Method for identifying arisaema heterophyllum blume and arisaema sibiricum

Abstract

The invention relates to the technical field of molecular markers, in particular to a method for identifying and distinguishing arisaema heterophyllum and arisaema sibiricum by using molecular markers. The method disclosed by the invention can be used for accurately identifying and distinguishing the arisaema alkekengi and the arisaema alkekengi by a sequencing or electrophoresis method.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to a method for identifying Arisaema confusa and Echeveria serrata by using molecular markers. Background Art

[0002] Arisaema amurense Maxim. and Arisaema bockii Engler. are both perennial herbs of the genus Araceae, of which Arisaema amurense is one of the authentic origins of Arisaema medicinal materials specified in the Chinese Pharmacopoeia. According to the description of the identification points of these two species in the Flora of China, Arisaema amurense has one leaf and Arisaema bockii Engler has two leaves. However, in field observations of Arisaema amurense and Arisaema bockii Engler, it was found that Arisaema amurense often has two leaves, and Arisaema bockii Engler also often has one leaf. Moreover, both have short-stalked rod-shaped appendages, and the leaves are bird-toed compound leaves ( Figure 1 ).

[0003] Therefore, it is difficult to distinguish the two according to the description in Flora of China, so that the single-leaf type of Asterix lanceolata was mistakenly included in Flora of Anhui as Asterix lanceolata. It can be seen that professionals may make mistakes in distinguishing Asterix lanceolata from Asterix lanceolata according to traditional taxonomy, which may lead to Asterix lanceolata being mistakenly used as medicine for Asterix lanceolata. Therefore, it is necessary to find new ways to distinguish the two, among which molecular identification is a relatively fast and reliable identification method nowadays. By developing molecular markers to identify Asterix lanceolata and Asterix lanceolata, it can provide important basis for the management of germplasm resources of the two and the formulation of Chinese medicinal materials for medicine. Summary of the invention

[0004] The present invention mainly aims at the above technical problems and provides a simple method for distinguishing Arisaema manchurianum and Echeveria caerulea by using molecular markers.

[0005] Specifically, the present invention provides the following technical solutions:

[0006] In a first aspect, the present invention provides a method for identifying and distinguishing Arisaema confusa and Aster fasciata, characterized by comprising the following steps:

[0007] 1) Extracting total DNA from samples to be tested;

[0008] 2) sequencing the total DNA to obtain a sequencing sequence;

[0009] 3) aligning the above sequencing sequence to a DNA barcode, wherein the DNA barcode is any one of SEQ ID NO. 1-4;

[0010] 4) Determine the species of the sample based on the coverage of the sequencing reads on the DNA barcode, such as if SEQ ID NO.1 and / or SEQ ID NO.4 can be completely covered.

[0011] That is, it is judged that the species of the sample to be tested contains the Arisaema dulcis sample; if SEQ ID NO.2 and / or SEQ ID NO.3 can be completely covered, it is judged that the species of the sample to be tested contains the Acanthus fasciatus sample.

[0012] Furthermore, the sample in step 1) is a single species sample or a mixed multi-species sample.

[0013] Furthermore, the high-throughput sequencing in step 2) is second-generation sequencing or third-generation sequencing.

[0014] Furthermore, in step 3), polarity reads are aligned using any of the software Geneious, Bowtie, Bowtie, Tophat or HISAT.

[0015] In another aspect, the present invention provides a second method for identifying and distinguishing Arisaema confusa and Aster fasciata, characterized by comprising the following steps:

[0016] 1) Extracting total DNA from samples to be tested;

[0017] 2) using primers to perform PCR on the total DNA of the above samples, wherein the upstream primer is any one of SEQ ID NOs. 5-9, and the downstream primer is any one of SEQ ID NOs. 10-14;

[0018] 3) Using SEQ ID NO.1 and / or SEQ ID NO.2 as standards, electrophoresis is performed on the PCR products and the standards, and the species information of the sample to be tested is determined based on the electrophoresis results;

[0019] When the electrophoresis results show that the PCR product is close in length to SEQ ID NO.1, and / or greater than SEQ ID NO.2, the sample to be tested is determined to be Rhizoma Coptidis;

[0020] When the electrophoresis result shows that the length of the PCR product is close to that of SEQ ID NO.2, and / or is smaller than that of SEQ ID NO.1, the sample to be tested is determined to be Leptospermum officinale;

[0021] When the electrophoresis results show that the PCR product contains two main bands, and the lengths are close to SEQ ID NO.1 and SEQ ID NO.2 respectively, it is determined that the sample to be tested contains both Arisaema confusa and Echinops chinensis.

[0022] Furthermore, the upstream primer of the primer is SEQ ID NO.5, and the downstream primer is SEQ ID NO.10.

[0023] On the other hand, the present invention provides a third method for identifying and distinguishing Arisaema confusa and Acanthus chinensis, which is characterized by comprising the following steps:

[0024] 1) Extracting total DNA from samples to be tested;

[0025] 2) using primers to perform PCR on the total DNA of the above samples, wherein the upstream primer is any one of SEQ ID NOs. 15-19, and the downstream primer is any one of SEQ ID NOs. 20-24;

[0026] 3) Using SEQ ID NO.3 and / or SEQ ID NO.4 as standards, electrophoresis detection is performed on the PCR products and the standards, and the species information of the sample to be detected is determined according to the electrophoresis results;

[0027] When the electrophoresis result shows that the length of the PCR product is close to that of SEQ ID NO.3, and / or greater than that of SEQ ID NO.4, the sample to be tested is determined to be Leptospermum officinale;

[0028] When the electrophoresis results show that the PCR product is close in length to SEQ ID NO.4, and / or smaller than SEQ ID NO.3, the sample to be tested is determined to be Rhizoma Coptidis;

[0029] When the electrophoresis results show that the PCR product contains two main bands, and the lengths are close to SEQ ID NO.3 and SEQ ID NO.4 respectively, it is determined that the sample to be tested contains both Arisaema confusa and Echinops chinensis.

[0030] Furthermore, the upstream primer of the primer is SEQ ID NO.15, and the downstream primer is SEQ ID NO.20.

[0031] 5. On the other hand, the present invention provides a fourth method for identifying and distinguishing Arisaema confusa and Aster fasciata, characterized by comprising the following steps:

[0032] 1) Extracting total DNA from samples to be tested;

[0033] 2) performing PCR on the total DNA of the above samples using primers, wherein the primers include 2 pairs of primers;

[0034] The upstream primer of the first pair of primers is any one of SEQ ID NOs. 5-9, and the downstream primer is any one of SEQ ID NOs. 10-14;

[0035] The upstream primer of the second pair of primers is any one of SEQ ID NOs. 15-19, and the downstream primer is any one of SEQ ID NOs. 20-24;

[0036] 3) Using SEQ ID NO.1 and / or SEQ ID NO.2 and / or SEQ ID NO.3 and / or SEQ ID NO.4 as standards, electrophoresis detection is performed on the PCR products and the standards, and the species information of the sample to be detected is determined according to the electrophoresis results. The determination table is as follows:

[0037] a. When the electrophoresis results show that the PCR product of the first pair of primers is close in length to SEQ ID NO.1, and / or greater than SEQ ID NO.2,

[0038] When the PCR product of the second pair of primers is close in length to SEQ ID NO.4 and / or smaller than SEQ ID NO.3, the sample to be tested is determined to be Rhizoma Aristolochiae;

[0039] b. When the electrophoresis results show that the PCR product of the first pair of primers is close in length to SEQ ID NO.2, and / or shorter than SEQ ID NO.1,

[0040] When the length of the PCR product of the second pair of primers is close to that of SEQ ID NO.3 and / or greater than that of SEQ ID NO.4, the sample to be detected is determined to be Leptospermum officinale;

[0041] c. When the electrophoresis results show that the PCR product of the first pair of primers contains two main bands, and the lengths are close to SEQ ID NO.1 and SEQ ID NO.2 respectively,

[0042] The PCR product of the second pair of primers contains two main bands, and the lengths are close to SEQ ID NO.3 and SEQ ID NO.4, respectively, which means that the sample to be tested contains both Arisaema confusa and Echinops chinensis.

[0043] Furthermore, the upstream primer of the first pair of primers is SEQ ID NO.5, and the downstream primer is SEQ ID NO.10; the upstream primer of the second pair of primers is SEQ ID NO.15, and the downstream primer is SEQ ID NO.20.

[0044] In a preferred case, the conditions of the PCR reaction are as follows: 25 μL of PCR amplification reaction system, 12.5 μL of 2×Phanta Max Master Mix, 1 μL of upstream primer (10 μM) / downstream primer (10 μM), 200-300 ng of DNA template, ddH2O supplemented to 25 μL. 2×Phanta Max Master Mix contains Phanta Max Super-Fidelity DNA Polymerase, dNTP, protective agent and buffer system; PCR amplification program is: ① 95℃ pre-denaturation for 3 min; ② 95℃ denaturation for 15 s, 60℃ annealing for 15 s, 72℃ extension for 75 s, 35 cycles; ③ 72℃ extension for 5 min.

[0045] In another preferred embodiment, the electrophoresis conditions of the PCR amplification products are as follows: the PCR products are detected by 1% agarose gel electrophoresis, 10× Loading Buffer is used for staining and loading, and the PCR amplification is observed under a gel imaging system.

[0046] Compared with the prior art, the identification method of the present invention can simply and effectively distinguish whether the tested variety is Araceae or Araceae, providing a guarantee for the identification, planting, resource utilization and breeding of Araceae and Araceae. It is also of great significance for the classification, phylogeny, and phylogenetic research of Araceae species, as well as the protection and utilization of Araceae resources. BRIEF DESCRIPTION OF THE DRAWINGS

[0047] Figure 1 Samples of Arisaema confusa and Echinops edulis with different numbers of leaves; A is two-leaf Echinops edulis, B is single-leaf Echinops edulis, C is two-leaf Arisaema confusa, and D is single-leaf Arisaema confusa.

[0048] Figure 2 The results of high-throughput sequencing assembly and comparative analysis are shown, showing the molecular markers SEQ ID NO.1 and SEQ ID NO.2 of Arisaema confusa and Echinops chinensis; wherein sequence 1 is Arisaema confusa and sequence 2 is Echinops chinensis.

[0049] Figure 3 The results of high-throughput sequencing assembly and comparative analysis were used to show the molecular markers SEQ ID NO.3 and SEQ ID NO.4 of Arisaema confusa and Echinops chinensis, wherein sequence 1 was Arisaema confusa and sequence 2 was Echinops chinensis.

[0050] Figure 4 It is the result of aligning the second-generation high-throughput sequencing reads of Northeastern Amur Star to the molecular marker sequence. Figure 4 A and B are the comparison results on SEQ ID NO.1 and SEQ ID NO.4 respectively. Figure 4 C and D are the alignment results on SEQ ID NO.2 and SEQ ID NO.3 respectively.

[0051] Figure 5 It is the result of using the second-generation high-throughput sequencing reads of Lampleaf chinensis to align with the molecular marker sequence. Figure 5 A and B are the comparison results on SEQ ID NO.2 and SEQ ID NO.3 respectively. Figure 5 C and D are the alignment results on SEQ ID NO.1 and SEQ ID NO.4 respectively.

[0052] Figure 6 It is an electrophoresis image of the PCR products of 6 (3 of each type of leaves) Arisaema confusa samples and 6 (3 of each type of leaves) Coleus fasciatus samples amplified using SEQ ID NO.5-10, wherein M is mark, 1-3 are two-leaf Arisaema confusa, 4-6 are single-leaf Arisaema confusa, 7-9 are two-leaf Coleus fasciatus, and 10-12 are single-leaf Coleus fasciatus.

[0053] Figure 7 It is an electrophoresis image of the PCR products of 6 (3 of each type of leaves) Arisaema confusa samples and 6 (3 of each type of leaves) Coleus fasciatus samples amplified by SEQ ID NO.15-20, wherein M is mark, 1-3 are two-leaf Arisaema confusa, 4-6 are single-leaf Arisaema confusa, 7-9 are two-leaf Coleus fasciatus, and 10-12 are single-leaf Coleus fasciatus. DETAILED DESCRIPTION

[0054] In order to make the purpose, technical scheme and beneficial technical effect of the present invention clearer, the present invention is further described in detail below in conjunction with embodiment.It should be understood that the following embodiments are provided only for the purpose of illustration and are not intended to limit the scope of the present invention.Those skilled in the art may make various modifications and substitutions to the present invention without departing from the purpose and spirit of the present invention.The experimental methods used in the following examples are conventional methods unless otherwise specified.The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial sources.

[0055] The plant samples of Arisaema confusa and Acanthus chinensis used in the following examples can be obtained through commercial purchase or collected from the wild.

[0056] Example 1 Collection of Arisaema confusa and Echeveria paniculata

[0057] The Arisaema confusa and Echeveria paniculata of the present invention are collected from Jilin City, Jilin Province and Lu'an City, Anhui Province respectively.

[0058] Example 2 Development of specific molecular markers for Arisaema manchurianum and Acanthus chinensis

[0059] The specific molecular markers for distinguishing Arisaema manchurianum and Acanthus chinensis, i.e., molecular markers, were obtained by the following steps:

[0060] 1) Collect leaves of Arisaema confusa and Echeveria paniculata;

[0061] 2) Extracting total DNA from leaves of Arisaema dulcis and Echinops edulis;

[0062] 3) performing second-generation high-throughput sequencing on the total DNA to obtain sequencing reads;

[0063] 4) Assemble the genomes of Arisaema confusa and Echinops edulis to obtain genome contigs sequences.

[0064] 5) Compare the genomic contigs of Arisaema dulcis and Echeveria paniculata to obtain species-specific fragments, i.e., molecular markers.

[0065] Results Figure 2 and Figure 3 , Figure 2 The results showed that compared with the Aglaonema dasyphylla, there was an insertion sequence of 143 bp in the genome of Aglaonema dasyphylla. The sequence was relatively long and it was speculated that it could be used as an Indel molecular marker to identify and distinguish Aglaonema dasyphylla and Aglaonema dasyphylla through conventional PCR and agarose gel electrophoresis.

[0066] The 143 bp insertion sequence in the genome of the northeastern star is as follows, where the underlined part of SEQ ID NO.1 is the insertion fragment unique to the northeastern star, the homologous region sequence in the corresponding scutellaria genome is shown in SEQ ID NO.2, and the dash '-' represents the fragment missing from the homologous region group of the eastern star genome relative to the northeastern star gene:

[0067] 5'-GCCGAAAAGAACGAGCATCCTTATGTATTTGCATATATCTTTTTTTATAATATATACAGAATGCGCAGGGGCAGGGACCTTACCCACAATCCATATATACAAGATCTAAATACAAGATAAGATCTAAGGCTAAACAACTAAATATTTCTTTTTATTATTTGTTGGATCTATAAAAAATCCTATGGATCCTTTTGATTGGTAGATTATTTTATATACCAGAGTTTCAGACCATAGCTCAACCCAAGGGAGGGTATCTTCCACTGGTCCTGTATATTGTCTTTTTCGTTCCGTGTCGTGTTCCTATGGAAACTAATATTATACGAGAATGAATTCTTTCCAGAGGTAACAAGTATTTCTACTTTCGATGAAAATTTATACACGATATACGATATGAGAAGAAACCCCTACTTATATTTTTTTCTATTTTTTATAATTGAGGAAAAGATTCCATTATTTAAATCATAATCATATTAAATCATAAGAAATC ATATATATAAATCATAAATCATAATAA ATCATATTCATATACATATTCATATAATCATATATATAATATATATAATAATCATAATCATATATAAATCATATC ATATATAAATCATATTAAATCATATATAAATCATATTCAT ATATCATATATATAATCATATAACTAATACATAATAATAATATATATTGAAATGAGACCCTGGATCCCCACACACAAAAAAAAAATTATTTCTTTCAATACTCATTCGTATTAGTTAACGATCCAAACGGCTGGATCCATATGCTTAATTCTGATACGAAATCAAATAGTAAAATAATTATTCATCGAATGACTATTCATCCATTATATTTTCAAATAAGGCGCGGGAAGATTCTATG-3'(SEQ ID NO.1)

[0068] 5'-GCCGAAAAGAACGAGCATCCTCATGTATTTGCATATATCTTTTTTTATAATATATACAGAATGCGCAGGGGCAGGGACCTTACCCACAATCCATATATACAAGATCTAAATACAAGATAAGATCTAAGGCTAAACAACTAAATATTTCTTTTTATTATTTGTTGGATCTATAAAAAATCCTATGGATCCTTTGGATTGGTAGATTATTTTATATACCAGAGTTTCAGACCATAGCTCAACCCAAGGGAGGGTATCTTCCACCGGTCTGTATATTGTCTTTTTCGTTCCGTGTCGTGTTCCTATGGAAACTAATATTATATATTATACGAGAATGAATTCTTTCCAGAGGTAACAAGTATTTCTACTTTCGATGAAAATTTATACACGATATACGATATGAGAAGAAACCCCTACTTATATTTTTTTTCTATTTTTTATAATTGAGGAAAAGATTCCATTATTTAAATCATAATCATATTAAATCATAAGAAATC----------------------------------------------------------------------

[0069] ----------------------------------------------------------ATATCATATATATAATCATATAACTAATACATAATAATAATATATATTGAAATGAGACCCTGGATCCCCACACACAAAAAAAAAATTATTTCTTTCAATACTCATTCGTATTAGTTAACGACCCAAACGGCTGGATCCATATGTTTAATTCTGATACGAAATCAAATAGTAAAATAATTATTCATCGAATGACTATTCATCCATTATATTTTCAAATAAGGCGCGGGAAGATTCTATG-3'(SEQ ID NO.2)

[0070] Figure 3The results showed that there was a 491bp AT-rich region in the genome of A. styracifolia, with an AT content of 98.6%, while the corresponding homologous region in the genome of A. styracifolia was only 223bp, with an AT content of 96.9%. Compared with A. styracifolia, the genome of A. styracifolia contained 268bp of continuously arranged intervening insertion sequences in the above region. The total length of these insertion sequences was longer, and it was speculated that they could be used as molecular markers to identify and distinguish A. styracifolia and A. styracifolia through conventional PCR and agarose gel electrophoresis.

[0071] The base sequence of the Asterix ternariae genome in the above interval is SEQ ID NO.3 as follows, wherein the bold fonts on a gray background are the above AT-rich region sequences, and the underlined parts are insertion fragments unique to the Asterix ternariae genome; the base sequence of the Arisaema confusa genome in the above homologous region is SEQ ID NO.4 as follows, wherein the bold fonts on a gray background are the above AT-rich region sequences, and the dash '-' represents the fragments missing from the Arisaema confusa genome relative to the Asterix ternariae gene in the homologous region group:

[0072]

[0073] Example 3 Primer design of specific molecular markers of Arisaema confusa and Acanthus chinensis

[0074] According to the comparison results in Example 2, combined with the corresponding contigs sequences, multiple pairs of PCR primers for identifying Arisaema confusa and Acanthus fasciatus were designed using Geneious software. The primer sequences are as follows:

[0075] Primers for SEQ ID NO.1 and its homologous sequences

[0076] Forward primer TM-4F1: 5'-GCCGAAAAGAACGAGCATCC-3' (SEQ ID NO. 5)

[0077] Forward primer TM-4F2: 5'-CCGCTGCTTGTGAGATTTGG-3' (SEQ ID NO.6)

[0078] Forward primer TM-4F3: 5'-TGAGCCGAAAAGAACGAGCA-3' (SEQ ID NO. 7)

[0079] Forward primer TM-4F4: 5'-TATACAGAATGCGCAGGGGC-3' (SEQ ID NO. 8)

[0080] Forward primer TM-4F5: 5'-CGTTCCGTGTCGTGTTCCTA-3' (SEQ ID NO.9)

[0081] Reverse primer TM-4R1: 5'-CATAGAATCTTCCCGCGCCT-3' (SEQ ID NO. 10)

[0082] Reverse primer TM-4R2: 5'-TGGGGATCCAGGGTCTCATT-3' (SEQ ID NO.11)

[0083] Reverse primer TM-4R3: 5'-TTGTGTTGTGGGGATCCAGG-3' (SEQ ID NO. 12)

[0084] Reverse primer TM-4R4: 5'-TCCATAGAATCTTCCCGCGC-3' (SEQ ID NO. 13)

[0085] Reverse primer TM-4F5: 5'-TCTTCCCGCGCCTTATTTGA-3' (SEQ ID NO. 14)

[0086] This pair of primers for SEQ ID NO.2 and SEQ ID NO.3

[0087] Forward primer TM-8F1: 5'-GCAGAACCGGACATGAGAGT-3' (SEQ ID NO. 15)

[0088] Forward primer TM-8F2: 5'-ACTGCAGAACCGGACATGAG-3' (SEQ ID NO. 16)

[0089] Forward primer TM-8F3: 5'-CTGCAGAACCGGACATGAGA-3' (SEQ ID NO. 17)

[0090] Forward primer TM-8F4: 5'-TGCAGAACCGGACATGAGAG-3' (SEQ ID NO. 18)

[0091] Forward primer TM-8F5: 5'-GGCTCCTCGCGAAAGAAGAA-3' (SEQ ID NO. 19)

[0092] Reverse primer TM-8R1: 5'-ATTCATTGGGTGGGATGGCG-3' (SEQ ID NO. 20)

[0093] Reverse primer TM-8R2: 5'-GGAACCCGTGACTGCATAGG-3' (SEQ ID NO.21)

[0094] Reverse primer TM-8R3: 5'-AGAGTCAATATTCGCCCGCG-3' (SEQ ID NO. 22)

[0095] Reverse primer TM-8R4: 5'-GAACCCGTGACTGCATAGGA-3' (SEQ ID NO. 23)

[0096] Reverse primer TM-8F5: 5'-ATTGACGGAGAAGCCATGGG-3' (SEQ ID NO. 24)

[0097] Example 4 Identification method 2 of Arisaema confusa and Acanthus chinensis

[0098] 1) Collect leaves of Arisaema confusa and Echeveria paniculata plants as samples to be tested;

[0099] 2) extracting total DNA from the sample to be tested;

[0100] 3) Performing second-generation high-throughput sequencing on the total DNA of the above two samples to obtain sequencing reads;

[0101] 3) Using the default parameters of Geneious software, the above sequencing reads were aligned to the molecular markers described in Example 2;

[0102] 4) judging whether the sample is Arisaema confusa or Aster fasciata according to the coverage of the sequencing reads on the molecular markers; if SEQ ID NO.1 and SEQ ID NO.4 can be completely covered, the species of the sample to be tested is judged to be Arisaema confusa; if SEQ ID NO.2 and SEQ ID NO.3 can be completely covered, the species of the sample to be tested is judged to be Aster fasciata.

[0103] Test results such as Figure 6-7 As shown, Figure 4 This is a sample of Northeast Nanxing. The figure shows that the sequencing reads are fully covered on SEQ ID NO.1 and SEQ ID NO.4 ( Figure 4 A, B), while there are a lot of uncovered regions on SEQ ID NO.2 and SEQ ID NO.3 ( Figure 4 C, D). Figure 5 This is a sample of Lampleaf sempervivum. The figure shows that the sequencing reads fully cover SEQ ID NO.2 and SEQ ID NO.3 ( Figure 5 A, B), while there are a lot of uncovered regions on SEQ ID NO.1 and SEQ ID NO.4.

[0104] Example 5 Identification method of Arisaema confusa and Acanthus chinensis 1

[0105] 1) Collect leaves of Arisaema confusa and Echeveria paniculata plants as samples to be tested, with 3 double-leaf and 3 single-leaf samples of each plant;

[0106] 2) extracting total DNA from the sample to be tested;

[0107] 3) using the primers designed in Example 3 (using TM-4F1 and TM-4R1, TM-8F1 and TM-8R1 for amplification, respectively), PCR was performed on the total DNA of the above samples;

[0108] The PCR amplification reaction system is 25 μL, 2×Phanta Max Master Mix 12.5 μL, upstream primer (10 μM) / downstream primer (10 μM) 1 μL each, DNA template 200-300 ng, ddH2O supplemented to 25 μL. 2×Phanta Max Master Mix contains Phanta Max Super-Fidelity DNA Polymerase, dNTP, protective agent and buffer system;

[0109] The PCR amplification procedure was as follows: ① pre-denaturation at 95°C for 3 min; ② denaturation at 95°C for 15 s, annealing at 60°C for 15 s, extension at 72°C for 75 s, 35 cycles; ③ extension at 72°C for 5 min; 4) PCR amplification product detection: PCR products were detected by 1% agarose gel electrophoresis, 10× Loading Buffer was used for staining, and PCR amplification was observed under a gel imaging system. The main bands were clear ( Figure 6 , Figure 7 ).

[0110] from Figure 6 It can be seen that the length of the PCR product of Arisaema confusa (1-6 dot sample wells) is significantly longer than that of D. cerana (7-12 dot sample wells), which is in line with expectations. Figure 7 It can be seen that the length of the PCR product of the northeastern star (1-6 dot sample wells) is significantly shorter than that of the PCR product of the lamp-shaped lotus (7-12 dot sample wells), which is consistent with expectations. It can be seen that the above identification method can simply and effectively identify and distinguish the northeastern star and the lamp-shaped lotus.

[0111] According to the disclosure and teaching of the above description, those skilled in the art to which the present invention belongs may also make appropriate changes and modifications to the above embodiments. Therefore, the present invention is not limited to the specific embodiments disclosed and described above, and some modifications and changes to the present invention should also fall within the scope of protection of the claims of the present invention. In addition, although some specific terms are used in this specification, these terms are only for the convenience of description and do not constitute any limitation to the present invention.

Claims

1. A method for identifying and distinguishing Arisaema confusa and Aster fasciata, characterized in that The following steps are involved: 1) Extracting total DNA from samples to be tested; 2) sequencing the total DNA to obtain a sequencing sequence; 3) aligning the above sequencing sequence to a DNA barcode, wherein the DNA barcode is any one of SEQ ID NO. 1-4; 4) Determine the species of the sample according to the coverage of the sequencing reads on the DNA barcode. If SEQ ID NO.1 and / or SEQ ID NO.4 can be completely covered, it is determined that the species of the sample to be tested contains a sample of Arisaema confusa; if SEQ ID NO.2 and / or SEQ ID NO.3 can be completely covered, it is determined that the species of the sample to be tested contains a sample of Acanthus fasciatus.

2. The method for identifying and distinguishing Arisaema confusa and Acanthus sempervivum as claimed in claim 1, characterized in that: The sample in step 1) is a single species sample or a mixed multi-species sample.

3. The method for identifying and distinguishing Arisaema confusa and Aster fasciata as claimed in claim 1, characterized in that: The high-throughput sequencing described in step 2) is second-generation sequencing or third-generation sequencing.

4. The method for identifying and distinguishing Arisaema confusa and Acanthus sempervivum as claimed in claim 1, characterized in that: In step 3), polar reads were aligned using any of the softwares Geneious, Bowtie, Tophat or HISAT.

5. A method for identifying and distinguishing Arisaema confusa and Aster fasciata, characterized in that The following steps are involved: 1) Extracting total DNA from samples to be tested; 2) using primers to perform PCR on the total DNA of the above samples, wherein the upstream primer is any one of SEQ ID NOs. 5-9, and the downstream primer is any one of SEQ ID NOs. 10-14; 3) Using SEQ ID NO.1 and / or SEQ ID NO.2 as standards, electrophoresis is performed on the PCR products and the standards, and the species information of the sample to be tested is determined based on the electrophoresis results; When the electrophoresis results show that the PCR product is close in length to SEQ ID NO.1, and / or greater than SEQ ID NO.2, the sample to be tested is determined to be Rhizoma Coptidis; When the electrophoresis result shows that the length of the PCR product is close to that of SEQ ID NO.2, and / or is smaller than that of SEQ ID NO.1, the sample to be tested is determined to be Leptospermum officinale; When the electrophoresis results show that the PCR product contains two main bands, and the lengths are close to SEQ ID NO.1 and SEQ ID NO.2 respectively, it is determined that the sample to be tested contains both Arisaema confusa and Echinops chinensis.

6. The method for identifying and distinguishing Arisaema confusa and Acanthus sempervivum as claimed in claim 5, characterized in that: The upstream primer of the primer is SEQ ID NO.5, and the downstream primer is SEQ ID NO.

10.

7. A method for identifying and distinguishing Arisaema confusa and Aster fasciata, characterized in that The following steps are involved: 1) Extracting total DNA from samples to be tested; 2) using primers to perform PCR on the total DNA of the above samples, wherein the upstream primer is any one of SEQ ID NOs. 15-19, and the downstream primer is any one of SEQ ID NOs. 20-24; 3) Using SEQ ID NO.3 and / or SEQ ID NO.4 as standards, electrophoresis detection is performed on the PCR products and the standards, and the species information of the sample to be detected is determined according to the electrophoresis results; When the electrophoresis result shows that the length of the PCR product is close to that of SEQ ID NO.3, and / or greater than that of SEQ ID NO.4, the sample to be tested is determined to be Leptospermum officinale; When the electrophoresis results show that the PCR product is close in length to SEQ ID NO.4, and / or smaller than SEQ ID NO.3, the sample to be tested is determined to be Rhizoma Coptidis; When the electrophoresis results show that the PCR product contains two main bands, and the lengths are close to SEQ ID NO.3 and SEQ ID NO.4 respectively, it is determined that the sample to be tested contains both Arisaema confusa and Echinops chinensis.

8. The method for identifying and distinguishing Arisaema confusa and Acanthus sempervivum as claimed in claim 7, characterized in that: The upstream primer of the primer is SEQ ID NO.15, and the downstream primer is SEQ ID NO.

20.

9. A method for identifying and distinguishing Arisaema confusa and Aster fasciata, characterized in that The following steps are involved: 1) Extracting total DNA from samples to be tested; 2) performing PCR on the total DNA of the above samples using primers, wherein the primers include two pairs of primers; The upstream primer of the first pair of primers is any one of SEQ ID NOs. 5-9, and the downstream primer is any one of SEQ ID NOs. 10-14; The upstream primer of the second pair of primers is any one of SEQ ID NOs. 15-19, and the downstream primer is any one of SEQ ID NOs. 20-24; 3) Using SEQ ID NO.1 and / or SEQ ID NO.2 and / or SEQ ID NO.3 and / or SEQ ID NO.4 as standards, electrophoresis is performed on the PCR products and the standards, and the species information of the sample to be tested is determined according to the electrophoresis results. The determination criteria are as follows: a. When the electrophoresis results show that the PCR product of the first pair of primers is close in length to SEQ ID NO.1, and / or greater than SEQ ID NO.2, When the PCR product of the second pair of primers is close in length to SEQ ID NO.4 and / or smaller than SEQ ID NO.3, the sample to be tested is determined to be Rhizoma Aristolochiae; b. When the electrophoresis results show that the PCR product of the first pair of primers is close in length to SEQ ID NO.2, and / or shorter than SEQ ID NO.1, When the length of the PCR product of the second pair of primers is close to that of SEQ ID NO.3 and / or greater than that of SEQ ID NO.4, the sample to be detected is determined to be Leptospermum officinale; c. When the electrophoresis results show that the PCR product of the first pair of primers contains two main bands, and the lengths are close to SEQ ID NO.1 and SEQ ID NO.2, respectively, and the PCR product of the second pair of primers contains two main bands, and the lengths are close to SEQ ID NO.3 and SEQ ID NO.4, respectively, it is determined that the sample to be tested contains both Arisaema confusa and Echinops chinensis.

10. The method for identifying and distinguishing Arisaema confusa and Acanthus sempervivum as claimed in claim 9, characterized in that: The upstream primer of the first pair of primers is SEQ ID NO.5, and the downstream primer is SEQ ID NO.10; the upstream primer of the second pair of primers is SEQ ID NO.15, and the downstream primer is SEQ ID NO.20.

Images