing MGR, MG F-36, MG TS-11, and MG 6 / 85 DNA were all ≤35, and all showed specific amplification curves. The results indicate that MG-U can detect both the virulent wild-type strain MG-R and the vaccine strains MG F-36, MG TS-11, and MG 6 / 85.

[0177] The results are as follows Figure 16The MG-U channel showed a Ct value ≤ 35 and exhibited a specific amplification curve; the MG F-36, MG TS-11, and MG6 / 85 channels showed no Ct value or a Ct value > 35 and no specific amplification curve. The results indicate that the specific primers and probes for vaccine strains MG F-36, MG TS-11, and MG 6 / 85 could not detect the virulent strain MG-R, while the MG-U primer probe detected the virulent strain MG-R.

[0178] The results are as follows Figure 17 In the positive control, the MG-U template showed only a typical amplification curve with HEX signal, the MG F-36 template showed only a typical amplification curve with FAM signal, the MG TS-11 template showed only a typical amplification curve with CY5 signal, and the MG 6 / 85 template showed only a typical amplification curve with ROX signal. No amplification signal was observed in the negative control, thus confirming the experiment's validity. In this experiment, no amplification signal was observed in the nucleic acid samples of Newcastle disease virus (lasota strain), Mycoplasma synoviae MS-H strain, Salmonella typhimurium ATCC54003 strain, Escherichia coli O78 SH strain, H9 subtype avian influenza virus SS strain, Infectious bronchitis virus H120 strain, avian pasteurellosis inactivated vaccine (strain 1502), SPF chicken blood, SPF chicken saliva, and SPF chicken skin tissue. The results indicate that this method has good specificity, with no cross-reactivity in detecting related bacteria, viruses, and samples from healthy animals.

[0179] Example 6: Detection of actual clinical field samples

[0180] The primer and probe design in Example 1 were used to prepare the reaction system. This system was applied to clinical samples collected from patients suspected of having mycoplasma sarcoma (MG), and to positive controls (the components of working standards 6, 15, 24, and 33 prepared in Example 2, all at a concentration of 10). 3 The PCR products were tested using a combination of a positive control (containing nuclease-free water) and a negative control, and then sequenced for identification. The specific steps are as follows:

[0181] Preparation of clinical samples: A total of 200 pharyngeal swab samples from cleft palate chickens that were not immunized with MG were obtained from three random live poultry stalls in the Sanjin Live Poultry Market in Nanning City. 30 pharyngeal swab nucleic acid samples were collected from SPF chickens one week after immunization with the MG F-36 attenuated vaccine strain, one week after immunization with the MG TS-11 attenuated vaccine strain, and one week after immunization with the MG 6 / 85 attenuated vaccine strain. All immunized SPF chickens were sourced from Guangxi Lichengdong Biotechnology Co., Ltd. Nucleic acid was extracted directly from the cleft palate pharyngeal swab samples using a commercially available DNA extraction kit on a fully automated nucleic acid extractor. The obtained nucleic acid samples were stored at -20℃ for later use.

[0182] Testing of clinical samples:

[0183] 1) Preparation of the fluorescent PCR reaction system: Dilute each forward primer, reverse primer, and probe to 10 μmol / μL using ddH2O; each reaction tube contains 20 μL of 2×Premix Ex Taq. TM (Probe qPCR) 10.0 μL, MG-U_F / R 0.5 μL, MG F-36_F / R 0.3 μL, MG TS-11_F / R 0.3 μL, MG 6 / 85_F F / R 0.3 μL, MG-U_P 0.2 μL, MG F-36_P 0.1 μL, MG TS-11_P 0.1 μL, MG 6 / 85_P 0.1 μL, add 2 μL of the DNA template from the sample to be tested, and finally add ddH2O to make up to 20.0 μL;

[0184] 2) Fluorescent PCR reaction system amplification: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 48℃ annealing for 30 s (at the end of each cycle, HEX, FAM, CY5, and ROX fluorescence signals were collected), for a total of 40 cycles;

[0185] 3) Result Interpretation: The threshold setting principle is based on the threshold line just exceeding the highest point of the amplification curve of the normal negative control. If the sample to be tested has no Ct value or a Ct value > 35 and no specific amplification curve, the result is judged as MG negative. If the Ct value of the MG-U channel of the sample to be tested is ≤ 35 and a specific amplification curve appears, the result is judged as MG positive. At the same time, if the Ct value of any one or more channels of vaccine strains such as F-36, TS-11, or 6 / 85 is ≤ 35 and a specific amplification curve appears, the result is judged as positive for that MG vaccine strain. If all three vaccine strain channels have no Ct value or a Ct value > 35 and no specific amplification curve appears, the result is judged as positive for the wild-type MG strain.

[0186] The results are shown in Table 3. This method detected nucleic acid in 30 SPF chicken cleft palate pharyngeal swab samples immunized with the MG F-36 vaccine strain, of which 26 were positive for MG-U and 26 were positive for the MG F-36 vaccine strain; it also detected nucleic acid in 30 SPF chicken cleft palate pharyngeal swab samples immunized with the MG TS-11 vaccine strain, of which 23 were positive for MG-U and 23 were positive for the MG TS-11 vaccine strain; it further detected nucleic acid in 30 SPF chicken cleft palate pharyngeal swab samples immunized with the MG 6 / 85 vaccine strain, of which 24 were positive for MG-U and 24 were positive for the MG 6 / 85 strain; and it detected nucleic acid in 200 cleft palate pharyngeal swab samples of unknown clinical origin from chickens that were not immunized with MG, of which 142 were positive for MG-U, 32 were positive for the MGF-36 strain, 67 were positive for the MG TS-11 strain, 25 were positive for the MG 6 / 85 strain, and 18 were positive for wild-type strains. All PCR products that tested positive were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The sequencing results were then compared and verified using BLAST in Genebank. The verification results showed that the results of all samples matched the PCR test results as expected.

[0187] Table 3: Results of actual clinical field sample testing

[0188]

[0189] In summary, the primer-probe combination of the present invention and the quadruple Taqman fluorescent PCR method using the primer-probe combination have high sensitivity, good specificity, and are simple and rapid, making them suitable for the detection and identification of wild-type MG strains and vaccine strains MG F-36, MG TS-11, and MG 6 / 85 in my country.

[0190] The foregoing description of specific exemplary embodiments of the invention is for illustrative and explanatory purposes. These descriptions are not intended to limit the invention to the precise forms disclosed, and it will be apparent that many changes and variations can be made in accordance with the foregoing teachings. The exemplary embodiments were chosen and described in order to explain the specific principles of the invention and its practical application, thereby enabling those skilled in the art to implement and utilize various different exemplary embodiments of the invention, as well as various different choices and variations. The scope of the invention is intended to be defined by the claims and their equivalents.

Claims

1. A quadruple fluorescent PCR reaction system for identifying wild-type and vaccine strains of Mycoplasma gallisepticum, characterized in that, This includes a quadruple fluorescent PCR primer-probe combination, which comprises the following primer-probe sets: A universal primer and probe set for detecting MG includes: the forward primer MG-U_F as shown in SEQ ID NO:1, the reverse primer MG-U_R as shown in SEQ ID NO:2, and the probe MG-U_P as shown in SEQ ID NO:9; The primer and probe set for detecting MG vaccine strain F-36 includes: the forward primer MG F-36_F as shown in SEQ ID NO:3, the reverse primer MG F-36_R as shown in SEQ ID NO:4, and the probe MG F-36_P as shown in SEQ ID NO:10; The primer and probe set for detecting the MG vaccine strain TS-11 includes: the forward primer MG TS-11_F as shown in SEQ ID NO:5, the reverse primer MG TS-11_R as shown in SEQ ID NO:6, and the probe MG TS-11_P as shown in SEQ ID NO:11; The primer and probe set for detecting MG vaccine strain 6 / 85 includes: the forward primer MG 6 / 85_F as shown in SEQ ID NO:7, the reverse primer MG 6 / 85_R as shown in SEQ ID NO:8, and the probe MG 6 / 85_P as shown in SEQ ID NO:12; In the quadruple fluorescent PCR reaction system, the concentrations of the forward primer MG-U_F and the reverse primer MG-U_R are 0.25 μmol / μL, and the concentration of the probe MG-U_P is 0.1 μmol / μL. The concentrations of the forward primer MG F-36_F and the reverse primer MG F-36_R are 0.15 μmol / μL, and the concentration of the probe MG F-36_P is 0.05 μmol / μL. The concentrations of the forward primer MG TS-11_F and the reverse primer MG TS-11_R are 0.15 μmol / μL, and the concentration of the probe MGTS-11_P is 0.05 μmol / μL. The concentrations of the forward primer MG 6 / 85_F and the reverse primer MG 6 / 85_R are 0.15 μmol / μL, and the concentration of the probe MG 6 / 85_P is 0.05 μmol / μL.

2. The quadruple fluorescent PCR reaction system according to claim 1, characterized in that, The probes MG-U_P, MGF-36_P, MG TS-11_P, and MG 6 / 85_P are labeled with different fluorescent groups.

3. The application of the quadruple fluorescent PCR reaction system according to claim 1 in the preparation of products for identifying wild-type Mycoplasma gallisepticum strains and vaccine strains.

4. The application of the quadruple fluorescent PCR reaction system according to claim 1 in the identification of wild-type Mycoplasma gallisepticum strains and vaccine strains for non-disease diagnosis or treatment purposes.

5. The application according to claim 4, characterized in that, The vaccine strains are MG F-36, TS-11, and 6 / 85.

6. A quadruple fluorescent PCR detection method for differentiating wild-type and vaccine strains of Mycoplasma gallisepticum for non-disease diagnosis or treatment purposes, characterized in that, Includes the following steps: (1) Preparation of fluorescent PCR reaction system: Add the DNA template of the sample to be tested and prepare the quadruple fluorescent PCR reaction system according to the quadruple fluorescent PCR reaction system described in claim 1 or 2; (2) Amplification using the fluorescent PCR reaction system; (3) Result determination: The threshold setting principle is based on the threshold line just exceeding the highest point of the amplification curve of the normal negative control. If the sample to be tested has no Ct value or a Ct value > 35 and no specific amplification curve, the result is judged as MG negative. If the Ct value of the MG-U channel of the sample to be tested is ≤ 35 and a specific amplification curve appears, the result is judged as MG positive. At the same time, if the Ct value of any one or more channels of F-36, TS-11 or 6 / 85 vaccine strains is ≤ 35 and a specific amplification curve appears, the result is judged as MG vaccine strain positive. If the channels of the three vaccine strains have no Ct value or a Ct value > 35 and no specific amplification curve appears, the result is judged as MG wild-type strain positive.

7. The detection method according to claim 6, characterized in that, In step (2), the reaction conditions are set as follows: 95℃ pre-denaturation for 30s; 95℃ denaturation for 15s; 48℃ annealing for 30s, for a total of 40 cycles; and fluorescence signals are collected at the end of each cycle.

Citation Information

Patent Citations

  • Primer probe combination, kit and method for multiple fluorescent PCR detection for identifying mycoplasma gallisepticum vaccine strain

    CN117904340A

  • Real-time fluorescent quantitative PCR (Polymerase Chain Reaction) kit for identifying mycoplasma gallisepticum wild strain from F strain, TS-11 strain and 6 / 85 strain

    CN118813835A

  • Composition for simultaneously distinguishing and detecting wild strain and vaccine strain of Mycoplasma Gallisepticum and detection method using the same

    KR102405994B1