Clostridium bacteria modified to assimilate several sugars simultaneously, and preparation and use thereof

Abstract

The present invention relates to a genetically modified bacterium of the genus Clostridium, in particular a solvent-producing bacterium of the genus Clostridium. The invention also relates to methods, tools and kits for deleting or modifying one or more coding sequences of a XylR and / or AraR transcriptional repressor or for controlling transcription of one or more coding sequences of a XylR and / or AraR transcriptional repressor, the genetically modified bacteria obtained and uses thereof, the present invention relates to a carbon-containing composition, in particular for the simultaneous fermentation of at least one hexose and one pentose or of at least two carbon-containing substrates selected from the group consisting of glucose, arabinose, xylose, mannose and galactose.

Description

[0001] The present invention relates to genetically modified Clostridium bacteria, in particular solvent-producing Clostridium bacteria. The present invention also relates to methods, tools and kits capable of eliminating or modifying sequences encoding transcriptional repressors XylR and / or AraR or controlling the transcription of sequences encoding transcriptional repressors XylR and / or AraR, the genetically modified bacteria obtained and their uses, in particular for simultaneously fermenting at least one hexose and one pentose or a carbon-based element of a substrate containing at least two carbon-based elements selected from glucose, arabinose, xylose, mannose and galactose. Background Art

[0002] The genus Clostridium contains Gram-positive, strictly anaerobic, spore-forming bacteria that belong to the phylum Firmicutes. Clostridia are an important group to the scientific community for several reasons. The first is that a number of serious diseases (e.g., tetanus, botulism) are caused by infection with pathogenic members of this family (John & Wood, 1986). The second is the possibility of using "acidogenic" or "solventogenic" strains in biotechnology. These non-pathogenic Clostridia have the natural ability to convert a variety of sugars to produce chemicals of interest (particularly acetone, butanol and ethanol) in a process known as ABE fermentation (John & Wood, 1986). The bacterium Clostridium acetobutylicum is now considered to be the poster child for solventogenic Clostridia.

[0003] Solventogenic Clostridia are able to assimilate a wide range of carbon sources, which is advantageous for ABE fermentation processes (Keis, Shaheen and Jones 2001). In theory, this versatility allows them to efficiently proliferate on a wide range of substrates, especially by-products from agro-industries (Qureshi et al. 2008; Ezeji, Qureshi and Blaschek 2007; Ezeji and Blaschek 2008; Qureshi et al. 2006). The incorporation of plant biomass into industrial processes has become increasingly common due to the development of industrial fermentation processes and more recently green chemistry. However, the classification of plant substrates in contrast to the two “generations” of industrial substrates has spread rapidly throughout the industry, based on environmental and human considerations.

[0004] "First generation" (1G) substrates collate all carbon sources derived from plant reserve organs. In particular, 1G substrates can be derived from corn or wheat, but also from sugar cane or sugar beet. Composed mainly of sucrose and starch, their fermentation on an industrial scale is currently very efficient. On the other hand, the use of these substrates is controversial, since they require the use of arable land and commodities developed by the agri-food industry.

[0005] In contrast to this paradigm, "second generation" (2G) substrates collate all substrates derived from plant structural organs or derived from agro-industrial byproducts. In doing so, this approach helps to reduce the tension between the energy and food sectors. However, their use is far less simple than 1G substrates. This is due to the main carbon source of these substrates: lignocellulose, a complex and intractable polymer substrate. Its degradation into fermentable sugars requires more or less expensive pretreatment, which may generate microbial growth inhibitors.

[0006] Due to the complex nature of the different fractions derived from it, hemicellulose hydrolysates contain a variety of carbon sources. These carbon sources mainly include xylose and glucose, accompanied by a mixture of small amounts of sugars (such as galactose, mannose and arabinose). All of these sugars can be fermented by solvent-producing Clostridium species. For example, Clostridium cellulovorans DSM743B is described by Wen et al. (2020) as a strain that can be manipulated to optimize the production of n-butanol from lignocellulose, and WO 2013 / 159710 describes a modified Clostridium beijerinckii with enhanced consumption of xylose and / or arabinose. However, in practice, biological processes known as catabolism inhibition (CR) prevent the optimal and simultaneous use of all these carbon sources. In particular, catabolism inhibition prevents the effective metabolism of xylose contained in lignocellulose hydrolysates. The bacterium Clostridium. acetobutylicum is particularly susceptible to this inhibition phenomenon (Qureshi et al. 2006; Grimmler et al. 2010). Hu et al. (2011) reported that inactivation of the xylR gene (CA_C2613) in Clostridium acetobutylicum ATCC 824 strain resulted in faster xylose utilization, but did not affect the total amount of fermented xylose. WO 2013 / 159710 recommends that those skilled in the art not inactivate xylR (CAC3673) in Clostridium acetobutylicum. SUMMARY OF THE INVENTION

[0008] In the context of the present invention, the inventors describe bacteria of the genus Clostridium, generally solventogenic bacteria, which are able to simultaneously consume different carbon sources, in particular different sugars. In particular, they describe for the first time Clostridium acetobutylicum bacteria that are able to simultaneously consume glucose and pentoses, preferably glucose and arabinose.

[0009] In particular, the inventors describe a genetically modified bacterium belonging to the genus Clostridium, in particular a solvent-producing bacterium that does not express the transcriptional repressors XylR and / or AraR or expresses a non-functional form thereof. Such a genetically modified bacterium is a bacterium that does not express the xylR and / or araR gene products, in particular the CA_C2613, CA_C3673 and / or CA_C1340 gene products, or expresses a non-functional form of said products.

[0010] The specific bacteria described herein by the inventors do not express the transcriptional repressor XylR or express a non-functional form thereof. Such genetically modified bacteria are bacteria that do not express the xylR gene product, in particular the CA_C2613 and / or CA_C3673 gene product, or express a non-functional form of said product.

[0011] Another specific bacterium described herein by the inventors does not express the AraR transcriptional repressor or expresses its non-functional form. This genetically modified bacterium is a bacterium that does not express the araR gene product, particularly the CA_C1340 gene product, or expresses the non-functional form of the product.

[0012] Another preferred genetically modified bacterium according to the present invention is a bacterium that does not express the transcriptional repressors XylR and AraR or expresses their non-functional forms. This genetically modified bacterium does not express xylR and araR gene products, particularly CA_C2613, CA_C3673 and CA_C1340 gene products, or expresses the non-functional forms of the products.

[0013] Particularly preferred genetically modified bacteria according to the present invention correspond to the strain identified in this specification as IFP 968, which was registered with the BCCM-LMG Collection under the deposit number LMG P-32703 on June 13, 2022 (also identified herein as ΔCA_C1340 ΔCA_C2613 ΔCA_C3673 or ΔaraR ΔxylR1 ΔxylR2), and the strain identified in this specification as IFP 967, which was registered with the BCCM-LMG Collection under the deposit number LMG P-32702 on June 13, 2022 (also identified herein as ΔCA_C1340 or ΔaraR), which can be used to prepare a strain equivalent to strain IFP 968. The present invention also relates to any derived bacteria, clones, mutants or genetically modified forms thereof.

[0014] The inventors also describe methods for producing recombinant bacteria as described herein, in particular methods comprising deleting or inactivating the xylR and / or araR genes to prevent or reduce the expression of functional XylR and / or AraR proteins, as well as genetically modified bacteria obtainable by this method, of which IFP 967 and IFP 968 are examples.

[0015] The inventors also describe the use of genetically modified bacteria belonging to the genus Clostridium, characterized in that they do not express the xylR or araR gene product, or express a non-functional form of the xylR or araR gene, such as strain IFP 967, for the preparation of genetically modified bacteria according to the present invention that do not express the xylR or araR gene product, or express their non-functional form.

[0016] The inventors also describe the use of the bacteria according to the invention for producing solvents, sugars or bio-based molecules, for example from: i) lignocellulosic biomass, ii) products of specific dedicated crops (e.g., energy crops, perennial forage crops, herbaceous crops or shrub crops), or iii) 1G substrates derived from one or more sugar-producing plants, cereal plants or oil-producing plants, or iv) mixtures of such carbon sources.

[0017] The inventors have also described the use of bacteria according to the invention for simultaneous fermentation (or in other words "co-fermentation") of at least one hexose and one pentose or a carbon-based element of a substrate comprising at least two carbon-based elements selected from glucose, arabinose, xylose, mannose and galactose. Such bacteria can be advantageously used for the production of solvents or solvent mixtures, in particular on an industrial scale.

[0018] The present invention also relates to fermentation methods involving the use of the genetically modified bacteria as described herein.

[0019] Finally, the inventors describe a kit, in particular a kit for transforming and preferably genetically modifying bacteria belonging to the genus Clostridium, and a kit for producing solvents, sugars or bio-based molecules using bacteria belonging to the genus Clostridium, said kit comprising i) a genetically modified bacterium belonging to the genus Clostridium according to the present invention and ii) a culture medium, in particular a rich culture medium, preferably an RCM-type culture medium, more preferably a GAPES-type culture medium, even more preferably a CGM-type culture medium, which contains at least glucose and a pentose, preferably glucose and arabinose and / or xylose. DETAILED DESCRIPTION OF THE INVENTION

[0021] Despite being used in industry for more than a century, knowledge about bacteria belonging to the genus Clostridium, and in particular solvent-producing bacteria, remains very limited. The main limitation encountered by manufacturers concerns their inability to use several different carbon sources simultaneously and thus to efficiently metabolize different types of substrates, in particular different types of sugars.

[0022] Although it is well known to those skilled in the art that there are difficulties in genetically modifying bacteria belonging to the genus Clostridium, the inventors have succeeded in obtaining for the first time in the context of the present invention a Clostridium acetobutylicum bacterium that is able to simultaneously utilize (i.e., co-assimilate, cometabolize or co-ferment (these terms are used interchangeably herein)) several different carbon sources, in particular carbon sources from biomass, in particular plant biomass, such as lignocellulosic biomass.

[0023] Preferred "raw material biomass" in the context of the present invention, also referred to as "natural biomass" is plant biomass, in particular lignocellulosic biomass. The latter essentially comprises three natural components (polymers), present in different amounts according to their source: cellulose (accounting for about 35-50% of the dry mass of biomass), which is a polysaccharide essentially consisting of hexoses; hemicellulose (accounting for about 20-30% of the dry mass of biomass), which is a polysaccharide essentially consisting of pentoses; and lignin (accounting for about 15-25% of the dry mass of biomass), which is a complex high molecular weight polymer formed by aromatic alcohols connected via ether bonds. These different molecules are responsible for the intrinsic properties of plant walls and organize themselves into a complex entangled network. Of the three basic polymers contained in lignocellulosic biomass, cellulose and hemicellulose are polymers that allow the production of 2G sugary liquor and 2G alcohol.

[0024] Non-limiting examples of lignocellulosic biomass include, for example, agricultural residues (particularly straw waste, corn cobs, bagasse, etc.), but also forestry residues, sawmill residues (typically wood chips) or any other type of woody residues from forestry, industrial, urban or domestic sources. Cellulosic biomass can also be the product of specific dedicated crops, such as energy crops, such as dedicated to the cultivation of annual plants ("whole plant" use, such as wheat or corn). It can also be, for example, perennial forage crops (such as fescue, cocksfoot or ryegrass), herbaceous plant crops (such as Miscanthus or switchgrass) or shrub crops (short-cycle or very short-cycle coppice, such as willow, poplar, chestnut or eucalyptus).

[0025] Another biomass that can be used in the context of the present invention can be a 1G substrate or a mixture of several 1G substrates from sugar-producing plants (e.g. sugar cane or sugar beet), cereal plants (e.g. corn or wheat) and / or oil-producing plants (e.g. soybean, rapeseed or palm). In the context of the present invention, the biomass can be used alone or as a mixture (e.g. a mixture of several different types of biomass). The amount of water contained in the raw biomass is 1% to 70% of the total mass of the raw biomass.

[0026] To this end, the inventors have therefore advantageously succeeded in genetically modifying a solventogenic bacterium, reference strain Clostridium acetobutylicum, in particular, making it capable of fermenting two carbon-based elements of different nature, such as at least one hexose and one pentose, or a carbon-based element comprising at least two different carbon-based elements selected from glucose, arabinose, xylose, mannose and galactose, preferably selected from glucose, arabinose and xylose, even more preferably glucose and arabinose.

[0027] In C. acetobutylicum, genes related to xylose catabolism are organized in the form of regulons (Gu et al. 2010). The main operon involved in xylose assimilation is the CA_C2610-CA_C2612 locus, which contains genes encoding xylose isomerase XylA (CA_C2610) and xylulokinase XylB (CA_C2612) (Gu et al. 2010). Genes encoding permeases predicted to be involved in xylose import, AraE1 (CA_C1339) and XylT (CA_C1345), are located in the second locus (CA_C1339-CA_C1349), which also contains genes related to arabinose assimilation. The third operon (CA_C3451-CA_C3452) contains genes encoding XynT and XynB proteins, corresponding to putative permeases and 1,4-β-D-xylosidases, respectively.

[0028] With the exception of xylT, all of these genes have XylR binding site (XBS) operator sequences in their promoters or coding sequences (Gu et al. 2010). Specifically, the presence of XBS has the effect of placing these genes under the control of a xylose repressor (called XylR), which is able to prevent transcription in the absence of xylose in the culture medium.

[0029] The CA_C2613 gene is located upstream of the xylB gene within the major xylose assimilation operon. This arrangement is very similar to that observed in species carrying a xylose repressor (Gu et al. 2010).

[0030] The CA_C3673 gene has an XBS at its promoter, indicating autoregulation of its transcription. The product of this gene is also a repressor with the greatest identity to the XylR homologue belonging to closely related solventogenic Clostridia (e.g., Clostridium beijerinckii NCIMB 8052).

[0031] Most of the genes involved in arabinose assimilation are located within the CA_C1339-CA_C1349 locus. This locus contains genes encoding putative arabinose transporters AraE1 and XylT, L-arabinose isomerases AraA1 (CA_C1342) and AraA2 (CA_C1346), ribulose kinase AraK (CA_C1344), and L-ribulose-5-phosphate 4-epimerase AraD (CA_C1341).

[0032] The second operon contains the CA_C1529 and CA_C1530 genes encoding the arabinofuranosidase Arb43 and the arabinoside transporter AraT.

[0033] All of these genes, as well as the gene encoding the Xfp phosphoketolase, are placed under the control of the AraR transcriptional repressor (CA_C1340), which is active in the absence of arabinose (Zhang et al. 2012).

[0034] A striking feature of the recently discovered Clostridium acetobutylicum is the phenotypic differences in growth on xylose and arabinose, despite the fact that the metabolic pathways for the assimilation of these sugars share many common intermediates (Servinsky et al. 2010). Specifically, the generation time on arabinose was 78 minutes, while it reached 287 minutes on xylose (Servinsky et al. 2012). Although xylose permease and xylulokinase activities are involved, this difference can also be explained by the role of transcriptional regulators.

[0035] Transcriptome analysis of C. acetobutylicum ATCC 824 cultures in the presence of glucose, xylose or arabinose revealed that the pentose phosphate pathway is similarly induced by xylose and arabinose (Servinsky et al. 2010). In contrast, the expression of the phosphoketolase Xfp has a different expression profile. Specifically, xfp is weakly induced by xylose (3-fold weaker than glucose), but is strongly induced by arabinose (185-fold stronger than glucose) (Servinsky et al. 2012). The significant contrast in the induction of xfp gene expression in the absence of arabinose can be explained by the presence of an AraR binding site upstream of the gene. Therefore, one of the most noteworthy results of the transcriptome analysis of mutants in which the araR gene has been inactivated is that xfp gene transcription is enhanced by more than 1000-fold (Zhang et al. 2012). This transcriptional regulation of phosphoketolase contributes to the partial blockade of xylose assimilation in the absence of arabinose.

[0036] Recent work has also shown that, in addition to being partially inhibited in the absence of arabinose, xylose assimilation is also reduced in the presence of arabinose. Specifically, cultures performed in the presence of xylose and arabinose showed minimal xylose consumption, while arabinose assimilation levels did not differ from those observed with arabinose alone (Aristilde et al. 2014). Metabolic flux analysis confirmed the preferential assimilation of arabinose over xylose in the culture over the two sugars (Aristilde et al. 2014). Servinsky et al. also showed that the preference for arabinose over xylose could not be fully explained by the intrinsic growth rates of the two carbohydrates. Thus, they highlighted the fact that arabinose is able to specifically inhibit the expression of genes for the assimilation of other sugars, including xylose.

[0037] The inventors have shown for the first time that the combined inactivation of the genes encoding the AraR and XylR repressors provides a strain with surprising co-assimilative capacity, as it is able to simultaneously assimilate and / or metabolize two different carbon sources, such as arabinose and glucose, without releasing the catabolic repression of xylose assimilation.

[0038] Thus, one subject described by the inventors is a genetically modified bacterium belonging to the genus Clostridium, in particular a Clostridium species of industrial interest, in particular Clostridium acetobutylicum, characterized in that it does not express the xylR and / or araR gene products, or expresses a non-functional form thereof.

[0039] In the present context, the term "xylR gene" refers in particular to the sequence SEQ ID NO: 1 (CA_C2613) or the sequence SEQ ID NO: 2 (CA_C3673). The term "xylR gene" also refers to variants of the sequences SEQ ID NO: 1 and SEQ ID NO: 2, in particular variants having sequence homology to one of the sequences SEQ ID NO: 1 or SEQ ID NO: 2.

[0040] In the context of the present invention, the term "araR gene" refers in particular to the sequence SEQ ID NO: 3 (CA_C1340) or a variant of said sequence, in particular a variant showing sequence homology with said sequence SEQ ID NO: 3.

[0041] Typical examples of variants according to the invention have a sequence homology of 95% to 100%, preferably a sequence homology of 96% to 100% with the sequence SEQ ID NO: 1, SEQ ID NO: 2 or the sequence SEQ ID NO: 3. The sequence SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3 is, for example, at least 95% homologous, for example at least 96% homologous, at least 97% homologous, at least 98% homologous or at least 99% homologous with its variants. According to a preferred embodiment, the sequence SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3 and its variants have a sequence homologous of at least 96%, at least 97% or at least 98%.

[0042] The term "xylR gene" also refers to sequences encoding functional fragments or variants of the XylR protein, in particular sequences encoding a protein capable of, for example, in the absence of xylose, inhibiting, reducing or preventing (or participating in the inhibition of) the expression of an enzyme of the xylose assimilation pathway, for example, capable of inhibiting, reducing or preventing the transcription of at least one gene selected from the group consisting of: a gene encoding a xylose isomerase "XylA" (encoded by gene CA_C2610, SEQ ID NO: 4), a gene encoding a xylulose kinase "XylB" (encoded by gene CA_C2612, SEQ ID NO: 5), a gene encoding a permease involved in xylose import, for example, the protein "AraE1" (encoded by gene CA_C1339, SEQ ID NO: 6), a "XylT" protein (encoded by gene CA_C1345, SEQ ID NO: 7) or a "XynT" protein (encoded by gene CA_C3451, SEQ ID NO: 8). 8), and a gene encoding a 1,4-β-D-xylosidase "XynB" (encoded by gene CA_C3452, SEQ ID NO: 9).

[0043] The term "xylR gene" also refers to a variant nucleotide sequence encoding a protein capable of binding, in particular, to the promoter (SEQ ID NO: 10) of the "xylA" gene (CA_C2610, SEQ ID NO: 4), the promoter (SEQ ID NO: 11) of the "xylB" gene (CA_C2612, SEQ ID NO: 5), or an XBS (XylR binding site) operator sequence selected from SEQ ID NO: 12 and SEQ ID NO: 13. The protein encoded by the variant nucleotide sequence is preferably capable of recognizing an XBS (XylR binding site) sequence (e.g., SEQ ID NO: 12 or SEQ ID NO: 13) and / or is capable of inhibiting, reducing or preventing the expression of the gene.

[0044] In a specific embodiment, the term "xylR gene" also refers to a sequence encoding a functional fragment or variant of the XylR protein, in particular a sequence encoding a functional fragment or variant of a protein that is capable of inhibiting, reducing or preventing (or participating in the inhibition of) the expression of an enzyme of the xylose assimilation pathway as described above, for example in the presence of xylose.

[0045] The term "araR gene" also refers to a sequence encoding a functional fragment or variant of the AraR protein, in particular a sequence encoding a protein that can, for example, in the absence of arabinose, inhibit, reduce or prevent (or participate in the inhibition of) the expression of an enzyme in the xylose assimilation pathway or the arabinose assimilation pathway, in particular a functional fragment or variant of the protein that can partially prevent the assimilation of xylose or arabinose.

[0046] The term "araR gene" also refers to a sequence capable of inhibiting, reducing or preventing transcription of at least one gene selected from the following, for example, in the absence of arabinose: a gene encoding a transporter or putative transporter of arabinose "XylA", such as "AraE1" (encoded by gene CA_C1339, SEQ ID NO: 6) or "XylT" (encoded by gene CA_C1345, SEQ ID NO: 7); a gene encoding an L-arabinose isomerase, such as "AraA1" (encoded by gene CA_C1342, SEQ ID NO: 14) or "AraA2" (encoded by gene CA_C1346, SEQ ID NO: 15); a gene encoding a ribulose kinase "AraK" (encoded by gene CA_C1344, SEQ ID NO: 16); a gene encoding an L-ribulose-5-phosphate 4-epimerase "AraD" (encoded by gene CA_C1341, SEQ ID NO: 17); a gene encoding an arabinofuranosidase "Arb43" (encoded by gene CA_C1529, SEQ ID NO: 18); a gene encoding an arabinoside transporter "AraT" (encoded by gene CA_C1530, SEQ ID NO: 19); and an xfp gene encoding a phosphoketolase (CA_C1343, SEQ ID NO: 20).

[0047] The term "araR gene" also refers to a variant nucleotide sequence encoding a protein capable of binding to the promoter of, in particular, an "ara" gene (e.g., "araE1", "araA1", "araA2", "araK" or "araD"), for example a sequence selected from SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23 and SEQ ID NO: 24, or an "ABS" (AraR binding site) operator sequence, for example selected from SEQ ID NO: 25, SEQ ID NO: 26 and SEQ ID NO: 27. The protein encoded by the variant nucleotide sequence is preferably capable of recognizing an ABS (AraR binding site) sequence (e.g., SEQ ID NO: 25 or SEQ ID NO: 26) and / or is capable of inhibiting, reducing or preventing the expression of one or more of the genes encoding enzymes involved in the arabinose assimilation pathway.

[0048] In a specific embodiment, the term "araR gene" also refers to a sequence encoding a functional fragment or variant of the AraR protein, in particular a sequence encoding a functional fragment or variant of a protein that is capable of inhibiting, reducing or preventing (or participating in the inhibition of) the expression of an enzyme as described above in the xylose assimilation pathway or the arabinose assimilation pathway, for example in the presence of arabinose.

[0049] When referring herein to a genetically modified bacterium belonging to the genus Clostridium, characterized in that it does not express the xylR and / or araR gene product, or expresses a non-functional form thereof, the expression "non-functional form of the xylR or araR gene product" means a protein, typically a protein identified herein as "XylR" or "AraR", which is non-functional, i.e., it is unable to perform the function of the protein encoded by the wild-type version of the gene in question. For the product of the xylR gene, the non-functional form of the product means a protein that is unable to inhibit, reduce or prevent the expression of an enzyme of the xylose and / or arabinose assimilation pathway, such as a protein that is unable to inhibit, reduce or prevent the transcription of at least one gene selected from the following: a gene encoding a xylose isomerase "XylA", a gene encoding a xylulokinase "XylB", a gene encoding a permease involved in xylose import, such as the protein "AraE1", the protein "XylT" or the protein "XynT" and a gene encoding a 1, 4-β-D-xylosidase "XynB".

[0050] For the araR gene product, the non-functional form of the product refers to a protein that cannot inhibit, reduce or prevent the expression of enzymes of the xylose assimilation pathway and / or the arabinose assimilation pathway, in particular a protein that can partially prevent xylose assimilation. Therefore, the protein cannot inhibit, reduce or prevent the transcription of at least one gene selected from the following: a gene encoding an arabinose "XylA" transporter or a putative transporter such as "AraE1" or "XylT"; a gene encoding an L-arabinose isomerase such as "AraA1" or "AraA2"; a gene encoding a ribulose kinase "AraK"; a gene encoding an L-ribulose-5-phosphate 4-epimerase "AraD"; a gene encoding an arabinofuranosidase "Arb43"; a gene encoding an arabinoside transporter "AraT"; and an xfp gene encoding a phosphoketolase.

[0051] The term "clostridial bacteria" refers in particular to Clostridial species of industrial interest, typically solventogenic or acetogenic bacteria of the genus Clostridium. The term "clostridial bacteria" includes wild-type bacteria as well as strains derived therefrom, genetically modified to improve their properties.

[0052] The term "Clostridium species of industrial interest" or "Clostridium bacteria of industrial interest" refers to a species that is capable of producing by fermentation a solvent (e.g., ethanol, butanol, acetone or isopropanol) and / or an acid (e.g., butyric acid or acetic acid) from a sugar or ose, typically from a sugar containing 5 carbon atoms (e.g., xylose, arabinose or fructose), from a sugar containing 6 carbon atoms (e.g., glucose or mannose), from a polysaccharide or polysaccharide (e.g., cellulose or hemicellulose) and / or from any other carbon source that can be assimilated and utilized by the Clostridium bacteria (e.g., CO, CO2 and methanol). Examples of solventogenic bacteria of interest are bacteria of the genus Clostridium that produce acetone, butanol, ethanol and / or isopropanol, such as the strains identified in the literature as "ABE strain" [a strain that performs fermentations allowing the production of acetone, butanol and ethanol], "IBE strain" [a strain that performs fermentations allowing the production of isopropanol (by reduction of acetone), butanol and ethanol] and "AIBE strain" [a strain that performs fermentations allowing the production of acetone, isopropanol, butanol and ethanol]. The solvent producing bacteria of the genus Clostridium can be selected from, for example, but not limited to, Clostridium acetobutylicum, Clostridium cellulolyticum, Clostridium phytofermentans, Clostridium beijerinckii, Clostridium saccharobutylicum, Clostridium saccharoperbutylacetonicum, Clostridium sporogenes, Clostridium butyricum, Clostridium aurantibutyricum and Clostridium tyrobutyricum, preferably selected from Clostridium acetobutylicum, Clostridium beijerinckii, Clostridium butyricum, Clostridium tyrobutyricum and Clostridium cellulolyticum, and even more preferably selected from Clostridium acetobutylicum and Clostridium beijerinckii. The most preferred solvent producing bacteria is Clostridium acetobutylicum.

[0053] Acetogenic bacteria of interest are bacteria that produce acids and / or solvents from CO and H. Acetogenic bacteria of the genus Clostridium may, for example, be selected from C. aceticum, C. thermoaceticum, C. ljungdahlii, C. autoethanogenum, C. difficile, C. scatologenes, and C. carboxidivorans.

[0054] In a particular embodiment, the bacterium of the genus Clostridium concerned is an "ABE strain", preferably a strain of Clostridium acetobutylicum, for example, Clostridium acetobutylicum strain DSM 792 (also known as ATCC 824 or LMG 5710).

[0055] In another specific embodiment, the bacterium of the genus Clostridium involved is an "ABE strain", preferably Clostridium beijerinckii, such as the NCIMB 8052 strain of Clostridium beijerinckii.

[0056] In another specific embodiment, the bacterium of the genus Clostridium concerned is an "IBE strain", preferably a subclade of Clostridium beijerinckii selected from DSM6423, LMG 7814, LMG 7815, NRRL B-593 and NCCB 27006.

[0057] Thus, according to a preferred embodiment, the bacterium belonging to the genus Clostridium according to the invention is an industrially interesting Clostridium bacterium, in particular a solventogenic bacterium, which in the wild-type state is capable of producing solvents and / or acids by fermentation from a carbon source selected from, for example, sugars, CO, CO2, alcohols and organic acids. In a particularly preferred embodiment, the carbon source is a sugar, in particular a sugar containing 5 carbon atoms such as xylose or arabinose, a sugar containing 6 carbon atoms such as glucose, fructose or mannose, or a polysaccharide or polysaccharide glycoside such as cellulose or hemicellulose.

[0058] Particularly preferred bacteria according to the present invention are Clostridium bacteria capable of simultaneously fermenting at least one hexose and one pentose. Particularly preferred bacteria according to the present invention are Clostridium bacteria capable of simultaneously fermenting carbon-based elements of substrates comprising at least two carbon-based elements, the carbon-based elements being selected from glucose, arabinose, xylose, mannose and galactose, preferably selected from glucose, arabinose and xylose.

[0059] Thus, a person skilled in the art can easily verify whether the Clostridium bacterium is a bacterium according to the invention (e.g. according to the method taught by Grimmler et al., 2010) by culturing the bacterium on a substrate comprising several carbon sources: if the bacterium ferments / assimilates at least two different carbon sources simultaneously (relative to continuous fermentation / assimilation, i.e. one after the other), it is a bacterium according to the invention. Thus, in the presence of a substrate comprising glucose, arabinose and xylose, a wild-type Clostridium bacterium first ferments glucose, then arabinose and then xylose. In contrast, the bacterium according to the invention is capable of simultaneously fermenting / assimilating (i.e. at the same time) at least two of the three sugars present in the substrate, i.e. glucose and arabinose in the example provided (xylose is assimilated in the second stage).

[0060] Another simple way to easily verify whether a Clostridium bacterium is a bacterium according to the present invention includes measuring the growth rate of the bacterium. On a culture medium containing xylose as the sole carbon source, it is observed that the bacteria grow faster than bacteria expressing a functional AraR protein or a mixture of functional XylR and AraR proteins will be considered to be bacteria obtained by the method of the process according to the present invention (comprising the deletion or inactivation of the xylR and araR genes to prevent or reduce the expression of functional XylR and AraR proteins). In practice, on a culture medium containing xylose as the sole carbon source, a person skilled in the art believes that wild-type Clostridium bacteria have a maximum growth rate of about 0.10 to about 0.25; preferably about 0.15 (Servinskyet al., 2010). The inventors have observed that on such a culture medium, the modified bacteria according to the present invention have a maximum growth rate of about 0.45 to about 0.60; preferably greater than about 0.50. Another method of verifying whether a Clostridium is a bacterium according to the invention comprises sequencing the CA_C1340, CA_C2613 and CA_C3673 loci and checking whether they have been modified relative to their wild-type forms to prevent or reduce the expression of functional XylR and AraR proteins.

[0061] Particularly preferred bacteria belong to the species Clostridium acetobutylicum and, as described above, do not express the gene product of the sequence SEQ ID NO: 1 (CA_C2613) or a sequence at least 95%, such as at least 96%, at least 97% or at least 98% homologous thereto, SEQ ID NO: 2 (CA_C3673) or a sequence at least 95%, such as at least 96%, at least 97% or at least 98% homologous thereto and SEQ ID NO: 3 (CA_C1340) or a sequence at least 95%, such as at least 96%, at least 97% or at least 98% homologous thereto, or express a non-functional form of said expression product.

[0062] This particularly preferred bacterium has the above-mentioned technical ability, ie it is able to ferment / assimilate at least two different carbon sources simultaneously and grows faster on a medium comprising xylose as the sole carbon source than bacteria expressing a functional AraR protein or a mixture of functional XylR and AraR proteins.

[0063] This strain is characterized for the first time in the context of the present patent application.

[0064] The strain was registered at the BCCM-LMG Collection on June 13, 2022, with the collection number LMG P-32703. In this strain, the xylR and araR genes have been (co-) inactivated. The specification also relates to any bacteria derived therefrom, their clones, mutants or genetically modified forms, which generally do not contain the xylR and araR genes, or wherein the genes are also inactivated.

[0065] Another subject of the present invention is the simultaneous fermentation of two different carbon sources, for example at least one hexose and one pentose, or even a carbon element of a substrate comprising at least two carbon elements selected from glucose, arabinose, xylose, mannose and galactose, using the bacteria according to the invention. In a particular embodiment, the bacteria according to the invention are capable of, for example, simultaneously fermenting glucose and arabinose, glucose and xylose, glucose and mannose, glucose and galactose, arabinose and xylose, arabinose and mannose, arabinose and galactose, xylose and mannose, xylose and galactose or mannose and galactose.

[0066] In a particularly preferred embodiment, the bacterium according to the invention is capable of fermenting a substrate comprising at least two sugars selected from the group consisting of glucose, arabinose and xylose, such as glucose and arabinose, glucose and xylose or arabinose and xylose.

[0067] The genetically modified bacteria according to the invention can advantageously be used for the production of solvents (eg biofuels) or mixtures of solvents (eg biofuel mixtures), in particular on an industrial scale.

[0068] The invention also relates to a fermentation process, typically an industrial process, involving the use of the bacteria according to the invention.

[0069] By virtue of the present invention, the use of second generation ("2G") substrates, in particular lignocellulose, is now greatly facilitated. The present invention provides a welcome solution that allows reducing the tension between the energy and food sectors.

[0070] The genetically modified bacteria according to the invention can also advantageously be used to produce sugars or bio-based molecules from biomass, in particular lignocellulosic biomass, or from dedicated energy crops.

[0071] In the context of the present invention, the term "biobased molecules" refers to molecules characterized in that the starting materials for their production must be derived from plant biomass, preferably lignocellulosic biomass, and not from resources of fossil origin, such as oil, coal or natural gas.

[0072] Non-limiting examples of lignocellulosic biomass include, for example, agricultural residues (particularly straw waste, corn cobs, bagasse, etc.), but also forestry residues, sawmill residues (typically wood chips), or any other type of woody residue.

[0073] Cellulosic biomass can also be the product of specific dedicated crops, such as energy crops, for example, dedicated to the cultivation of annual plants ("whole plant" use, such as wheat or corn). It can also be, for example, perennial fodder plant crops (such as fescue, cocksfoot, ryegrass), herbaceous plant crops (such as miscanthus or switchgrass) or shrub crops (short-term or very short-term coppice, such as willow, poplar, chestnut or eucalyptus).

[0074] Another biomass that can be used in the context of the present invention may be a 1G substrate derived from sugar-producing plants such as sugar cane or sugar beet, cereal plants such as corn or wheat, and / or oil-producing plants such as soybean, rapeseed or palm.

[0075] The present invention also relates to a method for producing a recombinant bacterium according to the present invention, which comprises deleting or inactivating the xylR and araR genes, thereby preventing or reducing the expression of functional XylR and AraR proteins.

[0076] The best performing modification methods known for obtaining genetically modified strains are based on homologous recombination events, which allow the modification of the genome in a precise and stable manner.

[0077] A particular production method according to the invention comprises the step of transforming the bacteria by introducing into said bacteria the nucleic acid of interest.

[0078] For the purposes of the present invention, the term "nucleic acid" refers to any natural, synthetic, semisynthetic or recombinant DNA or RNA molecule that may be chemically modified (i.e., contain non-natural bases, modified nucleotides, including, for example, modified bonds, modified bases and / or modified sugars) or optimized so that the codons of the transcript synthesized from the coding sequence are the most common codons in Clostridium bacteria for use therein. For Clostridium, the optimized codons are typically codons rich in adenine ("A") and thymine ("T") bases.

[0079] In the peptide sequences described herein, the amino acids are represented by their single-letter codes according to the following nomenclature: C: cysteine; D: aspartic acid; E: glutamic acid; F: phenylalanine; G: glycine; H: histidine; I: isoleucine; K: lysine; L: leucine; M: methionine; N: asparagine; P: proline; Q: glutamine; R: arginine; S: serine; T: threonine; V: valine; W: tryptophan and Y: tyrosine.

[0080] In the specific embodiment described, the nucleic acid of interest comprises at least two regions each complementary to a target sequence, and the target sequence is at least 100% identical or at least 80% identical, preferably at least 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to the targeted DNA region / part / sequence in the bacterial genome. These regions are capable of hybridizing with all or part of a sequence complementary to the region / part / sequence, typically with a sequence hybridizing comprising at least 1 nucleotide, preferably at least 100 nucleotides, typically between 100 and 1000 nucleotides as described above. The complementary region of the target sequence present in the nucleic acid of interest can be identified in genetic modification tools known to those skilled in the art (typically any tool based on homologous recombination) and preferably targets the 5' and 3' flanking regions of the targeted sequence.

[0081] In a particularly preferred embodiment, a portion of the nucleic acid of interest also recognizes (at least partially binds) and preferably targets, i.e. recognizes and allows cleavage of at least one strand of i) a target sequence, ii) a sequence controlling transcription of the target sequence, or iii) a sequence flanking the target sequence in the genome of the Clostridium bacterium of interest. The recognized sequence is also identified herein as a "target sequence" or "targeted sequence".

[0082] In this same preferred specific embodiment, the nucleic acid of interest comprises at least one region complementary to the target sequence, which region is at least 100% identical or at least 80% identical, preferably at least 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to the targeted DNA region / part / sequence within the bacterial genome, and is capable of hybridizing to all or part of the sequence complementary to said region / part / sequence, typically to a sequence comprising at least 5 nucleotides, preferably at least 5, 10, 14, 15, 20, 25, 30, 35 or 40 nucleotides, typically between 15 and 30 nucleotides, preferably to a sequence comprising 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides.

[0083] The nucleic acids of interest described in the context of the present invention are capable of deleting said target sequences from the bacterial genome or modifying their expression, e.g. regulating / modulating them, in particular inhibiting them, preferably modifying them so that said bacterium is unable to express one or more proteins, in particular one or more functional proteins, from said sequences.

[0084] "Nucleic acid of interest", typically an expression cassette or vector, can be constructed via conventional techniques well known to those skilled in the art, and can include one or more promoters, bacterial origins of replication (ORI sequences), termination sequences, selection genes (e.g., antibiotic resistance genes), and sequences ("flanking regions") that can be targeted for insertion into the cassette or vector. The ORI sequence of interest can be selected, for example, from pIP404, pAMβ1, repH (origin of replication in Clostridium acetobutylicum), ColE1 or rep (origin of replication in Escherichia coli), or any other origin of replication that enables the vector (typically a plasmid) to be maintained in a bacterial cell belonging to the genus Clostridium. The termination sequence of interest can be selected, for example, from ad and thl genes, bcs operon, or any other terminator known to those skilled in the art, which can terminate transcription in a bacterial cell belonging to the genus Clostridium. The selection gene of interest (resistance gene) can be selected from ermB, catP, bla, tetA, tetM, and / or any other gene that is resistant to ampicillin, erythromycin, chloramphenicol, thiamphenicol, spectinomycin, tetracycline, or any other antibiotic well known to those skilled in the art, which can be used to select bacteria of the genus Clostridium.

[0085] The nucleic acid of interest can be natural or synthetic RNA, or produced via recombinant technology. The nucleic acid of interest can be prepared via any method known to those skilled in the art, such as chemical synthesis, in vivo transcription or amplification technology. When the nucleic acid of interest is directly introduced into the cell in the form of RNA molecules (mature or precursor) such as guide RNA (gRNA), these molecules can contain modified nucleotides or chemical modifications, so as to allow them to, for example, increase resistance to nucleases and thus increase their lifespan in the cell. They can especially include at least one modified or non-natural nucleotide, such as nucleotides comprising modified bases, such as inosine, methyl-5-deoxycytidine, dimethylamino-5-deoxyuridine, deoxyuridine, diamino-2, 6-purine, bromo-5-deoxyuridine or any other modified bases allowing hybridization.

[0086] The nucleic acids of interest used according to the invention may also be modified at the level of the internucleotide bonds, such as, for example, phosphorothioates, H-phosphonates or alkylphosphonates, or at the backbone level, such as, for example, α-oligonucleotides, 2'-O-alkylribose or PNA (peptide nucleic acid) (Egholm et al., 1992).

[0087] In the context of the present specification, specific examples of nucleic acids of interest for transformation and / or genetic modification of bacteria of interest are DNA fragments that i) recognize a coding sequence, ii) control the transcription of a coding sequence, or iii) flank a coding sequence, XylR repressor or AraR repressor.

[0088] In a preferred embodiment, the nucleic acid of interest is selected from plasmid pGRNA-ΔCA_C1340 of sequence SEQ ID NO: 28, plasmid pGRNA-ΔCA_C2613 of sequence SEQ ID NO: 29, or plasmid pGRNA-ΔCA_C3673 of sequence SEQ ID NO: 30.

[0089] The nucleic acids of particular interest described by the inventors are, for example, vectors, preferably plasmids, such as the plasmid pGRNA-ΔCA_C1340 of sequence SEQ ID NO: 28, the plasmid pGRNA-ΔCA_C2613 of sequence SEQ ID NO: 29, or the plasmid pGRNA-ΔCA_C3673 of sequence SEQ ID NO: 30 described in the experimental part of this specification.

[0090] The recognized sequence (target sequence) or one of the recognized sequences is preferably one of the sequences SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3 corresponding to the xylR and araR genes encoding the XylR protein and the AraR protein, respectively, or is an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90% or 95% identical to the protein, or is a sequence comprising all or at least 95%, 96%, 97%, 98% or 99% of the sequence SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3. In other words, the recognized sequence can be a sequence comprising at least 1 nucleotide, preferably at least 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35 or 40 nucleotides, typically between 1 and 40 nucleotides, preferably a sequence comprising 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides of the sequence SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3.

[0091] According to another specific example, the target sequence can also be a sequence that controls the transcription of a coding sequence as described above, typically a promoter sequence, such as the promoter sequence (SEQ ID NO: 10) of the "XylA" gene (CA_C2610, SEQ ID NO: 4), or the promoter sequence (SEQ ID NO: 11) of the "XylB" gene (CA_C2612, SEQ ID NO: 5). Then, the nucleic acid of interest recognizes and is therefore typically able to bind to a sequence that controls the transcription of a coding sequence as described above.

[0092] According to another specific example, the target sequence can be a sequence flanking a coding sequence as described above, for example, a sequence flanking a sequence of SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3, or a sequence at least 70% identical thereto. Such flanking sequences generally comprise 1, 10 or 20 and 1000 nucleotides, for example, 1, 10 or 20 to 900, 800, 700, 600, 500, 400, 300 or 200 nucleotides, 1, 10 or 20 to 100 nucleotides, 1, 10 or 20 to 50 nucleotides, or 1, 10 or 20 to 40 nucleotides, for example, 10 to 40 nucleotides, 10 to 30 nucleotides, 10 to 20 nucleotides, 20 to 30 nucleotides, 15 to 40 nucleotides, 15 to 30 nucleotides or 15 to 20 nucleotides.

[0093] According to a particular aspect, the target sequence corresponds to a pair of sequences flanking such a coding sequence, each flanking sequence usually comprising at least 20 nucleotides, usually between 100 and 1000 nucleotides, preferably between 200 and 800 nucleotides.

[0094] Preferably, the method for producing a recombinant bacterium according to the invention involves transforming a bacterial cell with at least one nucleic acid of interest (e.g. two or three nucleic acids of interest as described above) which is capable of i) recognizing (and at least partially binding to) a sequence encoding a XylR repressor, a sequence controlling the transcription of a sequence encoding a XylR repressor, or a sequence flanking a sequence encoding a XylR repressor, and ii) recognizing (and at least partially binding to) a sequence encoding an AraR repressor, a sequence controlling the transcription of a sequence encoding an AraR repressor, or a sequence flanking a sequence encoding an AraR repressor.

[0095] As explained above, sequences encoding a XylR repressor or an AraR repressor, sequences controlling the transcription of a sequence encoding a XylR repressor or an AraR repressor, or sequences flanking a sequence encoding a XylR repressor or an AraR repressor are also identified herein as "target sequences" or "targeted sequences".

[0096] The nucleic acid of interest described in the context of the present invention is capable of deleting the target sequence from the bacterial genome or modifying its expression, e.g. regulating / modulating it, in particular inhibiting it, preferably modifying it in such a way that the bacterium is unable to express a protein (usually an AraR or XylR protein), in particular a functional protein, from the sequence. In a particularly preferred embodiment, the nucleic acid of interest is capable of modifying the bacterium so that it is unable to express one and / or the other of the AraR and XylR proteins.

[0097] Introduction of any nucleic acid of interest into bacteria can be performed by any direct or indirect method known to those skilled in the art, such as by transformation, conjugation, microinjection, transfection, electroporation, etc., preferably by electroporation (Mermelstein et al., 1993).

[0098] Furthermore, these nucleic acids of interest (eg, DNA fragments, RNA fragments, expression cassettes or expression vectors) can be incorporated into the bacterial genome via techniques well known to those skilled in the art.

[0099] In a specific embodiment, the method for transforming and preferably genetically modifying a bacterium as described herein comprises a step of transforming the bacterium by introducing into said bacterium a nucleic acid of interest according to the present invention as described above, and involves a genetic modification tool, for example selected from the group consisting of CRISPR tools, insertional mutagenesis tools, for example genetic modification tools based on the use of group II introns (e.g. the Targetron® tool or the ClosTron® tool) and allelic exchange tools (e.g. the ACE® tool).

[0100] The method for transforming and preferably also genetically modifying a Clostridium bacterium may also comprise the step of obtaining, recovering, selecting or isolating transformed bacteria (ie bacteria exhibiting the desired recombination / modification / optimization).

[0101] In a specific embodiment, the method according to the present invention is based on the use (implementation) of CRISPR (clustered regularly interspaced short palindromic repeats) technology / genetic tools, in particular CRISPR / Cas (CRISPR associated protein) genetic tools. The present invention can be carried out using conventional CRISPR / Cas genetic tools, which use a single plasmid containing nuclease, gRNA and repair template, as described in Wang et al. (2015). Those skilled in the art can easily define the sequence and structure of gRNA according to the chromosomal region to be targeted or the mobile genetic element using well-known techniques (see, for example, DiCarlo et al., 2013 article). The inventors have also developed and described genetic tools for bacterial modification, which are suitable for bacteria of the genus Clostridium, which can be used in the context of the present invention based on the use of two plasmids (cf. WO 2017 / 064439, Wasels et al., 2017).

[0102] In another embodiment, the method according to the invention is based on the use of insertional mutagenesis tools, such as the use of group II introns, and involves, for example, the ClosTron® technology / genetic tools or the Targetron® genetic tools.

[0103] The Targetron® technology is based on the use of a reprogrammable group II intron (based on the Lactococcus lactis intron Ll.ltrB), which can be rapidly incorporated into the bacterial genome at the desired locus (Chen et al., 2005, Wang et al., 2013), usually with the purpose of inactivating the targeted gene. The mechanism of recognition of the editing region and insertion into the genome by backsplicing is based on the homology between the intron and this region on the one hand, and on the activity of the protein (ltrA) on the other hand.

[0104] The ClosTron® technology is based on a similar approach, complemented by the addition of a selection marker within the intron sequence (Heap et al., 2007). This marker allows the integration of the intron into the genome to be selected, thus promoting the generation of the desired mutants. This genetic system also exploits group I introns. Specifically, the selection marker (a retrotransposition activation marker called RAM) is interrupted by a genetic element that prevents its expression from the plasmid (for a more precise description of the system: Zhong et al.). Splicing of this genetic element occurs prior to integration into the genome, allowing the generation of chromosomes with an active form of the resistance gene. An optimized version of this system contains FLP / FRT sites upstream and downstream of the gene, allowing the use of FRT recombinases to eliminate the resistance gene (Heap et al., 2010).

[0105] In another embodiment, the method according to the invention is based on the use of an allelic exchange tool and involves, for example, the ACE® technology / genetic tool.

[0106] The ACE® technology is based on the use of auxotrophic mutants (for uracil in Clostridium acetobutylicum ATCC 824, by deletion of the pyrE gene, which also confers resistance to 5-fluoroorotic acid (A-5-FO); Heap et al., 2012). The system uses the mechanism of allelic exchange well known to those skilled in the art. After transformation with a pseudo-suicide (very low copy) vector, the integration of the latter into the bacterial chromosome by a first allelic exchange event can be verified by the resistance gene initially present on the plasmid. The integration step can be performed in two different ways, either within the pyrE locus or within another locus. In the case of integration at the pyrE locus, the pyrE gene is also placed on the plasmid, but it is not expressed (no functional promoter). A second recombination restores the functional pyrE gene, which can then be selected by auxotrophy (minimal medium, without uracil). Since the non-functional pyrE gene also has selectable properties (sensitivity to A-5-FO), other integrations can be envisioned on the same model, alternating the state of pyrE between functional and non-functional in turn. In the case of integration into another locus, a genomic region that allows expression of a counterselectable marker after recombination is targeted (usually in an operon after another gene, preferably a highly expressed gene). This second recombination is then selected by auxotrophy (minimal medium without uracil).

[0107] In such embodiments based on the use of group II introns and involving, for example, ClosTron® technology / genetic tools or Targetron® genetic tools or based on the use of allelic exchange tools and involving, for example, ACE® technology / genetic tools, the targeted sequence is typically one of the sequences described herein.

[0108] In addition, the present invention also relates to a kit for transforming and / or genetically modifying bacteria of the genus Clostridium, comprising at least one nucleic acid of interest as described herein for transforming and preferably genetically modifying bacteria of the genus Clostridium (e.g., two nucleic acids of interest, typically DNA fragments, each recognizing a target sequence), and optionally one or more selection molecules. A specific kit comprises the elements necessary for operating a CRISPR tool (typically at least one nucleic acid that can be used as a gRNA, a nucleic acid that can be used as a repair template, at least one primer pair, and an inducer capable of expressing a Cas9 or MAD7 type nuclease), the elements necessary for operating a tool based on the use of a type II intron (typically at least one type II intron, at least one primer pair, and an inducer that allows reverse transcriptase (e.g., LtrA RT or Tel4c RT type) expression), or the elements necessary for operating an allelic exchange tool (typically at least two nucleic acids that can be used as homologous recombination templates and at least one primer pair).

[0109] The kit according to the invention may further comprise one or more consumables, such as culture medium, at least one competent bacterium of the genus Clostridium (ie, processed for transformation), or instructions.

[0110] The present invention generally relates to kits for carrying out the transformation and / or genetic modification methods described herein using bacteria of the genus Clostridium.

[0111] The present invention particularly relates to genetically modified bacteria belonging to the genus Clostridium, which have the essential characteristics of not expressing the xylR and araR gene products, or expressing them in non-functional form, and also to any derived bacteria, clones, mutants or genetically modified forms thereof and uses thereof.

[0112] The present patent application also describes strain IFP 967, which was registered on June 13, 2022 at the BCCM-LMG Collection with the accession number LMG P-32702, in which the araR gene has been inactivated, and any derived bacteria, clones, mutants or genetically modified forms thereof, generally do not contain the xylR and araR genes, or in which the genes are also inactivated.

[0113] The present patent application relates in particular to the use of genetically modified bacteria belonging to the genus Clostridium, characterized in that it does not express the xylR or araR gene product, or that it expresses a non-functional form of the xylR or araR gene, such as strain IFP 967, which was registered at the BCCM-LMG Collection Center on June 13, 2022 with the deposit number LMG P-32702, for the preparation of genetically modified bacteria according to the present invention that do not express the xylR or araR gene product, or express their non-functional form.

[0114] The present invention also relates to a kit for producing solvents, sugars or bio-based molecules using bacteria belonging to the genus Clostridium, comprising i) a genetically modified bacterium belonging to the genus Clostridium according to the present invention, such as IPF968, and ii) a culture medium, typically a storage medium or a culture medium for the bacteria. The kit may also include any instructions.

[0115] The storage medium or culture medium of the genetically modified bacteria (belonging to the genus Clostridium) according to the present invention present in the kit is preferably supplemented with a carbon source consisting of glucose and at least one pentose, preferably i) glucose and ii) arabinose and / or xylose. The medium preferably contains 0.1 to 250 g / L, more preferably 1 to 100 g / L of the carbon source (consisting of glucose and at least one pentose).

[0116] The storage medium or culture medium for the genetically modified bacteria is preferably an RCM type medium, more preferably a GAPES type medium, and even more preferably a CGM type medium.

[0117] The present invention also relates to a specific kit for producing a solvent or a biofuel, or a mixture of solvents or biofuels, by a bacterium belonging to the genus Clostridium, said kit comprising i) a bacterium (belonging to the genus Clostridium) genetically modified according to the invention, characterized in that it does not express the xylR and araR gene products, or that it expresses them in a non-functional form, and ii) a rich medium, preferably a RCM-type medium, more preferably a GAPES-type medium, even more preferably a CGM-type medium, containing at least glucose and a pentose, preferably arabinose and / or xylose.

[0118] Furthermore, the present invention also relates to the possible use of the method or the kit according to the invention for transforming and / or genetically modifying bacteria of the genus Clostridium, typically solvent-producing bacteria of the genus Clostridium, for example to generate improved variants of said bacteria.

[0119] Finally, the present invention relates to possible uses of the method, the kit or the transformed and preferably genetically modified bacteria of the genus Clostridium according to the invention, in particular allowing the production of solvents or biofuels or mixtures thereof, typically on an industrial scale.

[0120] The following examples and drawings are intended to more fully illustrate the present invention without limiting its scope. In particular, these examples show the production and characterization of bacteria according to the present invention, wherein araR and / or xylR genes are inactivated by CRISPR-Cas9 tools according to particularly preferred embodiments. The genes can be inactivated according to other specific embodiments well known to those skilled in the art, such as gene inactivation based on homologous recombination or insertional mutagenesis, as described above. BRIEF DESCRIPTION OF THE DRAWINGS

[0121] [ Figure 1 ] Figure 1 A map of plasmid pBANak is shown.

[0122] [ Figure 2 ] Figure 2 A map showing plasmid pGRNA_ΔCA_C1340

[0123] [ Figure 3 ] Figure 3 A map showing plasmid pGRNA_ΔCA_C2613

[0124] [ Figure 4 ] Figure 4 A map showing plasmid pGRNA_ΔCA_C3673

[0125] [ Figure 5 ] Figure 5 Growth kinetics on 30 mM xylose CGM medium are shown.

[0126] [ Figure 6 A] Figure 6 A shows the consumption kinetics of a mixture of glucose, arabinose and xylose in wild-type C. acetobutylicum strain DSM 792 on CGM medium containing 25 mM glucose, 25 mM arabinose and 70 mM xylose.

[0127] [ Figure 6 B] Figure 6 B shows the consumption kinetics of a mixture of glucose, arabinose and xylose in C. acetobutylicum strain DSM 792 ΔCA_C2613 ΔCA_C3673 on CGM medium containing 25 mM glucose, 25 mM arabinose and 70 mM xylose.

[0128] [ Figure 6 C] Figure 6 C shows the consumption kinetics of a mixture of glucose, arabinose and xylose in C. acetobutylicum strain DSM 792 ΔCA_C1340 on CGM medium containing 25 mM glucose, 25 mM arabinose and 70 mM xylose.

[0129] [ Figure 6 D] Figure 6 D shows the consumption kinetics of a mixture of glucose, arabinose and xylose in C. acetobutylicum strain DSM 792 ΔCA_C1340 ΔCA_C2613 ΔCA_C3673 on CGM medium containing 25 mM glucose, 25 mM arabinose and 70 mM xylose. Example

[0130] Example 1: Clostridium acetobutylicum strains ΔCA_C2613 ΔCA_C3673

[0131] Materials and methods

[0132] Culture conditions

[0133] Clostridium acetobutylicum DSM 792 was cultured in 2YTG medium (tryptone 16 g / L -1 , yeast extract 10 gL -1 , glucose 5 gL -1 , sodium chloride 4 gL -1 ) and CGM (KH2PO4, 0.75 g; K2HPO4, 0.75 g; MgSO4·7H2O, 0.40 g; MnSO4·H2O, 0.01 g; FeSO4·7H2O, 0.01 g; NaCl, 1.0 g; asparagine, 2.0 g; yeast extract, 5.0 g; (NH4)2SO4, 2.0 g; specified carbon sources). Escherichia coli NEB 10-β was cultured in LB medium (tryptone 10 gL-1 , yeast extract 5 gL -1 、NaCl 10 gL -1 ) were grown in . -1 Agarose is added to liquid medium to produce solid medium. Erythromycin (40 mg.L in 2YTG medium) is used as needed. -1 ), chloramphenicol (25 or 12.5 mg L in solid or liquid LB medium, respectively -1 ), thiamphenicol (15 mg / L in 2YTG medium -1 ).

[0134] Nucleic Acids and Plasmid Vectors

[0135] The list of primers used for all constructs (name / DNA sequence) is detailed below:

[0136] CA_C2613_LHA_Fwd: AAAAAAGAATTCATTTGTCCACTTATACCAATTCCT (SEQ ID NO:31)

[0137] CA_C2613_LHA_Rev:TCCTACTAGATACGGCGGAGTAAAATTAGT (SEQ ID NO: 32)

[0138] CA_C2613_RHA_Fwd:CTCCGCCGTATCTAGTAGGAATCTCCCACT (SEQ ID NO: 33)

[0139] CA_C2613_RHA_Rev:AAAAAAGTCGACAAAGAGAAAATAAGAGGAATACAAAAG (SEQ ID NO:34)

[0140] gRNA_CA_C2613_Fwd:TCATGTTACACTTGGAACAGGCGT (SEQ ID NO: 35)

[0141] gRNA_CA_C2613_Rev:AAACACGCCTGTCCAAGTGTAAC (SEQ ID NO: 36)

[0142] CA_C3673_LHA_Fwd: AAAAAAGGATCCAGAAAGACTTGTTACATCTCTAAGT (SEQ ID NO:37)

[0143] CA_C3673_LHA_Rev:TGATATAGACTTAATTGAACAAGATGTAATTTGAAATTAGT (SEQ IDNO: 38)

[0144] CA_C3673_RHA_Fwd:GTTCAATTAAGTCTATATCAAACATATCGCACCAACC (SEQ ID NO:39)

[0145] CA_C3673_RHA_Rev:AAAAAAGTCGACATGATAATGGGAAATATATAGGAACTTT (SEQ ID NO:40)

[0146] gRNA_CA_C3673_Fwd:TCATGGAGTAGCAAGTCCTACAGG (SEQ ID NO: 41)

[0147] gRNA_CA_C3673_Rev:AAACCCTGTAGAGCTTGCTACTCC (SEQ ID NO: 42)

[0148] CA_C2613_verif_Fwd:TCGGCAGCAAAAACTCCAGT (SEQ ID NO: 43)

[0149] CA_C2613_verif_Rev:GCAATTGCTGGCGGAATGAA (SEQ ID NO: 44)

[0150] CA_C3673_verif Fwd:TACTTCATACATATCTAACGCACTCT (SEQ ID NO: 45)

[0151] CA_C3673_verif Rev:AAAATAACTTCTACTATGAGACAAGCA (SEQ ID NO: 46)

[0152] Construct the following plasmid vector:

[0153] -Plasmid No. 1: pBANak (SEQ ID NO: 47)

[0154] It contains the p15A origin of replication, as well as the ampR and kanR genes, which allow for ampicillin and kanamycin resistance, respectively. It also contains an expression cassette for the Bacillus subtilis phi 3T I methyltransferase, which is required for methylation of the gene editing vector prior to transformation in Clostridium acetobutylicum.

[0155] -Plasmid No. 2: pGRNA_ΔCA_C2613 (SEQ ID NO: 29)

[0156] It contains pGRNA ind and has a guide RNA surrogate that provides CA_C2613 targeting (Oligo-20-mer obtained by hybridization of primers gRNA_CA_C2613_Fwd (SEQ ID NO: 35) and gRNA_CA_C2613_Rev (SEQ ID NO: 36) and is integrated into the plasmid via the "golden gate assembly" technique after digestion with BsaI. It also contains an editing template that allows the inactivation of CA_C2613. The editing template was constructed by cloning LHA and RHA fragments, which were amplified from Clostridium acetobutylicum DSM with primer pairs CA_C2613_LHA_Fwd (SEQ ID NO: 31) / CA_C2613_LHA_Rev (SEQ ID NO: 32) and CA_C2613_RHA_Fwd (SEQ ID NO: 33) / CA_C2613_RHA_Rev (SEQ ID NO: 34), respectively. The gDNA of 792 was obtained. The editing template was cloned between BamHI and SalI restriction sites.

[0157] -Plasmid No. 3: pGRNA_ΔCA_C3673 (SEQ ID NO: 30)

[0158] It contains pGRNA ind and has a guide RNA surrogate that provides CA_C3673 targeting (Oligo-20-mer obtained by hybridization of primers gRNA_CA_C3673_Fwd (SEQ ID NO: 41) and gRNA_CA_C3673_Rev (SEQ ID NO: 42) and integrated into the plasmid by golden gate assembly technology after digestion with BsaI. It also contains an editing template that allows inactivation of CA_C3673. The editing template was constructed by cloning LHA and RHA fragments, which were amplified from Clostridium acetobutylicum DSM with primer pairs CA_C3673_LHA_Fwd (SEQ ID NO: 37) / CA_C3673_LHA_Rev (SEQ ID NO: 38) and CA_C3673_RHA_Fwd (SEQ ID NO: 39) / CA_C3673_RHA_Rev (SEQ ID NO: 40), respectively. The gDNA of 792 was obtained. The editing template was cloned between BamHI and SalI restriction sites.

[0159] Transformation of Clostridium acetobutylicum strains

[0160] The plasmid prepared in the NEB 10-β strain was methylated by transformation into the NEB 10-β strain that also contained the pBANak plasmid. The extracted methylated plasmid was then used to transform the C. acetobutylicum strain. The transformation was performed according to the protocol described by Wasels et al. 2020.

[0161] Genetic editing of CA_C2613 (SEQ ID NO: 1) and CA_C3673 (SEQ ID NO: 2) genes

[0162] According to the protocol described by Wasels et al. 2020, inactivation of the CA_C2613 and CA_C3673 genes in the ΔCA_C2613-ΔCA_C3673 strain was performed by gene editing, using primer pairs CA_C2613_verif_Fwd(SEQID NO: 43) / CA_C2613_verif_Rev(SEQ ID NO: 44); CA_C3673_verif_Fwd(SEQ ID NO: 45) / CA_C3673_verif_Rev(SEQ ID NO: 46) for editing verification, respectively. The use of other genetic tools, such as those based on homologous recombination or the insertion of mobile genetic elements, can provide mutants with equivalent genotypes, i.e., no longer expressing the products of the CA_C2613 and CA_C3673 genes, or expressing their non-functional forms.

[0163] result

[0164] Determination of growth kinetics and generation time

[0165] The growth of wild-type C. acetobutylicum DSM 792 and ΔCA_C2613 ΔCA_C3673 strains was monitored in quintuplicate on CGM medium containing 30 mM xylose ( Figure 5 ).

[0166] The results revealed an improvement in generation time when grown on xylose as carbon source. Furthermore, the combined inactivation of the CA_C2613 and CA_C3673 genes allowed a 33% improvement in generation time relative to the wild-type strain.

[0167] Monitoring consumption of sugar mixtures

[0168] Sugar mixture consumption monitoring was performed in technical triplicates with wild-type C. acetobutylicum DSM 792 and ΔCA_C2613 ΔCA_C3673 strains on CGM medium containing 25 mM glucose, 25 mM arabinose, and 70 mM xylose ( Figure 6 ).

[0169] The results showed that the combined inactivation of CA_C2613 and CA_C3673 showed no significant phenotypic changes relative to the wild-type strain.

[0170] Example 2: Strain IFP 967 (LMG P-32702), Clostridium acetobutylicum ΔCA_C1340

[0171] Materials and methods

[0172] Growing conditions

[0173] Clostridium acetobutylicum DSM 792 was cultured in 2YTG medium (tryptone 16 g / L -1 , yeast extract 10 gL -1 , glucose 5 gL -1 , sodium chloride 4 gL -1 ) and CGM (KH2PO4, 0.75 g; K2HPO4, 0.75 g; MgSO4·7H2O, 0.40 g; MnSO4·H2O, 0.01 g; FeSO4·7H2O, 0.01 g; NaCl, 1.0 g; asparagine, 2.0 g; yeast extract, 5.0 g; (NH4)2SO4, 2.0 g; specified carbon sources). Escherichia coli NEB 10-β was grown in LB medium (tryptone 10 gL -1 , yeast extract 5 gL -1 、NaCl 10 gL -1 ) were grown in . -1 Agarose is added to liquid medium to produce solid medium. Erythromycin (40 mg.L in 2YTG medium) is used as needed. -1 ), chloramphenicol (25 or 12.5 mg L in solid or liquid LB medium, respectively -1 ), thiamphenicol (15 mg / L in 2YTG medium -1 ).

[0174] Nucleic Acids and Plasmid Vectors

[0175] The list of primers used for all constructs (name / DNA sequence) is detailed below:

[0176] CA_C1340_LHA_Fwd:AAAAAAGGATCCACCAGAAAAACCAACGCCTAGTA (SEQ ID NO: 48)

[0177] CA_C1340_LHA_Rev:AGAAGTAGAAGAATTAAAATTGAAATAATTTATTTAGTCCCTTGCC (SEQID NO: 49)

[0178] CA_C1340_RHA_Fwd:TTTCAATTTTAATTCTTCTACTTCTTCATATTTGTGCT (SEQ ID NO:50)

[0179] CA_C1340_RHA_Rev:AAAAAAGTCGACTAATTACTCATTACATACGTTATTTTTCAGT (SEQ IDNO: 51)

[0180] gRNA_CA_C1340_Fwd:TCATTTTAAGGTCGATGATTCACA (SEQ ID NO: 52)

[0181] gRNA_CA_C1340_Rev:AAACTGTGAATCATCGACCTTAAA (SEQ ID NO: 53)

[0182] CA_C1340_verif_Fwd:CCTACCAATAGCATCGCCCAAGA (SEQ ID NO: 54)

[0183] CA_C1340_verif_Rev:TTCTAGCATAAAATACTCCTCCCTA (SEQ ID NO: 55)

[0184] Construct the following plasmid vector:

[0185] -Plasmid No. 1: pBANak (SEQ ID NO: 47)

[0186] It contains the p15A origin of replication, as well as the ampR and kanR genes, which allow for ampicillin and kanamycin resistance, respectively. It also contains an expression cassette for the Bacillus subtilis phi 3T I methyltransferase, which is required for methylation of the gene editing vector prior to transformation in Clostridium acetobutylicum.

[0187] -Plasmid No. 4: pGRNA_ΔCA_C1340 (SEQ ID NO: 28)

[0188] It contains pGRNA ind 2020) and has a guide RNA alternative that provides CA_C1340 targeting (Oligo-20-mer obtained by hybridization of primers gRNA_CA_C1340_Fwd (SEQ ID NO: 52) and gRNA_CA_C1340_Rev (SEQ ID NO: 53) and integrated into the plasmid via the “golden gate assembly” technique after digestion with BsaI. It also contains an editing template that allows the inactivation of CA_C1340. The editing template was constructed by cloning LHA and RHA fragments, which were constructed by using primer pairs CA_C1340_LHA_Fwd (SEQ ID NO: 48) / CA_C1340_LHA_Rev (SEQ ID NO: 49) and CA_C1340_RHA_Fwd (SEQ ID NO: 50) / CA_C1340_RHA_Rev (SEQ ID NO: 51) Amplify gDNA from Clostridium acetobutylicum DSM 792. The editing template is cloned between the BamHI and SalI restriction sites.

[0189] Transformation of Clostridium acetobutylicum strains

[0190] The plasmid prepared in the NEB 10-β strain was methylated by transformation into the NEB 10-β strain that also contained the pBANak plasmid. The extracted methylated plasmid was then used to transform the C. acetobutylicum strain. The transformation was performed according to the protocol described by Wasels et al. 2020.

[0191] Genetic editing of CA_C1340 gene (SEQ ID NO: 3):

[0192] Inactivation of the CA_C1340 gene in the ΔCA_C1340 strain was performed by gene editing according to the protocol described by Wasels et al. 2020, using the primer pair CA_C1340_verif_Fwd (SEQ ID NO: 54) / CA_C1340_verif_Rev (SEQ ID NO: 55), respectively, during editing verification. The use of other genetic tools, such as those based on homologous recombination or the insertion of mobile genetic elements, can provide mutants with an equivalent genotype, i.e., no longer expressing the CA_C1340 gene product or expressing its non-functional form.

[0193] result

[0194] Determination of growth kinetics and generation time

[0195] The growth of wild-type C. acetobutylicum DSM 792 and ΔCA_C1340 strains was monitored in quintuplicate on CGM medium containing 30 mM xylose ( Figure 5 ).

[0196] The results revealed an improvement in the generation time when grown on xylose as carbon source. Furthermore, inactivation of the gene encoding the AraR repressor allowed an improvement of +152% in the generation time relative to the wild-type strain.

[0197] Monitoring consumption of sugar mixtures

[0198] Sugar mixture consumption monitoring was performed in technical triplicate with wild-type C. acetobutylicum DSM 792 and ΔCA_C1340 strains on CGM medium containing 25 mM glucose, 25 mM arabinose and 70 mM xylose ( Figure 6 ).

[0199] The results showed that inactivation of CA_C1340 provided faster kinetics of arabinose consumption than that observed in the wild-type strain in the presence of glucose.

[0200] Example 3: strain IFP 968 (LMG P-32703), Clostridium acetobutylicum ΔCA_C1340-ΔCA_C2613-Δ CA_C3673

[0201] Materials and methods

[0202] Growing conditions

[0203] Clostridium acetobutylicum DSM 792 was cultured in 2YTG medium (tryptone 16 g / L -1 , yeast extract 10 gL -1 , glucose 5 gL -1 , sodium chloride 4 gL -1 ) and CGM (KH2PO4, 0.75 g; K2HPO4, 0.75 g; MgSO4·7H2O, 0.40 g; MnSO4·H2O, 0.01 g; FeSO4·7H2O, 0.01 g; NaCl, 1.0 g; asparagine, 2.0 g; yeast extract, 5.0 g; (NH4)2SO4, 2.0 g; specified carbon sources). Escherichia coli NEB 10-β was grown in LB medium (tryptone 10 gL -1 , yeast extract 5 gL -1 、NaCl 10 gL -1 ) were grown in . -1 Agarose is added to liquid medium to produce solid medium. Erythromycin (40 mg.L in 2YTG medium) is used as needed. -1), chloramphenicol (25 or 12.5 mg L in solid or liquid LB medium, respectively -1 ), thiamphenicol (15 mg / L in 2YTG medium -1 ).

[0204] Nucleic Acids and Plasmid Vectors

[0205] The list of primers used for all constructs (name / DNA sequence) is detailed below:

[0206] CA_C1340_LHA_Fwd:AAAAAAGGATCCACCAGAAAAACCAACGCCTAGTA (SEQ ID NO: 48)

[0207] CA_C1340_LHA_Rev:AGAAGTAGAAGAATTAAAATTGAAATAATTTATTTAGTCCCTTGCC (SEQID NO: 49)

[0208] CA_C1340_RHA_Fwd:TTTCAATTTTAATTCTTCTACTTCTTCATATTTGTGCT (SEQ ID NO:50)

[0209] CA_C1340_RHA_Rev:AAAAAAGTCGACTAATTACTCATTACATACGTTATTTTTCAGT (SEQ IDNO: 51)

[0210] gRNA_CA_C1340_Fwd:TCATTTTAAGGTCGATGATTCACA (SEQ ID NO: 52)

[0211] gRNA_CA_C1340_Rev:AAACTGTGAATCATCGACCTTAAA (SEQ ID NO: 53)

[0212] CA_C1340_verif_Fwd:CCTACCAATAGCATCGCCCAAGA (SEQ ID NO: 54)

[0213] CA_C1340_verif_Rev:TTCTAGCATAAAATACTCCTCCCTA (SEQ ID NO: 55)

[0214] CA_C2613_LHA_Fwd: AAAAAAGAATTCATTTGTCCACTTATACCAATTCCT (SEQ ID NO:31)

[0215] CA_C2613_LHA_Rev:TCCTACTAGATACGGCGGAGTAAAATTAGT (SEQ ID NO: 32)

[0216] CA_C2613_RHA_Fwd:CTCCGCCGTATCTAGTAGGAATCTCCCACT (SEQ ID NO: 33)

[0217] CA_C2613_RHA_Rev:AAAAAAGTCGCAAGAAAATAAGGATACAAAAG (SEQ ID NO:34)

[0218] gRNA_CA_C2613_Fwd:TCATGTTACACTTGGAACAGGCGT (SEQ ID NO: 35)

[0219] gRNA_CA_C2613_Rev:AAACACGCCTGTTCCAAGTGTAAC (SEQ ID NO: 36)

[0220] CA_C2613_verif_Fwd:TCGGCAGCAAAAACTCCAGT (SEQ ID NO: 42)

[0221] CA_C2613_verif_Rev:GCAATTGCTGGCGGAATGAA (SEQ ID NO: 43)

[0222] CA_C3673_LHA_Fwd: AAAAAAGGATCCAGAAAGACTTGTTACATCTCTAAGT (SEQ ID NO:37)

[0223] CA_C3673_LHA_Rev:TGATATAGACTTAATGACAAGATGTAATTTGAATTAGT (SEQ IDNO: 38)

[0224] CA_C3673_RHA_Fwd:GTCAATTAAGTCTATATCAAACATATCGCACCAACC (SEQ ID NO:39)

[0225] CA_C3673_RHA_Rev:AAAAAAGTCGACATGAATGGGAATTATATAGGACTTT (SEQ ID NO:40)

[0226] gRNA_CA_C3673_Fwd:TCATGGAGTAGCAAGTCCTACAGG (SEQ ID NO: 41)

[0227] gRNA_CA_C3673_Rev:AAACCCTGTAGAGCTTGCTACTCC (SEQ ID NO: 42)

[0228] CA_C3673_verif Fwd:TACTTCATACATATCTAACGCACTCT (SEQ ID NO: 44)

[0229] CA_C3673_verif Rev:AAAATAACTTCTACTATGAGACAAGCA (SEQ ID NO: 45)

[0230] Construct the following plasmid vector:

[0231] -Plasmid No. 1: pBANak (SEQ ID NO: 52)

[0232] It contains the p15A origin of replication, as well as the ampR and kanR genes, which allow for ampicillin and kanamycin resistance, respectively. It also contains an expression cassette for the Bacillus subtilis phi 3T I methyltransferase, which is required for methylation of the gene editing vector prior to transformation in Clostridium acetobutylicum.

[0233] -Plasmid No. 4: pGRNA_ΔCA_C1340 (SEQ ID NO: 28)

[0234] It contains pGRNA ind2020) and has a guide RNA surrogate that allows CA_C1340 targeting (Oligo-20-mer obtained by hybridization of primers gRNA_CA_C1340_Fwd (SEQ ID NO: 52) and gRNA_CA_C1340_Rev (SEQ ID NO: 53) and integrated into the plasmid via the “golden gate assembly” technique after digestion with BsaI. It also contains an editing template that allows the inactivation of CA_C1340. The editing template was constructed by cloning the LHA and RHA fragments, which were constructed by using primer pairs CA_C1340_LHA_Fwd (SEQ ID NO: 48) / CA_C1340_LHA_Rev (SEQ ID NO: 49) and CA_C1340_RHA_Fwd (SEQ ID NO: 50) / CA_C1340_RHA_Rev (SEQ ID NO:51) was obtained by amplifying gDNA from Clostridium acetobutylicum DSM 792. The editing template was cloned between the BamHI and SalI restriction sites.

[0235] -Plasmid No. 2: pGRNA_ΔCA_C2613 (SEQ ID NO: 29)

[0236] It contains pGRNA ind and has a guide RNA surrogate allowing CA_C2613 targeting (Oligo-20-mer obtained by hybridization of primers gRNA_CA_C2613_Fwd (SEQ ID NO: 35) and gRNA_CA_C2613_Rev (SEQ ID NO: 36) and integrated into the plasmid via the "golden gate assembly" technique after digestion with BsaI. It also contains an editing template allowing the inactivation of CA_C2613. The editing template was constructed by cloning LHA and RHA fragments, which were amplified from Clostridium acetobutylicum DSM with primer pairs CA_C2613_LHA_Fwd (SEQ ID NO: 31) / CA_C2613_LHA_Rev (SEQ ID NO: 32) and CA_C2613_RHA_Fwd (SEQ ID NO: 33) / CA_C2613_RHA_Rev (SEQ ID NO: 34), respectively. The gDNA of 792 was obtained. The editing template was cloned between BamHI and SalI restriction sites.

[0237] -Plasmid No. 3: pGRNA_ΔCA_C3673 (SEQ ID NO: 30)

[0238] It contains pGRNA ind and has a guide RNA surrogate that provides CA_C3673 targeting (Oligo-20-mer obtained by hybridization of primers gRNA_CA_C3673_Fwd (SEQ ID NO: 41) and gRNA_CA_C3673_Rev (SEQ ID NO: 42) and integrated into the plasmid by golden gate assembly technology after digestion with BsaI. It also contains an editing template that allows inactivation of CA_C3673. The editing template was constructed by cloning LHA and RHA fragments, which were amplified from Clostridium acetobutylicum DSM with primer pairs CA_C3673_LHA_Fwd (SEQ ID NO: 37) / CA_C3673_LHA_Rev (SEQ ID NO: 38) and CA_C3673_RHA_Fwd (SEQ ID NO: 39) / CA_C3673_RHA_Rev (SEQ ID NO: 40), respectively. The gDNA of 792 was obtained. The editing template was cloned between BamHI and SalI restriction sites.

[0239] Transformation of Clostridium acetobutylicum strains

[0240] The plasmid prepared in the NEB 10-β strain was methylated by transformation into the NEB 10-β strain that also contained the pBANak plasmid. The extracted methylated plasmid was then used to transform the C. acetobutylicum strain. The transformation was performed according to the protocol described by Wasels et al. 2020.

[0241] Genetic editing of CA_C2613 (SEQ ID NO: 1), CA_C3673 (SEQ ID NO: 2) and / or CA_C1340 (SEQ ID NO: 3) genes:

[0242] According to the protocol described by Wasels et al. 2020, inactivation of the CA_C1340, CA_C2613 and CA_C3673 genes in the ΔCA_C1340-ΔCA_C2613-ΔCA_C3673 strain was performed by gene editing, and the primer pairs CA_C1340_verif_Fwd (SEQ ID NO: 54) / CA_C1340_verif_Rev (SEQ ID NO: 55); CA_C2613_verif_Fwd (SEQ ID NO: 43) / CA_C2613_verif_Rev (SEQ ID NO: 44); CA_C3673_verif_Fwd (SEQ ID NO: 45) / CA_C3673_verif_Rev (SEQ ID NO: 46) were used during editing verification. The use of other genetic tools, such as those based on homologous recombination or the insertion of mobile genetic elements, can provide mutants with an equivalent genotype, ie no longer expressing the product of the CA_C1340, CA_C2613 and / or CA_C3673 gene, or expressing a non-functional form thereof.

[0243] result

[0244] Determination of growth kinetics and generation time

[0245] The growth of wild-type C. acetobutylicum DSM 792 and ΔCA_C1340 ΔCA_C2613 ΔCA_C3673 strains was monitored in quintuplicate on CGM medium containing 30 mM xylose ( Figure 5 ).

[0246] The results revealed an improvement in the generation time when growing on xylose as carbon source. Furthermore, the combined inactivation of the genes encoding the AraR and XylR repressors allowed an improvement of +171% in the generation time relative to the wild type strain.

[0247] Monitoring consumption of sugar mixtures

[0248] Sugar mixture consumption monitoring was performed in technical triplicates with wild-type C. acetobutylicum DSM 792 and ΔCA_C1340 ΔCA_C2613 ΔCA_C3673 strains on CGM medium containing 25 mM glucose, 25 mM arabinose, and 70 mM xylose ( Figure 6 ).

[0249] The results showed that the simultaneous co-assimilation of arabinose and glucose was possible through the combined inactivation of CA_C1340 and CA_C2613 and CA_C3673 genes.

[0250] Catabolic repression that prevents the co-assimilation of xylose is also maintained in the presence of the other two sugars. This unexpected result suggests that the synergy between the combined inactivation of the genes encoding the AraR and XylR repressors allows the release of catabolic repression of arabinose while maintaining catabolic repression of xylose.

[0251] in conclusion

[0252] In this work, the inventors have successfully demonstrated the value of the combined inactivation of the genes encoding the AraR and XylR repressors in the Clostridium acetobutylicum DSM 792 strain, thereby describing how the combination of these genetic modifications allows the generation of Clostridium acetobutylicum strains that perform glucose / arabinose co-assimilation and accelerated growth on xylose alone. The inactivation of the araR gene alone does not achieve the co-assimilation of arabinose and glucose, which can only be achieved when the gene copy encoding the XylR repressor is also inactivated. In addition, when growing in a medium containing xylose as the sole carbon source, the inactivation of both copies of the gene encoding XylR is not sufficient to significantly reduce the generation time of the microorganism. Therefore, the inactivation of the gene encoding AraR is necessary.

[0253] This is an important result since this strain is naturally unable to simultaneously assimilate pentose and hexose sugars, such as glucose, arabinose and xylose, thus severely affecting performance when fermenting on substrates consisting of mixtures of these sugars, such as industrial substrates for biomass-based sugar production processes.

[0254] References

[0255] - Aristilde, Ludmilla; Lewis, Ian A.; Park, Junyoung O.; Rabinowitz,Joshua D. (2014) Hierarchy in Pentose Sugar Metabolism in Clostridiumacetobutylicum. In: Applied and Environmental Microbiology, vol. 81, No. 4,pp. 1452-1462. DOI: 10.1128 / aem.03199-14.

[0256] - Ezeji, Thaddeus; Blaschek, Hans P. (2008) Fermentation of drieddistillers' grains and solubles (DDGS) hydrolysates to solvents and value-added products by solventogenic clostridia. In: Bioresource Technology, vol.99, No. 12, pp. 5232-5242. DOI: 10.1016 / j.biortech.2007.09.032.

[0257] - Ezeji, Thaddeus; Qureshi, Nasib; Blaschek, Hans P. (2007) Butanolproduction from agricultural residues. Impact of degradation products onClostridium beijerinckii growth and butanol fermentation. In: Biotechnologyand Bioengineering, vol. 97, No. 6, pp. 1460-1469. DOI: 10.1002 / bit.21373.

[0258] - Grimmler, Christina; Held, Claudia; Liebl, Wolfgang; Ehrenreich,Armin (2010) Transcriptional analysis of catabolite repression in Clostridiumacetobutylicum growing on mixtures of D-glucose and D-xylose. In: Journal ofBiotechnology, vol. 150, No. 3, pp. 315-323. DOI: 10.1016 / j.jbiotec.2010.09.938.

[0259] - Gu, Yang; Ding, Yi; Ren, Cong; Sun, Zhe; Rodionov, Dmitry A.;Zhang, Weiwen et al. (2010) Reconstruction of xylose utilization pathway andregulons in Firmicutes. In: BMC Genomics, vol. 11, pp. 255. DOI: 10.1186 / 1471-2164-11-255.

[0260] - Hu, Shiyuan; Zheng, Huajun; Gu, Yang; Zhao, Jingbo; Zhang, Weiwen;Yang, Yunliu et al. (2011) Comparative genomic and transcriptomic analysisrevealed genetic characteristics related to solvent formation and xyloseutilization in Clostridium acetobutylicum EA 2018. In: BMC Genomics, vol. 12,No. 1. DOI: 10.1186 / 1471-2164-12-93.

[0261] - Keis, S.; Shaheen, R.; Jones, D. T. (2001) Emended descriptions ofClostridium acetobutylicum and Clostridium beijerinckii, and descriptions ofClostridium saccharoperbutylacetonicum sp. nov. and Clostridiumsaccharobutylicum sp. nov. In: International Journal of Systematic andEvolutionary Microbiology, vol. 51, No. 6, pp. 2095-2103. DOI: 10.1099 / 00207713-51-6-2095.

[0262] - Qureshi, N.; Li, X.-L.; Hughes, S.; Saha, B. C.; Cotta, M. A.(2006) Butanol production from corn fiber xylan using Clostridiumacetobutylicum. In: Biotechnology Progress, vol. 22, No. 3, pp. 673-680. DOI:10.1021 / bp050360w.

[0263] - Qureshi, Nasib; Ezeji, Thaddeus C.; Ebener, Jennifer; Dien, BruceS.; Cotta, Michael A.; Blaschek, Hans P. (2008) Butanol production byClostridium beijerinckii. Part I. Use of acid and enzyme hydrolyzed cornfiber. In: Bioresource Technology, vol. 99, No. 13, pp. 5915-5922. DOI:10.1016 / j.biortech.2007.09.087.

[0264] - Servinsky, M. D. Arabinose-induced catabolite repression as amechanism for pentose hierarchy control in Clostridium acetobutylicum ATCC824.

[0265] - Servinsky, M. D.; Germane, K. L.; Liu, S.; Kiel, J. T.; Clark, A.M.; Shankar, J.; Sund, C. J. (2012) Arabinose is metabolized via aphosphoketolase pathway in Clostridium acetobutylicum ATCC 824. In: Journalof Industrial Microbiology & Biotechnology, vol. 39, No. 12, pp. 1859-1867.DOI: 10.1007 / s10295-012-1186-x.

[0266] - Servinsky, Matthew D.; Kiel, James T.; Dupuy, Nicole F.; Sund,Christian J. (2010) Transcriptional analysis of differential carbohydrateutilization by Clostridium acetobutylicum. In: Microbiology (Reading,England), vol. 156, No. Pt 11, pp. 3478-3491. DOI: 10.1099 / mic.0.037085-0.

[0267] - Wasels, François; Chartier, Gwladys; Hocq, Rémi; Lopes Ferreira,Nicolas; Julia Pettinari, M. (2020) A CRISPR / Anti-CRISPR genome editingapproach underlines the synergy of butanol dehydrogenases in Clostridiumacetobutylicum DSM 792. In: Applied and Environmental Microbiology, vol. 86,No. 13, p. 4823. DOI: 10.1128 / AEM.00408-20.

[0268] - Zhiqiang Wen, Rodrigo Ledesma-Amaro, MinruiLLu, Mingjie Jin, andSgheng Yang (2020) Metabolic engineering of Clostridium cellulovorans toimprove butanol production by consolidated bioprocessing. ACS Synth. Biol. 9,304-315.

[0269] - Xiao, Han; Li, Zhilin; Jiang, Yu; Yang, Yunliu; Jiang, Weihong; Gu,Yang; Yang, Sheng (2012) Metabolic engineering of D-xylose pathway inClostridium beijerinckii to optimize solvent production from xylose motherliquid. In: Metabolic Engineering, vol. 14, No. 5, pp. 569-578. DOI: 10.1016 / j.ymben.2012.05.003.

[0270] -Zhang, Lei; Leyn, Semen A.; Gu, Yang; Jiang, Weihong; Rodionov,Dmitry A.; Yang, Chen (2012) Ribulokinase and transcriptional regulation ofarabinose metabolism in Clostridium acetobutylicum. In: Journal ofBacteriology, vol. 194, No. 5, pp. 1055-1064. DOI: 10.1128 / JB.06241-11.

Claims

1. A genetically modified bacterium belonging to the genus Clostridium, characterized in that It does not express the products of the xylR and araR genes, or expresses them in non-functional forms.

2. The bacterium according to claim 1, characterized in that The bacterium is a solvent-producing bacterium, preferably Clostridium acetobutylicum.

3. The bacterium according to claim 1 or 2, characterized in that i) the bacterium belongs to the species Clostridium acetobutylicum and does not express the gene product of the sequence SEQ ID NO: 1 (CA_C2613) or a sequence at least 95% homologous thereto, SEQ ID NO: 2 (CA_C3673) or a sequence at least 95% homologous thereto, and SEQ ID NO: (CA_C1340) or a sequence at least 95% homologous thereto, or ii) it expresses a non-functional form of the expression product.

4. The bacterium according to any one of claims 1 to 3, characterized in that It is capable of simultaneously fermenting at least one hexose and one pentose.

5. The bacterium according to any one of claims 1 to 3, characterized in that It is capable of simultaneously fermenting carbon-based components of a substrate comprising at least two carbon components selected from the group consisting of glucose, arabinose, xylose, mannose and galactose, preferably selected from the group consisting of glucose, arabinose and xylose.

6. The bacterium according to any one of claims 1 to 3, characterized in that On medium containing xylose as the sole carbon source, it grew faster than bacteria expressing a functional AraR protein or a mixture of functional XylR and AraR proteins.

7. The bacterium according to any one of claims 1 to 6, characterized in that The bacterium is strain IFP 968 registered at the BCCM-LMG Collection Center on June 13, 2022 with the collection number LMG P-32703.

8. Use of the bacterium according to any one of claims 1 to 6 for the simultaneous fermentation of at least one hexose and one pentose or a substrate comprising at least two carbon-based elements selected from glucose, arabinose, xylose, mannose and galactose.

9. The use according to claim 8, characterized in that The substrate comprises at least two sugars selected from the group consisting of glucose, arabinose and xylose.

10. Use according to claim 8 or 9 for producing a solvent, such as a biofuel, or a mixture of solvents, such as a biofuel mixture.

11. Use of a bacterium according to any one of claims 1 to 6 for producing sugars or bio-based molecules from i) lignocellulosic biomass, ii) products of specific dedicated crops (e.g., energy crops, perennial forage crops, herbaceous crops, shrub crops), or iii) 1G substrates derived from one or more sugar-producing plants, cereal plants or oil-producing plants, or iv) mixtures of such carbon sources.

12. A fermentation process involving the use of a bacterium as claimed in any one of claims 1 to 7.

13. A method for producing a recombinant bacterium according to any one of claims 1 to 7, comprising deleting or inactivating the xylR and araR genes, thereby preventing or reducing the expression of functional XylR and AraR proteins.

14. A genetically modified bacterium belonging to the genus Clostridium, obtainable by the method according to claim 13, characterized in that The bacterium is the bacterium according to any one of claims 1 to 6.

15. Use of a genetically modified bacterium belonging to the genus Clostridium, characterized in that The genetically modified bacteria do not express the xylR or araR gene product, or express a non-functional form of the xylR or araR gene product, and are used to prepare the genetically modified bacteria that do not express the xylR or araR gene product, or express a non-functional form thereof, according to any one of claims 1 to 6.

16. The use according to claim 15, characterized in that The genetically modified bacteria that do not express the xylR or araR gene products, or express a non-functional form of the xylR or araR gene products, is strain IFP 967 registered at the BCCM-LMG Collection Center on June 13, 2022 with the deposit number LMG P-32702.

17. A kit for producing solvents, sugars or bio-based molecules using bacteria belonging to the genus Clostridium, characterized in that The bacterium does not express the xylR or araR gene product, or expresses a non-functional form thereof, and the kit comprises the genetically modified bacterium belonging to the genus Clostridium according to claim 1 and a storage medium for the bacterium.

Images