DsRNA molecule for inhibiting LP (a) gene expression and application thereof

Abstract

The invention discloses a modified dsRNA molecule and application thereof. Specifically, a dsRNA molecule for inhibiting Lp (a) gene expression is provided, the dsRNA molecule comprises a positive-sense strand and an antisense strand which are complementary to form a double-stranded region, the positive-sense strand and / or the antisense strand comprises 15-25 nucleotides or is composed of 515-25 nucleotides, and the dsRNA molecule can be used for treating and / or preventing Lp (a) gene mediated diseases.

Description

A dsRNA molecule for inhibiting LP(a) gene expression and its application Technical Field

[0001] The present application belongs to the field of molecular biology and relates to a modified dsRNA molecule and its application, specifically to a dsRNA molecule and its pharmaceutical composition for inhibiting LP(a) gene expression, as well as a method for reducing the expression level of the LP(a) gene using the dsRNA molecule or its pharmaceutical composition. Background Art

[0002] RNA interference (RNAi) refers to the highly conserved evolutionary phenomenon of efficient and specific degradation of homologous mRNAs induced by double-stranded RNA (dsRNA). RNAi is a ubiquitous surveillance mechanism in eukaryotes that protects against viral invasion, inhibits transposon activity, and regulates gene expression. Small interfering RNA (dsRNA), a short double-stranded RNA molecule of 19 to 30 bp in length, is a key tool in RNAi technology. In nature, upon entering cells, dsRNA is specifically recognized and cleaved by the enzyme Dicer into small RNA fragments (i.e., 21 to 23 nucleotides in length). The resulting dsRNA fragments unwind into single strands and form complexes with certain proteins (RISC). RISC binds to complementary mRNAs within the cell and cleaves them, degrading them. This prevents protein synthesis and results in gene silencing. In industrial production, chemical synthesis and modification of dsRNA are preferred to further enhance the stability and efficacy of dsRNA therapeutics. In recent years, breakthroughs have been made in the research of dsRNA-based drugs. Several dsRNA drugs targeting rare diseases have been approved by the FDA, including patisiran (for hereditary transthyretin amyloidosis), eteplirsen (for Duchenne muscular dystrophy), givosiran (for acute intermittent porphyria), and spinraza (for spinal muscular atrophy). The therapeutic applications of dsRNA drugs have also gradually expanded from rare diseases to common ailments. Examples include the recently approved inclisiran for the treatment of hyperlipidemia, DCRH BVS for the treatment of hepatitis B, tivanisiran (for dry eye), QPI-1007 (for optic atrophy), SYL040012 (for glaucoma), and QPI-1002 for the treatment of severe kidney disease. The continuous advancement of dsRNA clinical research and the successful launch of these drugs have clarified the development path of dsRNA drugs. Their unique gene-silencing capabilities are curing a growing number of diseases, bringing benefits to humanity.

[0003] Lipoprotein A (Lp(a)) particles are essentially low-density lipoprotein-like particles, composed of apolipoprotein A linked to LDL-like particles via the ApoB polypeptide. They are synthesized in the liver from independent triglycerides and are not affected by age or diet. High Lp(a) levels can contribute to atherosclerosis and have been found in arterial walls. Because of its structural similarity to plasminogen, it can also inhibit fibrinolysis, leading to thrombosis. High serum Lp(a) levels are associated with premature atherosclerosis and stroke. Serum Lp(a) levels are primarily genetically determined and are largely unaffected by gender, age, weight, and most cholesterol-lowering medications. Research indicates that normal Lp(a) levels should be below 300 mg / L (30 mg / dL). When Lp(a) levels exceed 34 mg / dL, the risk of coronary artery disease increases approximately twofold. When evaluated together with LDL-cholesterol levels, the risk increases approximately sixfold. When other plasma lipoproteins are not considered, Lp(a) levels are considered the most sensitive indicator of the development of coronary artery disease. Therefore, Lp(a) inhibitors, which reduce Lp(a) concentrations in the blood, are expected to become potential therapeutic targets for the treatment and prevention of cardiovascular and cerebrovascular diseases and their complications.

[0004] Traditional statins, lipid-lowering and stabilizing drugs, do not cause significant changes in Lp(a) levels and do not result in clinically important differences in Lp(a) levels in patients at risk for CVD. In some studies, statins have even been shown to increase Lp(a). Fibrates and ezetimibe are also ineffective in lowering Lp(a). Currently, effective Lp(a)-lowering drugs include niacin, PCSK9 inhibitors, estrogens, mipomersen, and lomitapide. However, considering factors such as Lp(a)-lowering efficacy, cost-effectiveness, clinical adverse events, clinical feasibility and scalability, and cardiovascular benefits, these treatment options are not optimal. New Lp(a)-lowering drugs—small nucleic acid drugs—are expected to become effective interventions for lowering Lp(a). Therefore, developing highly effective Lp(a)-silencing inhibitors would provide effective long-term treatment for cardiovascular and cerebrovascular diseases, with improved efficacy, specificity, stability, targeting, and tolerability.

[0005] Summary of the Invention

[0006] The present application provides a dsRNA molecule, reagent, kit, and pharmaceutical composition for inhibiting Lp(a) gene expression, as well as methods and uses of the dsRNA molecule, reagent, kit, or pharmaceutical composition for inhibiting or reducing Lp(a) gene expression and preventing or treating diseases or symptoms associated with elevated Lp(a) protein levels. The dsRNA molecule promotes sequence-specific degradation of Lp(a) mRNA through RNAi, thereby inhibiting Lp(a) gene expression or reducing Lp(a) gene expression levels.

[0007] In one aspect, the present application provides a double-stranded ribonucleic acid (dsRNA) agent for inhibiting the expression of Lp(a), wherein the dsRNA comprises a sense strand and an antisense strand, wherein the sense strand and / or antisense strand comprises at least 15 consecutive nucleotides that differ by no more than 3 nucleotides from the nucleotide sequence of any of the sense sequences and antisense sequences listed in Table 2 or Table 8.

[0008] In some embodiments, the sense strand and / or the antisense strand comprises or consists of 15-25 nucleotides, the antisense strand is complementary to 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides of the sense strand sequence in Table 2, the length of the double-stranded region is 15-25 bp, preferably 19-21 bp, and at least one nucleotide in the dsRNA molecule is modified. In some embodiments, the modification is selected from any one or more of the following: locked nucleic acid (LNA) modification, open ring or unlocked (UNA) modification, 2'-methoxyethyl modification, 2'-O-methyl modification, 2'-O-allyl modification, 2'-C-allyl modification, 2'-fluoro modification, 2'-deoxy modification, 2'-hydroxyl modification, phosphorothioate backbone modification, DNA modification, fluorescent probe modification, and ligand modification.

[0009] The present application provides a dsRNA molecule, the nucleotide sequence of its sense chain is shown in any sense chain sequence in Table 2, and the nucleotide sequence of its antisense chain is shown in any antisense chain sequence in Table 2.

[0010] The dsRNA molecule can be selected from the dsRNA listed in Table 2 of the Examples;

[0011] In some embodiments, the sense strand structure of the dsRNA molecule is as shown in any of the following sequences:

[0012] The antisense strand structure of the dsRNA molecule is shown in any of the following sequences:

[0013] In some embodiments, the modification methods of the dsRNA molecules of the present application include: (1) the sense strand: 17-21 nt in length, such as 21 nt; composed of alternating 2'-O-methyl modified regions and 2'-fluoro modified regions, each modified region is 1 to 3 nucleotides in length; the modification methods of the 5' end and the first modified region from the 3' end are the same; (2) the antisense strand: 19-23 nt in length, such as 23 nt; composed of alternating 2'-O-methyl modified regions, 2'-fluoro modified regions, unmodified regions or DNA regions, each modified region is 1 to 5 nucleotides in length; and the continuous nucleotide region from the 2nd to 5th position from the 5' end and the continuous nucleotide region from the 1st to 3rd position from the 3' end are both connected by a thiophosphate backbone. In some alternative embodiments, the modification of the dsRNA molecule of the present application may also include: (1) positive chain: 17-21 nt in length, preferably 21 nt; composed of alternating 2′-O-methyl modified regions and 2′-fluoro modified regions, each modified region is 1 to 10 nucleotides in length; the modification of the 5′ end and the first modified region from the 3′ end is the same; and the continuous nucleotide region from the 1st to 3rd position from the 5′ end is connected by a thiophosphate backbone; (2) antisense chain: 19-23 nt in length, preferably 23 nt; composed of alternating 2′-O-methyl modified regions, 2′-fluoro modified regions, unmodified regions or DNA regions, each modified region is 1-11 nucleotides in length; and the continuous nucleotide region from the 1st to 3rd position from the 5′ end and the continuous nucleotide region from the 1st to 3rd position from the 3′ end are both connected by a thiophosphate backbone.

[0014] In one embodiment, the length of the 2'-O-methyl modified region in the sense strand is 1-10 nucleotides, and the length of the 2'-fluoro modified region is 1-3 nucleotides; the length of the 2'-O-methyl modified region in the antisense strand is 1-11 nucleotides, and the length of the 2'-fluoro modified region is 1-3 nucleotides.

[0015] In some embodiments, the sense strand structure of the dsRNA molecule is as shown in any of the following sequences:

[0016] The antisense strand structure of the dsRNA molecule is shown in any of the following sequences:

[0017] Among them, Am, Um, Cm and Gm represent 2'-O-methyl modified ribonucleotides A, U, C and G, respectively; Af, Uf, Cf and Gf represent 2'-fluoro modified ribonucleotides A, U, C and G, respectively; s indicates that the two nucleotides are connected by a thiophosphate backbone.

[0018] In some preferred embodiments, the dsRNA molecule is selected from the group consisting of dsRNA molecules shown by LP164, LP173, LP508, LP2941, and LP4927, wherein:

[0019] LP164:

[0020] Chain of Justice:

[0021] Antisense strand:

[0022] LP173:

[0023] Chain of Justice:

[0024] Antisense strand:

[0025] LP508:

[0026] Chain of Justice:

[0027] Antisense strand:

[0028] LP2941:

[0029] Chain of Justice:

[0030] Antisense strand:

[0031] AmsUfsAmGmAmUmGmAmCmCmAmAmGmCfUmUfGmGmCmAmGmsGmsUm (SEQ ID NO: 8); and

[0032] LP4927:

[0033] Chain of Justice:

[0034] Antisense strand:

[0035] GmsAfsAmUmGmUmGmCmCmUmCmGmAmUfAmAfCmUmCmUmGmsGmsCm (SEQ ID NO: 10). Wherein, Am, Um, Cm, and Gm represent 2'-O-methyl-modified ribonucleotides A, U, C, and G, respectively; Af, Uf, Cf, and Gf represent 2'-fluoro-modified ribonucleotides A, U, C, and G, respectively; and s represents the two nucleotides connected by a phosphorothioate backbone.

[0036] The dsRNA of the present application may further comprise ligand modification. The ligand may be a portion that is taken up by a host cell. Ligand modification can improve the cellular uptake, intracellular targeting, half-life, or drug metabolism or kinetics of the dsRNA molecule. In some embodiments, compared with dsRNA without ligand modification, dsRNA with ligand modification has enhanced affinity or cellular uptake for selected targets (such as specific tissue types, cell types, organelles, etc.), such as hepatocytes. Ligand modification will not interfere with the activity of the dsRNA.

[0037] In some embodiments, the ligand modification is to perform one or more ligand modifications on the 3' end, 5' end and / or the middle of the sequence of the dsRNA molecule of the present application.

[0038] In some preferred embodiments, the ligand is selected from the group consisting of cholesterol, biotin, vitamins, galactose derivatives or analogs, lactose derivatives or analogs, N-acetylgalactosamine derivatives or analogs, and N-acetylglucosamine derivatives or analogs. The ligand targets a cell surface receptor comprising a galactose, galactosamine, lactose, or N-acetylgalactosamine / glucosamine moiety. The ligand is preferably targeted to the liver, particularly to the parenchymal cells of the liver.

[0039] In some preferred embodiments, the ligand targets the ASGPR receptor.

[0040] In some preferred embodiments, the ligand may also be human serum albumin (HSA), hyaluronic acid, polypeptide, etc.

[0041] In some preferred embodiments, the ligand-modified dsRNA is selected from any one of the following dsRNA molecules (direction 5'->3'):

[0042] 1)LP164-E05

[0043] Chain of Justice:

[0044] Antisense strand:

[0045] 2)LP173-E05

[0046] Chain of Justice:

[0047] Antisense strand:

[0048] 3)LP508-E05

[0049] Chain of Justice:

[0050] Antisense strand:

[0051] 4)LP2941-E05

[0052] Chain of Justice:

[0053] Antisense strand:

[0054] AmsUfsAmGmAmUmGmAmCmCmAmAmGmCfUmUfGmGmCmAmG msGmsUm (SEQ ID NO: 8); and

[0055] 5)LP4927-E05

[0056] Chain of Justice:

[0057] Antisense strand:

[0058] Wherein, Am, Um, Cm, and Gm represent 2'-O-methyl modified ribonucleotides A, U, C, and G, respectively; Af, Uf, Cf, and Gf represent 2'-fluoro modified ribonucleotides A, U, C, and G, respectively; and s represents the connection of the two nucleotides to each other via a phosphorothioate backbone. The structure of L96 and its connection to the sense strand nucleotide (i.e., "-L96") are shown below:

[0059] In some embodiments, the 3' end, 5' end and / or the middle of the sequence of the dsRNA of the present application can also be modified with 1-5, 2-4 or 3 N-acetylgalactosamine derivatives or analogs, and the N-acetylgalactosamine derivative is preferably L96.

[0060] In some preferred embodiments, each strand of the dsRNA molecule of the present invention may contain 0%-100% modified nucleotides, such as 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% modified nucleotides. The modifications may be in the overhang region or the double-stranded region. The modifications may be used to improve the in vitro or in vivo characteristics of the dsRNA molecule, such as stability, biodistribution, inhibitory activity, etc. The above modifications may be used in combination.

[0061] In some preferred embodiments, each end of the dsRNA molecule of the present application has an overhang or a blunt end; including 1-8 overhangs, such as 1, 2, 3, 4, 5, 6, 7, or 8 overhangs at the 5' and / or 3' ends of any chain or double chain, and the overhangs are arbitrarily selected from U, A, G, C, T, and dT.

[0062] In some preferred embodiments, the dsRNA molecules of the present application are capable of inhibiting human Lp(a) gene expression. In some embodiments, when the antisense strand of the dsRNA of the present application hybridizes with the pre-mRNA or mature mRNA of the Lp(a) gene at maximum complementarity, the number of base mismatches between the antisense strand and the pre-mRNA or mature mRNA does not exceed two.

[0063] In some embodiments, the dsRNA molecules of the present application comprise a sense strand and an antisense strand, the sense strand is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length, preferably 21 nucleotides, and the antisense strand is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length, preferably 23 nucleotides.

[0064] In one embodiment, the dsRNA molecule of the present application comprises a sense strand and an antisense strand, which respectively comprise at least 15 consecutive nucleotides that differ by no more than 3 nucleotides from the sense strand set forth in CAGAGUUAUCGAGGCACAUUC (SEQ ID NO: 709) and the antisense strand set forth in GAAUGUGCCUCGAUAACUCUGGC (SEQ ID NO: 710).

[0065] In one embodiment, the dsRNA molecule of the present application comprises a sense strand and an antisense strand, each comprising at least 15 consecutive nucleotides that differ by no more than 3 nucleotides from the sense strand set forth in CAGAGUUAUCGAGGCACAUUC (SEQ ID NO: 709) and the antisense strand set forth in GAAUGUGCCUCGAUAACUCUGGC (SEQ ID NO: 710); and the sense strand is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length, and the antisense strand is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length.

[0066] In some embodiments, the sense strand and / or the antisense strand of the dsRNA molecule of the present application comprises or consists of 15-25 nucleotides, and the antisense strand is complementary to 15, 16, 17, 18, 19, 20 or 21 consecutive nucleotides of the sense strand sequence of GAAUGUGCCUCGAUAACUCUGGC (SEQ ID NO: 710), wherein the length of the double-stranded region of the dsRNA molecule is 15-25 bp, preferably 19-21 bp, for example 16, 17, 18, 20, 22, 23, or 24 bp. In one embodiment, the sense strand of the dsRNA molecule of the present application is 18, 19, 20, 21 or 22 nt in length, and the base sequence of the sense strand has at least 19 consecutive identical bases to CAGAGUUAUCGAGGCACAUUC (SEQ ID NO: 709); and the antisense strand is about 21, 22, 23, 24 or 25 nt in length, and the base sequence of the antisense strand has 21 consecutive identical bases to GAAUGUGCCUCGAUAACUCUGGC (SEQ ID NO: 710).

[0067] In one embodiment, the sense strand base sequence of the dsRNA molecule of the present application comprises CAGAGUUAUCGAGGCACAUUC (SEQ ID NO: 709) and the antisense strand base sequence comprises GAAUGUGCCUCGAUAACUCUGGC (SEQ ID NO: 710).

[0068] In one embodiment, the sense strand base sequence of the dsRNA molecule of the present application consists of CAGAGUUAUCGAGGCACAUUC (SEQ ID NO: 709) and 0, 1, 2, 3 or 4 additional nucleotides, and the antisense strand base sequence consists of GAAUGUGCCUCGAUAACUCUGGC (SEQ ID NO: 710) and 0, 1, 2, 3 or 4 additional nucleotides.

[0069] In one embodiment, the base sequence of the sense strand of the dsRNA molecule of the present application is CAGAGUUAUCGAGGCACAUUC (SEQ ID NO: 709), and the base sequence of the antisense strand is GAAUGUGCCUCGAUAACUCUGGC (SEQ ID NO: 710).

[0070] In one embodiment, the dsRNA molecule of the present application comprises a sense strand and an antisense strand, which respectively comprise at least 15 consecutive nucleotides that differ by no more than 3 nucleotides from the sense strand set forth in AGAGUUAUCGAGGCACGUACU (SEQ ID NO: 485) and the antisense strand set forth in AGUACGUGCCUCGAUAACUCUGU (SEQ ID NO: 486).

[0071] In one embodiment, the dsRNA molecule of the present application comprises a sense strand and an antisense strand, each comprising at least 15 consecutive nucleotides that differ by no more than 3 nucleotides from the sense strand set forth in AGAGUUAUCGAGGCACGUACU (SEQ ID NO: 485) and the antisense strand set forth in AGUACGUGCCUCGAUAACUCUGU (SEQ ID NO: 486); and the sense strand is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length, and the antisense strand is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length.

[0072] In some embodiments, the sense strand and / or the antisense strand of the dsRNA molecule of the present application comprises or consists of 15-25 nucleotides, and the antisense strand is complementary to 15, 16, 17, 18, 19, 20 or 21 consecutive nucleotides of the sense strand sequence of AGUACGUGCCUCGAUAACUCUGU (SEQ ID NO: 486), wherein the length of the double-stranded region of the dsRNA molecule is 15-25 bp, preferably 19-21 bp, for example 16, 17, 18, 20, 22, 23, or 24 bp. In one embodiment, the sense strand of the dsRNA molecule of the present application is 18, 19, 20, 21 or 22 nt in length, and the sense strand base sequence has at least 19 consecutive identical bases to AGAGUUAUCGAGGCACGUACU (SEQ ID NO: 485); and the antisense strand is about 21, 22, 23, 24 or 25 nt in length, and the antisense strand base sequence has 21 consecutive identical bases to AGUACGUGCCUCGAUAACUCUGU (SEQ ID NO: 486).

[0073] In one embodiment, the sense strand base sequence of the dsRNA molecule of the present application comprises AGAGUUAUCGAGGCACGUACU (SEQ ID NO: 485) and the antisense strand base sequence comprises AGUACGUGCCUCGAUAACUCUGU (SEQ ID NO: 486).

[0074] In one embodiment, the sense strand base sequence of the dsRNA molecule of the present application consists of AGAGUUAUCGAGGCACGUACU (SEQ ID NO: 485) and 0, 1, 2, 3 or 4 additional nucleotides, and the antisense strand base sequence consists of AGUACGUGCCUCGAUAACUCUGU (SEQ ID NO: 486) and 0, 1, 2, 3 or 4 additional nucleotides.

[0075] In one embodiment, the base sequence of the sense strand of the dsRNA molecule of the present application is AGAGUUAUCGAGGCACGUACU (SEQ ID NO: 485), and the base sequence of the antisense strand is AGUACGUGCCUCGAUAACUCUGU (SEQ ID NO: 486).

[0076] In one embodiment, the dsRNA molecule of the present application comprises a sense strand and an antisense strand, which respectively comprise at least 15 consecutive nucleotides that differ by no more than 3 nucleotides from the sense strand set forth in GAGGCACGUACUCCACCACUG (SEQ ID NO: 491) and the antisense strand set forth in CAGUGGUGGAGUACGUGCCUCGA (SEQ ID NO: 492).

[0077] In one embodiment, the dsRNA molecule of the present application comprises a sense strand and an antisense strand, each comprising at least 15 consecutive nucleotides that differ by no more than 3 nucleotides from the sense strand set forth in GAGGCACGUACUCCACCACUG (SEQ ID NO: 491) and the antisense strand set forth in CAGUGGUGGAGUACGUGCCUCGA (SEQ ID NO: 492); and the sense strand is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length, and the antisense strand is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length.

[0078] In some embodiments, the sense strand and / or the antisense strand of the dsRNA molecule of the present application comprises or consists of 15-25 nucleotides, and the antisense strand is complementary to 15, 16, 17, 18, 19, 20 or 21 consecutive nucleotides of the sense strand sequence of CAGUGGUGGAGUACGUGCCUCGA (SEQ ID NO: 492), wherein the length of the double-stranded region of the dsRNA molecule is 15-25 bp, preferably 19-21 bp, for example 16, 17, 18, 20, 22, 23, or 24 bp. In one embodiment, the sense strand of the dsRNA molecule of the present application is 18, 19, 20, 21 or 22 nt in length, and the base sequence of the sense strand has at least 19 consecutive identical bases to GAGGCACGUACUCCACCACUG (SEQ ID NO: 491); and the antisense strand is about 21, 22, 23, 24 or 25 nt in length, and the base sequence of the antisense strand has 21 consecutive identical bases to CAGUGGUGGAGUACGUGCCUCGA (SEQ ID NO: 492).

[0079] In one embodiment, the sense strand base sequence of the dsRNA molecule of the present application comprises GAGGCACGUACUCCACCACUG (SEQ ID NO: 491) and the antisense strand base sequence comprises CAGUGGUGGAGUACGUGCCUCGA (SEQ ID NO: 492).

[0080] In one embodiment, the sense strand base sequence of the dsRNA molecule of the present application consists of GAGGCACGUACUCCACCACUG (SEQ ID NO: 491) and 0, 1, 2, 3 or 4 additional nucleotides, and the antisense strand base sequence consists of CAGUGGUGGAGUACGUGCCUCGA (SEQ ID NO: 492) and 0, 1, 2, 3 or 4 additional nucleotides.

[0081] In one embodiment, the base sequence of the sense strand of the dsRNA molecule of the present application is GAGGCACGUACUCCACCACUG (SEQ ID NO: 491), and the base sequence of the antisense strand is CAGUGGUGGAGUACGUGCCUCGA (SEQ ID NO: 492).

[0082] In one embodiment, the dsRNA molecule of the present application comprises a sense strand and an antisense strand, which respectively comprise at least 15 consecutive nucleotides that differ by no more than 3 nucleotides from the sense strand set forth in AGUUAUCGAGGCACAUACUCC (SEQ ID NO: 531) and the antisense strand set forth in GGAGUAUGUGCCUCGAUAACUCU (SEQ ID NO: 532).

[0083] In one embodiment, the dsRNA molecule of the present application comprises a sense strand and an antisense strand, each comprising at least 15 consecutive nucleotides that differ by no more than 3 nucleotides from the sense strand set forth in AGUUAUCGAGGCACAUACUCC (SEQ ID NO: 531) and the antisense strand set forth in GGAGUAUGUGCCUCGAUAACUCU (SEQ ID NO: 532); and the sense strand is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length, and the antisense strand is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length.

[0084] In some embodiments, the sense strand and / or the antisense strand of the dsRNA molecule of the present application comprises or consists of 15-25 nucleotides, and the antisense strand is complementary to 15, 16, 17, 18, 19, 20 or 21 consecutive nucleotides of the sense strand sequence of GGAGUAUGUGCCUCGAUAACUCU (SEQ ID NO: 532), wherein the length of the double-stranded region of the dsRNA molecule is 15-25 bp, preferably 19-21 bp, for example 16, 17, 18, 20, 22, 23, or 24 bp. In one embodiment, the sense strand of the dsRNA molecule of the present application is 18, 19, 20, 21 or 22 nt in length, and the base sequence of the sense strand has at least 19 consecutive identical bases to AGUUAUCGAGGCACAUACUCC (SEQ ID NO: 531); and the antisense strand is about 21, 22, 23, 24 or 25 nt in length, and the base sequence of the antisense strand has 21 consecutive identical bases to GGAGUAUGUGCCUCGAUAACUCU (SEQ ID NO: 532).

[0085] In one embodiment, the sense strand base sequence of the dsRNA molecule of the present application comprises AGUUAUCGAGGCACAUACUCC (SEQ ID NO: 531) and the antisense strand base sequence comprises GGAGUAUGUGCCUCGAUAACUCU (SEQ ID NO: 532).

[0086] In one embodiment, the sense strand base sequence of the dsRNA molecule of the present application consists of AGUUAUCGAGGCACAUACUCC (SEQ ID NO: 531) and 0, 1, 2, 3 or 4 additional nucleotides, and the antisense strand base sequence consists of GGAGUAUGUGCCUCGAUAACUCU (SEQ ID NO: 532) and 0, 1, 2, 3 or 4 additional nucleotides.

[0087] In one embodiment, the base sequence of the sense strand of the dsRNA molecule of the present application is AGUUAUCGAGGCACAUACUCC (SEQ ID NO: 531), and the base sequence of the antisense strand is GGAGUAUGUGCCUCGAUAACUCU (SEQ ID NO: 532).

[0088] In one embodiment, the dsRNA molecule of the present application comprises a sense strand and an antisense strand, which respectively comprise at least 15 consecutive nucleotides that differ by no more than 3 nucleotides from the sense strand set forth in ACUGCCAAGCUUGGUCAUCUAU (SEQ ID NO: 119) and the antisense strand set forth in AUAGAUGACCAAGCUUGGCAGGU (SEQ ID NO: 120).

[0089] In one embodiment, the dsRNA molecule of the present application comprises a sense strand and an antisense strand, each comprising at least 15 consecutive nucleotides that differ by no more than 3 nucleotides from the sense strand set forth in ACUGCCAAGCUUGGUCAUCUAU (SEQ ID NO: 119) and the antisense strand set forth in AUAGAUGACCAAGCUUGGCAGGU (SEQ ID NO: 120); and the sense strand is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length, and the antisense strand is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length.

[0090] In some embodiments, the sense strand and / or the antisense strand of the dsRNA molecule of the present application comprises or consists of 15-25 nucleotides, and the antisense strand is complementary to 15, 16, 17, 18, 19, 20 or 21 consecutive nucleotides of the sense strand sequence of AUAGAUGACCAAGCUUGGCAGGU (SEQ ID NO: 120), wherein the length of the double-stranded region of the dsRNA molecule is 15-25 bp, preferably 19-21 bp, for example 16, 17, 18, 20, 22, 23, or 24 bp. In one embodiment, the sense strand of the dsRNA molecule of the present application is 18, 19, 20, 21 or 22 nt in length, and the base sequence of the sense strand has at least 19 consecutive identical bases to ACUGCCAAGCUUGGUCAUCUAU (SEQ ID NO: 119); and the antisense strand is about 21, 22, 23, 24 or 25 nt in length, and the base sequence of the antisense strand has 21 consecutive identical bases to AUAGAUGACCAAGCUUGGCAGGU (SEQ ID NO: 120).

[0091] In one embodiment, the sense strand base sequence of the dsRNA molecule of the present application comprises ACUGCCAAGCUUGGUCAUCUAU (SEQ ID NO: 119) and the antisense strand base sequence comprises AUAGAUGACCAAGCUUGGCAGGU (SEQ ID NO: 120).

[0092] In one embodiment, the sense strand base sequence of the dsRNA molecule of the present application consists of ACUGCCAAGCUUGGUCAUCUAU (SEQ ID NO: 119) and 0, 1, 2, 3 or 4 additional nucleotides, and the antisense strand base sequence consists of AUAGAUGACCAAGCUUGGCAGGU (SEQ ID NO: 120) and 0, 1, 2, 3 or 4 additional nucleotides.

[0093] In one embodiment, the base sequence of the sense strand of the dsRNA molecule of the present application is ACUGCCAAGCUUGGUCAUCUAU (SEQ ID NO: 119), and the base sequence of the antisense strand is AUAGAUGACCAAGCUUGGCAGGU (SEQ ID NO: 120).

[0094] In one embodiment, the sequences of SEQ ID NO: 709, SEQ ID NO: 710, SEQ ID NO: 485, SEQ ID NO: 486, SEQ ID NO: 491, SEQ ID NO: 492, SEQ ID NO: 531, SEQ ID NO: 532, SEQ ID NO: 119, and SEQ ID NO: 120 may comprise one or more nucleotide modifications selected from the group consisting of 2'-O-methyl modifications, 2'-fluoro modifications, phosphorothioate backbone modifications, and ligand modifications. Specific ligands are as described above.

[0095] In one embodiment, in the above-mentioned dsRNA, the characteristics of the sense strand of the dsRNA containing SEQ ID NO: 709, SEQ ID NO: 485, SEQ ID NO: 491, SEQ ID NO: 531, and SEQ ID NO: 119 include: a length of 17-21 nt, such as 21 nt; composed of alternating 2'-O-methyl modified regions and 2'-fluoro modified regions, each modified region being 1 to 10 nucleotides in length; the 5' end and the first modified region from the 3' end are modified in the same manner; and the consecutive nucleotides from the 1st to the 3rd position from the 5' end are connected by a thiophosphate backbone; in the above-mentioned dsRNA, the SEQ ID NO: 710, SEQ ID NO: 486, SEQ ID NO: 492, SEQ ID NO: 532, and SEQ ID NO: 119 are The characteristics of the antisense strand where NO:120 is located include: a length of 19-23 nt, such as 23 nt; composed of alternating 2'-O-methyl modified regions and 2'-fluoro modified regions, each modified region being 1 to 11 nucleotides in length; and the continuous nucleotide region from positions 1 to 3 from the 5' end and the continuous nucleotide region from positions 1 to 3 from the 3' end are both connected by a thiophosphate backbone.

[0096] In one embodiment, the length of the 2'-O-methyl modified region in the above-mentioned sense strand is 1-10 nucleotides, and the length of the 2'-fluoro modified region is 1-3 nucleotides; the length of the 2'-O-methyl modified region in the above-mentioned antisense strand is 1-11 nucleotides, and the length of the 2'-fluoro modified region is 1-3 nucleotides.

[0097] In one embodiment, each of the nucleotide sequences of SEQ ID NO:709, SEQ ID NO:710, SEQ ID NO:485, SEQ ID NO:486, SEQ ID NO:491, SEQ ID NO:492, SEQ ID NO:531, SEQ ID NO:532, SEQ ID NO:119 and SEQ ID NO:120 is modified, and the modification method is as described above.

[0098] In one embodiment, the modified SEQ ID NO: 709, SEQ ID NO: 710, SEQ ID NO: 485, SEQ ID NO: 486, SEQ ID NO: 491, SEQ ID NO: 492, SEQ ID NO: 531, SEQ ID NO: 532, SEQ ID NO: 119, and SEQ ID NO: 120 may further comprise ligand modifications at the 3' end, 5' end, and / or in the middle of the sequence. Specific ligands are as described above.

[0099] In some embodiments, the sense strand of the dsRNA of the present application is 18, 19, 20, 21 or 22 nt in length, which comprises or is:

[0100] The antisense strand is 21, 22, 23, 24 or 25 nt in length and comprises or is:

[0101] In some embodiments, the sense strand of the dsRNA of the present application is 18, 19, 20, 21 or 22 nt in length, which comprises or is:

[0102] The antisense strand is 21, 22, 23, 24 or 25 nt in length and comprises or is:

[0103] In some embodiments, the sense strand of the dsRNA of the present application is 18, 19, 20, 21 or 22 nt in length, which comprises or is:

[0104] The antisense strand is 21, 22, 23, 24 or 25 nt in length and comprises or is:

[0105] In some embodiments, the sense strand of the dsRNA of the present application is 18, 19, 20, 21 or 22 nt in length, which comprises or is:

[0106] The antisense strand is 21, 22, 23, 24 or 25 nt in length and comprises or is:

[0107] GmsGfsAmGmUmAmUmGmUmGmCmCmUmCfGmAfUmAmAmCmUmsCmsUm (SEQ ID NO:6); and

[0108] In some embodiments, the sense strand of the dsRNA of the present application is 18, 19, 20, 21 or 22 nt in length, which comprises or is:

[0109] The antisense strand is 21, 22, 23, 24 or 25 nt in length and comprises or is:

[0110] In the present application, Am, Um, Cm and Gm represent 2'-O-methyl modified ribonucleotides A, U, C and G, respectively; Af, Uf, Cf and Gf represent 2'-fluoro modified ribonucleotides A, U, C and G, respectively; s represents that the two nucleotides are connected by a thiophosphate backbone.

[0111] On the other hand, the present application also relates to biological materials related to the dsRNA of the present application; the biological materials related to the dsRNA of the present application can be selected from any one of the following:

[0112] (A) a DNA molecule capable of producing the dsRNA of the present application;

[0113] (B) a vector capable of expressing the dsRNA of the present application;

[0114] (C) a reagent or kit containing the dsRNA or DNA molecule of the present application or the vector;

[0115] (D) A pharmaceutical composition comprising the dsRNA molecule of the present application and other pharmaceutically acceptable components.

[0116] In some embodiments, the pharmaceutical composition includes a pharmacologically effective amount of the dsRNA molecule of the present application and other pharmaceutically acceptable components; the "effective amount" refers to the amount of the dsRNA molecule that can effectively produce the expected pharmacological therapeutic effect.

[0117] In some embodiments, "other components" include pharmaceutically acceptable carriers, such as water, saline, glucose, buffer (such as PBS), excipients, diluents, disintegrants, binders, lubricants, sweeteners, flavorings, preservatives, or combinations thereof.

[0118] In another aspect, the present application relates to dsRNA or related biological materials, which can be used to prevent and / or treat diseases mediated by the Lp(a) gene, or to alleviate the symptoms of diseases mediated by the Lp(a) gene.

[0119] In some embodiments, the present application further provides any of the following applications:

[0120] Use of the dsRNA or biological material of the present application in inhibiting Lp(a) gene expression or preparing a product for inhibiting Lp(a) gene expression.

[0121] Wherein, the inhibition of Lp(a) gene expression is to inhibit or reduce the Lp(a) gene expression level of humans or primates in cells in vivo or in vitro; the inhibition of Lp(a) gene expression is to inhibit or reduce the expression level of Lp(a) by at least 95%, 90%, 85%, 80%, 75%, 70%, 60%, 50%, 40%, 30%, 20%, 10% or 5%.

[0122] In some embodiments, the cells are mammalian cells expressing the Lp(a) gene, such as primate cells or human cells. More preferably, the target cells express high levels of the Lp(a) gene. More preferably, the target cells are derived from the brain, lung, liver, kidney, or tumor.

[0123] In some embodiments, the cells are selected from HepG2, HEP3B, Huh7, MHCC97H, Hela, cynomolgus monkey primary cells, and human primary cells.

[0124] In some embodiments, the final cellular concentration of the dsRNA molecules of the present application is 0.001-1000 nM, such as 0.001-10 nM, 10-500 nM, 25-300 nM or 50-100 nM.

[0125] In some embodiments, the dsRNA or related biological materials of the present application can be administered by any suitable means, such as parenteral administration, including intramuscular, intravenous, intraarterial, peritoneal, or subcutaneous injection; administration methods include but are not limited to single administration or multiple administration.

[0126] In some preferred embodiments, the dosage range is 0.1 mg / kg to 100 mg / kg, 0.5 mg / kg to 50 mg / kg, 3 mg / kg to 36 mg / kg, 2.5 mg / kg to 20 mg / kg, 5 mg / kg to 15 mg / kg, for example: 3 mg / kg, 4 mg / kg, 5 mg / kg, 6 mg / kg, 7 mg / kg, 8 mg / kg, 9 mg / kg, 10 mg / kg, 11 mg / kg, 12 mg / kg, 13 mg / kg g, 14mg / kg, 15mg / kg, 16mg / kg, 17mg / kg, 18mg / kg, 19mg / kg, 20mg / kg, 21mg / kg, 22mg / kg, 23mg / kg, 24mg / kg, 25m g / kg, 26mg / kg, 27mg / kg, 28mg / kg, 29mg / kg, 30mg / kg, 31mg / kg, 32mg / kg, 33mg / kg, 34mg / kg, 35mg / kg, 36mg / kg.

[0127] In some embodiments, a single dose of the pharmaceutical composition can be prolonged, for example, the reduction in Lp(a) expression lasts for at least 3, 5, 7, 10, 14, 18, 22, 25, 27, 29, 32, 35, 40, 45, 50, 55, 60 days or longer.

[0128] In some embodiments, the present application relates to the use of the dsRNA or biological material of the present application in reducing Lp(a) in serum or in preparing a method for reducing Lp(a).

[0129] Application of products with low serum Lp(a).

[0130] Wherein, the lowering of the Lp(a) concentration in serum is to lower the Lp(a) concentration in human or primate serum; for example, the concentration or content of serum Lp(a) is reduced by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 98%.

[0131] In some embodiments, the present application relates to the use of the dsRNA of the present application or the biological material of the present application in preventing and / or treating diseases mediated by the Lp(a) gene or in preparing products for preventing and / or treating diseases mediated by the Lp(a) gene;

[0132] In some embodiments, the present application relates to the use of the dsRNA of the present application or the biological material of the present application in alleviating the symptoms of a disease mediated by the Lp(a) gene or in preparing a product for alleviating the symptoms of a disease mediated by the Lp(a) gene;

[0133] In some embodiments, the Lp(a) gene-mediated disease or symptom can be caused by overexpression of the Lp(a) gene or overproduction of Lp(a) protein and can be regulated by downregulating Lp(a) gene expression. Treatment refers to alleviation, reduction, or cure of the Lp(a) gene-mediated disease or symptom, such as a decrease in serum Lp(a) levels. For example, the serum Lp(a) content or concentration is reduced by 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80%, 90%, or 95%.

[0134] On the other hand, the present application also provides methods and / or combination therapies for treating subjects suffering from a condition that would benefit from inhibiting or reducing the expression of the Lp(a) gene, such as an Lp(a)-associated disease, the method or combination therapy comprising administering the dsRNA or biological material of the present application alone or in combination with other therapeutic agents.

[0135] In certain embodiments, the present application also includes the use of the LPA-targeted dsRNA of the present application in the preparation of a medicament for treating or preventing cardiovascular diseases, including coronary artery disease, peripheral artery disease, myocardial infarction or stroke, in patients in need thereof.

[0136] In certain embodiments, the present application provides use of the LPA-targeted dsRNA of the present application in the preparation of a medicament for reducing LP(a) levels in a patient in need thereof.

[0137] The combination therapy of the present application comprises administering an RNAi agent of the present application and an additional therapeutic agent to a patient suffering from an Lp(a)-associated disease. The combination therapy of the present application reduces Lp(a) levels in the subject (e.g., by about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or about 99%).

[0138] In some embodiments, the additional therapeutic agent can be an anti-Lp(a) antibody or an antigen-binding fragment or derivative thereof.

[0139] In some embodiments, the cardiovascular disease includes but is not limited to myocardial infarction, heart failure, stroke (ischemic and hemorrhagic), atherosclerosis, coronary artery disease, peripheral vascular disease (e.g., peripheral arterial disease), cerebrovascular disease, vulnerable plaque, and aortic stenosis.

[0140] In some embodiments, a patient in need of reduced LPA expression is a patient at risk for myocardial infarction. A patient at risk for myocardial infarction can be a patient with a history of myocardial infarction (e.g., a patient who has previously suffered a myocardial infarction). A patient at risk for myocardial infarction can also be a patient with a family history of myocardial infarction or with one or more risk factors for myocardial infarction. These risk factors include, but are not limited to, hypertension, elevated non-HDL cholesterol levels, elevated triglyceride levels, diabetes, obesity, or a history of autoimmune disease (e.g., rheumatoid arthritis, lupus).

[0141] In one embodiment, the patient at risk for myocardial infarction is a patient suffering from or diagnosed with coronary artery disease.

[0142] In some embodiments, the present application also includes an LPA-targeted dsRNA for use in a method of reducing LP(a) levels in a patient in need thereof.

[0143] In some embodiments, the present application provides LPA-targeted dsRNA for use in a method of reducing the risk of myocardial infarction in a patient in need thereof.

[0144] For example, this application also provides the following optional technical solutions:

[0145] 1. A dsRNA molecule for inhibiting Lp(a) gene expression, comprising a sense strand and an antisense strand that complement each other to form a double-stranded region, wherein the sense strand and the antisense strand each comprise or consist of 15-25 nucleotides, and the antisense strand is complementary to at least 15, 16, 17, 18, 19, 20 or 21 consecutive nucleotides of the sense strand sequence shown in Table 2, and the length of the double-stranded region is 15-25 bp. Optionally, at least one nucleotide in the dsRNA molecule is modified.

[0146] 2. The dsRNA molecule according to item 1, wherein the nucleotide sequence of the sense strand and the nucleotide sequence of the antisense strand are as shown in Table 2.

[0147] 3. The dsRNA molecule according to item 1 or 2, characterized in that the modification is selected from any one or more of the following: locked nucleic acid modification, open ring or non-locked nucleic acid modification, 2′-methoxyethyl modification, 2′-O-methyl modification, 2′-O-allyl modification, 2′-C-allyl modification, 2′-fluoro modification, 2′-deoxy modification, 2′-hydroxyl modification, thiophosphate backbone modification, DNA modification, fluorescent probe modification, and ligand modification.

[0148] 4. The dsRNA molecule according to item 3, characterized in that the modification methods of the dsRNA molecule include: (1) a sense strand: 17-21 nt in length, preferably 21 nt; composed of alternating 2′-O-methyl modified regions and 2′-fluoro modified regions, each modified region being 1 to 3 nucleotides in length; the modification methods of the 5′ end and the first modified region from the 3′ end are the same; (2) an antisense strand: 19-23 nt in length, preferably 23 nt; composed of alternating 2′-O-methyl modified regions, 2′-fluoro modified regions, unmodified regions or DNA regions, each modified region being 1 to 5 nucleotides in length; and the continuous nucleotide region from the 2nd to the 5th position from the 5′ end and the continuous nucleotide region from the 1st to the 3′ end are both connected by a thiophosphate backbone.

[0149] 5. The dsRNA molecule according to item 4, wherein the structure of the sense strand of the dsRNA molecule is as shown in (A1), (A2), (A3), (A4), or (A5); and the structure of the antisense strand of the dsRNA molecule is as shown in (A6), (A7), (A8), (A9), or (A10).

[0150] 6. The dsRNA molecule according to item 5, wherein the structure of the sense strand of the dsRNA molecule is as shown in (B1), (B2), (B3), (B4), or (B5); and the structure of the antisense strand of the dsRNA molecule is as shown in (B6), (B7), (B8), (B9), or (B10).

[0151] Wherein, Am, Um, Cm and Gm represent 2′-O-methyl modified ribonucleotides A, U, C and G, respectively;

[0152] Af, Uf, Cf and Gf represent 2'-fluoro-modified ribonucleotides A, U, C and G, respectively; (s) indicates that the two nucleotides are connected by a thiophosphate backbone.

[0153] 7. The dsRNA molecule according to item 6, characterized in that: the dsRNA molecule is further modified with a ligand,

[0154] The structure of the sense strand of the modified dsRNA is shown as (C1), (C2), (C3), (C4), or (C5); the structure of the antisense strand of the dsRNA molecule is shown as (C6), (C7), (C8), (C9), or (C10):

[0155] Wherein, Am, Um, Cm and Gm represent 2'-O-methyl modified ribonucleotides A, U, C and G, respectively; Af, Uf, Cf and Gf represent 2'-fluoro modified ribonucleotides A, U, C and G, respectively; (s) indicates that the two nucleotides are connected by a phosphorothioate backbone; L96 is connected to the 3' terminal nucleotide of the dsRNA sense strand nucleotide sequence through a phosphodiester bond or a phosphorothioate diester bond; the structure of L96 and its connection mode to the sense strand nucleotide are as follows:

[0156] 8. The dsRNA molecule according to item 7, wherein the orientation is 5'->3', wherein the dsRNA molecule is selected from the following double-stranded RNA group:

[0157] 1) Justice Chain:

[0158] Antisense strand:

[0159] 2) Justice Chain:

[0160] Antisense strand:

[0161] 3) Justice Chain:

[0162] Antisense strand:

[0163] 4) Justice Chain:

[0164] Antisense strand:

[0165] 5) Justice Chain:

[0166] Antisense strand:

[0167] Wherein, Am, Um, Cm and Gm represent 2'-O-methyl modified ribonucleotides A, U, C and G, respectively;

[0168] Af, Uf, Cf and Gf represent 2'-fluoro-modified ribonucleotides A, U, C and G, respectively; (s) indicates that the two nucleotides before and after are connected by a thiophosphate backbone; L96 is connected to the 3' terminal nucleotide of the dsRNA sense chain nucleotide sequence through a phosphodiester bond or a thiophosphate diester bond.

[0169] 9. A biomaterial selected from any one of the following groups:

[0170] (A) a DNA molecule capable of producing the dsRNA according to any one of items 1 to 8;

[0171] (B) a vector capable of expressing the dsRNA according to any one of items 1 to 8;

[0172] (C) a reagent or kit comprising the dsRNA according to any one of items 1 to 8, or a DNA molecule of the dsRNA, or a vector of the dsRNA;

[0173] (D) A pharmaceutical composition consisting of the dsRNA molecule according to any one of items 1 to 8 and other pharmaceutically acceptable components.

[0174] 10. A use of dsRNA, selected from any one of the following groups:

[0175] (I) Use of the dsRNA described in any one of Items 1 to 8 or the biomaterial described in Item 9 for inhibiting Lp(a) gene expression or for preparing a product for inhibiting Lp(a) gene expression;

[0176] (II) Use of the dsRNA of any one of items 1 to 8 or the biomaterial of item 9 in a product for reducing the level of Lp(a) particles;

[0177] (III) Use of the dsRNA of any one of items 1 to 8 or the biomaterial of item 9 for preventing and / or treating a condition, pathology or syndrome associated with an elevated level of Lp(a) particles, or for the preparation of a product for preventing and / or treating a condition, pathology or syndrome associated with an elevated level of Lp(a) particles;

[0178] The diseases associated with elevated levels of Lp(a) particles include: stroke, atherosclerosis, thrombosis or cardiovascular diseases such as coronary heart disease or aortic valve stenosis, and any other diseases or pathologies associated with elevated levels of Lp(a) particles, as well as reducing the risk of developing stroke, atherosclerosis, thrombosis or cardiovascular diseases such as coronary heart disease or aortic valve stenosis, and any other diseases or pathologies associated with elevated levels of Lp(a) particles.

[0179] The innovation of the present application includes but is not limited to the following points: 1. The modified dsRNA molecules have high stability and high inhibitory activity; 2. The ligand-modified dsRNA molecules, while maintaining high inhibitory activity and stability, also have good liver targeting and the ability to promote cellular endocytosis, which can reduce the impact on other tissues or organs and reduce the amount of dsRNA molecules used, thereby achieving the purpose of reducing toxicity and reducing costs; In addition, the ligand-modified dsRNA molecules can enter target cells and target tissues without the need for transfection reagents, reducing the negative effects of transfection reagents, such as cell or tissue toxicity, thereby providing possibilities for targeted therapy. Although many modifications can be attempted to improve the performance of dsRNA, these attempts are generally difficult to mediate RNA interference and have improved stability in serum (for example, increased resistance to nucleases and / or extended duration). However, the modified dsRNA of the present application has high stability while maintaining high inhibitory activity, achieving unexpected technical effects.

[0180] definition:

[0181] As used herein, "LPA" and "Lp(a)" are used interchangeably and, depending on the context, may be used to refer to lipoprotein A or a nucleic acid molecule encoding lipoprotein A. For example, a dsRNA targeting LPA is a dsRNA targeting an LPA-encoding gene, such as a dsRNA targeting an mRNA or pre-mRNA transcribed from an LPA-encoding gene.

[0182] "G," "C," "A," "T," and "U" generally represent nucleotides based on guanine, cytosine, adenine, thymine, and uracil, respectively.

[0183] GalNAc: refers to 2-(acetylamino)-2-deoxy-D-galactopyranose, commonly referred to as N-acetylgalactosamine in the literature. References to "GalNAc" or "N-acetylgalactosamine" include both the β form: 2-(acetylamino)-2-deoxy-β-D-galactopyranose and the α form: 2-(acetylamino)-2-deoxy-α-D-galactopyranose. The β form: 2-(acetylamino)-2-deoxy-β-D-galactopyranose and the α form: 2-(acetylamino)-2-deoxy-α-D-galactopyranose can be used interchangeably. Preferably, the compound of the present application comprises the β form, i.e., 2-(acetylamino)-2-deoxy-β-D-galactopyranose.

[0184] L96: A GalNac conjugate with the following structure:

[0185] Typically, the majority of the nucleotides in each strand of a dsRNA molecule are ribonucleotides, but as described in detail herein, each strand or both strands may also include one or more non-ribonucleotides, such as deoxyribonucleotides and / or modified nucleotides. Additionally, as used herein, an "RNAi agent" may include ribonucleotides with chemical modifications; an RNAi agent may include a variety of modifications on multiple nucleotides. Such modifications may include all types of modifications disclosed herein or known in the art. Any such modifications, such as those used in dsRNA, siRNA-type molecules, are encompassed within the "RNAi agent" for the purposes of this specification and claims.

[0186] As used herein, "dsRNA" is double-stranded RNA. Since siRNA is a double-stranded RNA, the term "dsRNA" encompasses siRNA. dsRNA also includes double-stranded RNA that is longer than siRNA. The length greater than siRNA can refer to its sense strand being longer than siRNA, or its antisense strand being longer than siRNA, or its sense strand and antisense strand being longer than siRNA. After a double-stranded RNA that is generally longer than the siRNA sequence it contains enters the cell, it is broken down into siRNA by a type III endonuclease called Dicer. In some embodiments, the lengths of the two chains of the dsRNA are each independently 15 to 30 nt (in this application, "nt" refers to nucleotides). When "siRNA" is incorporated into the RNA-induced silencing complex (RISC), one or more helicases in RISC unwind the siRNA double helix. When bound to a target mRNA complementary to the antisense strand in the siRNA, one or more endonucleases in RISC cleave the target, inducing gene silencing. Typically, the majority of nucleotides in each chain of a dsRNA molecule are ribonucleotides, but this does not exclude the inclusion of one or more non-ribonucleotides, such as deoxyribonucleotides and / or non-natural nucleotides, in any one or both chains. In some embodiments, the dsRNA molecule does not include non-natural nucleotides. In some embodiments, each nucleotide in the dsRNA is a ribonucleotide. As used herein, a dsRNA may include one or more chemically modified nucleotides or may not include chemically modified nucleotides. BRIEF DESCRIPTION OF THE DRAWINGS

[0187] Figure 1: LPA gene expression in RT4 cells after administration of candidate modification sequences.

[0188] Figure 2: LPA gene expression in RT4 cells after administration of candidate modification sequences.

[0189] Figure 3: IC of chemically modified candidate molecules in Hep3B cells 50 value.

[0190] Figure 4: Percentage of serum Lp(a) levels in rhesus monkeys relative to baseline levels before administration.

[0191] Figure 5: Psicheck-2 plasmid map. DETAILED DESCRIPTION

[0192] Example 1. LPA-siRNA activity screening

[0193] 1. siRNA Design

[0194] Based on the human LPA mRNA sequence (NM_005577.4), various LPA siRNAs were designed at different sites. All designed individual siRNAs were able to target all transcripts of the target gene (as shown in Table 1). The above sequences (as shown in Table 2) showed minimal homology with all other non-target gene sequences after sequence similarity comparison using sequence similarity software. Among them, the Yangshen sequences were designed for: OLP2706, an siRNA drug developed by Amgen, and SLN2545, an siRNA drug developed by Silence Therapeutics. OLP2706 has sense and antisense strand sequence numbers 281 and 470, respectively, in WO 2021 / 119034A1. SLN2545 has sense and antisense strand sequence numbers 9 and 10, respectively, in WO 2019 / 092283A1.

[0195] Table 1 Target genes

[0196] Table 2 High-throughput screening of unmodified sequences

[0197] 2. siRNA Synthesis (Natural RNA / 2'-Methoxy or 2'-Fluoro-Modified RNA / GalNAc-RNA)

[0198] In this application, only ribonucleotides or 2'-methoxy or 2'-fluoro modified oligonucleotides were synthesized according to the theoretical yield of 1 μmol, and 1 μmol of the universal Frit vector ( All oligonucleotides (including the unmodified dsRNAs listed in Table 2 and the modified dsRNAs listed in Table 8) were prepared on an LK-192X synthesizer using CPG carriers (WuXi AppTec / Glen Research, loading capacity 30 μmol / g) containing either (Comma Biotech) or the protected GalNAc derivative L96. All phosphoramidite monomers (Shanghai Zhaowei / Chengdu Pioneer) were diluted 1:20 (g / mL) in anhydrous acetonitrile, and the coupling time was 3 min, with two couplings performed. Deprotection was performed using 3% TCA, activation was performed using 0.3 M benzylthiotetrazolyl in acetonitrile, and capping and oxidation were performed using CAPA / CAPB and 50 mM M₂ solutions, respectively. After trityl-off synthesis, the solid support was transferred to a 2 mL centrifuge tube, 1.2 mL of ammonia was added, and the tube was heated in a 65°C oven for 3 h to remove the protecting groups. The oligonucleotide was then cooled to room temperature and concentrated under vacuum for 30 minutes. The solution was then filtered through a 0.22 μm filter into a vial. Single-stranded oligonucleotides were purified using a semi-preparative reverse-phase purification system with an elution gradient of 7% to 30% (ACN:100 mM TEAA) over 10 minutes at a flow rate of 5 mL / min. After preparative purification, the oligonucleotides were concentrated under vacuum and spin-dried at room temperature. Finally, the samples were reconstituted with water, and each solution was desalted on a GE Hi-Trap desalting column to elute the final oligonucleotide product. All identities and purity were confirmed using ESI-MS and IEX HPLC, respectively. Concentration was determined using a microplate reader under UV light. Equimolar amounts of the sense and antisense strands were mixed and transferred to a new 2 mL EP tube. The product was heated at 95°C for 5 minutes, slowly annealed to room temperature, and then spin-dried using a vacuum concentrator at room temperature to obtain the final product.

[0199] 3. Detection of the inhibitory activity of LPA-siRNA in the in vitro psicheck-2 system

[0200] 1. Construction of detection plasmid

[0201] The LPA recombinant plasmid was constructed using the psicheck-2 plasmid (GenScript Biotech Co., Ltd.). The psicheck-2 plasmid was purchased from Promega. The plasmid map is shown in Figure 5 . It contains the target sequence of all the LPA siRNAs to be tested (i.e., the target sequence complementary to the antisense strand of any of the siRNAs to be tested). The cloning sites are the 5' XhoI and 3' NotI sites of the psicheck-2 plasmid.

[0202] 2. Co-transfection of LPA siRNA and recombinant plasmid

[0203] 293T cells and transfection reagents were purchased commercially. Cells were cultured in DMEM medium containing 10% fetal bovine serum in a 5% CO2, 37°C incubator. When the cells were in the logarithmic growth phase and in good condition (70% confluence), they were plated for transfection. The cell density was adjusted to 5×10 cells per well. 4 Plate cells into a 96-well plate. Prepare the transfection complex: Mix 5 μL of Opti-MEM, 8 ng of recombinant plasmid, and 1 μL of 10 μM siRNA. Then, mix 5 μL of Opti-MEM and 1 μL of Lipofectamine 2000 transfection reagent. Let stand for 5 minutes. Then, mix the two mixtures and let stand for 5 minutes. Add the transfection complex to the 96-well plate and incubate in a 5% CO2, 37°C incubator for 24 hours.

[0204] In addition to the experimental groups, the following control groups were set up for each cell transfection: NC (negative control (irrelevant siRNA), Lipo group (transfection reagent control), and Blank group (untreated control group (no siRNA added). Each experimental and control group had three replicates.

[0205] 3. DLR detection and analysis

[0206] Detection was performed using the Dual-Luciferase Reporter Assay System kit (Promega). Cells were lysed, collected, and processed according to the kit instructions. The fluorescence intensities of firefly (Photinus pyralis) and Renilla (Renilla reniformis) luciferase were measured sequentially using an InfiniteEplex microplate reader (TECAN). The ratio of Renilla (Renilla reniformis) to firefly (Photinus pyralis) luciferase fluorescence intensity was calculated and normalized to the NC group. Tables 4 and 5 show the results of three replicate DLR assays and the average expression levels of the dual-luciferase reporter gene in the LPA siRNA experimental group relative to the NC group.

[0207] Table 4 DLR test results

[0208] Table 5 DLR test results

[0209] As shown in Tables 4 and 5, a total of 387 siRNA pairs were screened in 293T cells using LPA siRNA DLR, and the top 50 siRNA molecules with higher activity were found (siRNA names are shown in Table 7), which were then subsequently screened in vitro using RT4 cells.

[0210] IV. LPA siRNA qPCR Screening

[0211] 1. LPA siRNA transfection into RT4 cells

[0212] RT4 cells were cultured in McCoy's medium containing 10% fetal bovine serum in a 5% CO2, 37°C incubator. When the cells were in the logarithmic growth phase and in good condition (70% confluence), they were plated for transfection. The cell density was adjusted to 1.5×10 cells per well. 5 Cells were plated into 24-well plates. Prepare transfection complexes: Mix 50 μL Opti-MEM and 1 μL 10nM siRNA, and 50 μL Opti-MEM and 1.5 μL RNAi Max transfection reagent, then mix the two mixtures and let them stand for 15 minutes. Add the above transfection complexes to the 24-well plate and incubate in a 5% CO2, 37°C constant temperature incubator for 48 hours. In addition to the experimental group, the following control groups were also set up for each cell transfection: NC group is a negative control (irrelevant siRNA), RNAiMax group is a transfection reagent control, and Blank group is an untreated control (no siRNA added).

[0213] 2. Real-time fluorescence quantitative PCR analysis:

[0214] 48 hours after transfection, cells were lysed and total RNA was extracted using a column extraction kit (Novagen). Real-time fluorescence quantitative PCR was performed using the Sybrgreen assay on a CFX96 fluorescence quantitative PCR instrument (Bio-Rad), using GAPDH as the internal reference gene. The primers used were:

[0215] Table 6 Primer sequence information

[0216] 3. Data Analysis

[0217] After the PCR reaction, relative quantitative analysis was performed using the 2-ΔΔCt method (Livak) with a reference gene as the standard. The results in Table 7 and Figures 1 and 2 demonstrate that 100 nM of LP4553 and LP4927 exhibited high inhibitory activity in RT4 cells, exceeding the inhibitory activity of the positive control OLP2706 by 6.9% and 5.6% respectively, and the inhibitory activity of the positive control SLN2545 by 15.5% and 14.2% respectively. It should be understood that all dsRNAs used in this example, including the positive control, were unmodified naked nucleic acid molecules.

[0218] Table 7 Inhibitory activity of the top 50 siRNA sequences

[0219] Example 2, Optimization of LPA-siRNA

[0220] 1. Hep3B cells transfected with LPA plasmid

[0221] To increase LPA expression, Hep3B cells were transfected with an LPA plasmid. A plasmid capable of transcribing LPA mRNA was constructed by inserting the full-length LPA mRNA sequence (Gene ID: 4018) into the pcDNA™ 3.1 plasmid (GenScript Biotech). After passage, Hep3B cells were grown in an incubator for 24 hours before transfection. In a 10 cm dish, 5 μL of Lipo2000 was added to 500 μL of Opti-MEM, and 10 μg of plasmid was added to 500 μL of Opti-MEM. The mixture was then allowed to stand for 5 minutes. The Lipo2000 mixture was then added to the plasmid mixture, gently pipetting three times, and allowed to stand for 10 minutes. The mixture was then added to a 10 cm dish and used for transfection 24 hours later. The top five highly active siRNA molecules were further identified and their sequences were optimized (Table 8). These sequences were then compared with the Yangshen sequence (Table 9) (Table 10).

[0222] Table 8 Top 5 highly active siRNA modified sequences

[0223] In the above table, Am, Um, Cm and Gm represent 2'-O-methyl modified ribonucleotides A, U, C and G, respectively; Af, Uf, Cf and Gf represent 2'-fluoro modified ribonucleotides A, U, C and G, respectively; s indicates that the two nucleotides are connected by a thiophosphate backbone.

[0224] Table 9 Positive reference sequence (5'->3')

[0225] In the above table, Am, Um, Cm and Gm represent 2'-O-methyl modified ribonucleotides A, U, C and G, respectively; Af, Uf, Cf and Gf represent 2'-fluoro modified ribonucleotides A, U, C and G, respectively; s indicates that the two nucleotides are connected by a thiophosphate backbone.

[0226] Table 10 Inhibitory activity of the first five modified siRNA sequences

[0227] 2. IC transfection of Hep3B cells 50 value

[0228] LP508, LP2941, LP4927, and the positive control OLP2706-modified were serially diluted with Nuclease-Free Water (Invitrogen) to various concentrations, with the highest final concentration set at 10 nM. Six 10-fold serial dilutions were performed and transfected into Hep3B cells. The LPA plasmid transfection, siRNA transfection, and quantitative PCR analysis procedures were as described in Example 1. Graphpad Prism software was used to analyze and calculate the IC 50 As shown in Figure 3, the IC values ​​of LP508-E05, LP2941-E05, LP4927-E05 and the positive control OLP2706-modified in Hep3B cells were 50 The values ​​were 1.822nM, 3.697nM, 3.671nM and 15.62nM respectively. The inhibition rates of LP508-E05, LP2941-E05 and LP4927-E05 on LPA mRNA were better than those of the positive control OLP2706-modified.

[0229] Example 3: In vivo effectiveness test in rhesus monkeys

[0230] Eight rhesus monkeys (Beijing Zhaoyan New Drug Research Center Co., Ltd.) were randomly assigned to either a positive control group or an experimental test group (OLP2706-modified, LP508-E05, LP2941-E05, LP4927-E05, or four test compounds) based on body weight and lipoprotein (Lp(a)) levels. Each group consisted of two animals, one male and one female. Prior to dosing, serum was collected and baseline Lp(a) levels were measured. The test drug was administered once (dosage 3 mg / kg, subcutaneous injection), and about 3 mL of blood was collected from the subcutaneous vein of the forelimb or hindlimb on days -1 (1 day before administration), 5, 8, 12, 15, 19, 22, 29, 36, 43, 50, 57, 64, 71, 78, 85, 92, 99, 106, 113, 120, 127, 134, 141, 148, 155, 162, and 169 (fasted overnight before blood collection, and the day of injection was day 1). The serum was separated for Lp(a) detection.

[0231] 1. Lp(a) protein detection

[0232] The serum Lp(a) protein level was measured using Human Lipoprotein A ELISA Kit (abcam, ab212165). All values ​​were normalized to the baseline value of each animal collected before administration and presented as a percentage of the starting level ( FIG4 , Table 11 ).

[0233] Table 11 Rhesus monkey serum Lp (a) change relative to the baseline level before administration

[0234] The results (Figure 4, Table 11) showed that serum Lp(a) protein levels in all four groups significantly decreased after administration compared to pre-dose levels. The OLP2706-modified (Yangshen), LP508-E05, and LP2941-E05 groups experienced a 64-84% decrease from day 19 to day 36, while the LP4927-E05 group experienced a 97%-99% decrease on day 36. Subsequently, OLP2706-modified (Yangshen), LP508-E05, and LP2941-E05 showed a rebound. Continued observation revealed that LP4927-E05 maintained a stable decrease on day 71, suppressing serum Lp(a) protein levels by 96%-99%. By day 92, the reduction in serum Lp(a) protein levels in the OLP2706-modified (Yang Shen) and LP508-E05 groups was only 17% to 38%, while the LP2941-E05 group had returned to pre-dose levels. The LP4927-E05 group continued to reduce serum Lp(a) protein levels by 92% to 94%. Therefore, even with extended sampling time to day 169, serum Lp(a) protein levels still decreased by 70% to 80%. This suggests that the long-term effect of LP4927-E05 in reducing serum Lp(a) protein levels is significantly superior to Yang Shen and other dsRNAs targeting LPAmRNA.

[0235] The above description is only a preferred embodiment, which is only used as an example and does not limit the combination of features required for implementing the present application. The title provided is not intended to limit the various embodiments of the present application. Terms such as "comprising", "containing" and "including" are not intended to limit. In addition, unless otherwise stated, plural forms are included when there is no numeral modification, and "or" and "or" mean "and / or". Unless otherwise defined herein, the meaning of all technical and scientific terms used herein is the same as that generally understood by those skilled in the art. All publications and patents mentioned in this application are incorporated herein by reference. Without departing from the scope and spirit of the present application, various modifications and variations of the described methods and compositions of the present application are obvious to those skilled in the art. Although the present application has been described by specific preferred embodiments, it should be understood that the present application claimed for protection should not be unduly limited to these specific embodiments. In fact, various variations of the described modes for implementing the present application that are obvious to those skilled in the relevant art are intended to be included in the scope of the attached items.

Claims

1. A dsRNA molecule for inhibiting Lp(a) gene expression, comprising a sense strand and an antisense strand that complement each other to form a double-stranded region, wherein the sense strand and the antisense strand each comprise or consist of 15-25 nucleotides, the antisense strand is complementary to at least 15, 16, 17, 18, 19, 20 or 21 consecutive nucleotides of the sense strand sequence shown in Table 2, the length of the double-stranded region is 15-25 bp, and optionally, at least one nucleotide in the dsRNA molecule is modified.

2. The dsRNA molecule according to claim 1, characterized in that: The nucleotide sequence of the sense strand and the nucleotide sequence of the antisense strand are selected from the sense strand and antisense strand sequences shown in Table 2.

3. The dsRNA molecule according to claim 1 or 2, characterized in that: The modification is selected from any one or more of the following: locked nucleic acid modification, open ring or non-locked nucleic acid modification, 2′-methoxyethyl modification, 2′-O-methyl modification, 2′-O-allyl modification, 2′-C-allyl modification, 2′-fluoro modification, 2′-deoxy modification, 2′-hydroxyl modification, thiophosphate backbone modification, DNA modification, fluorescent probe modification and ligand modification.

4. The dsRNA molecule according to claim 3, characterized in that: The modification methods of the dsRNA molecule include: (1) positive strand: 17-21 nt in length, preferably 21 nt; composed of 2′-O-methyl modified regions and 2′-fluoro modified regions alternately, each modified region is 1 to 10 nucleotides in length; the modification methods of the first modified region from the 5′ end and the 3′ end are the same; and the continuous nucleotide region from the 1st to 3rd position from the 5′ end is connected by a thiophosphate backbone; (2) antisense strand: 19-23 nt in length, preferably 23 nt; composed of 2′-O-methyl modified regions, 2′-fluoro modified regions, unmodified regions or DNA regions alternately, each modified region is 1 to 11 nucleotides in length; and the continuous nucleotide region from the 1st to 3rd position from the 5′ end and the continuous nucleotide region from the 1st to 3rd position from the 3′ end are both connected by a thiophosphate backbone.

5. The dsRNA molecule according to claim 1, characterized in that: The base sequences of the sense strand and antisense strand of the dsRNA molecule may be sequences selected from any one of the following groups: 1) Sense strand: CAGAGUUAUCGAGGCACAUUC (SEQ ID NO: 709), antisense strand: GAAUGUGCCUCGAUAACUCUGGC (SEQ ID NO: 710); 2) Sense strand: AGAGUUAUCGAGGCACGUACU (SEQ ID NO: 485), antisense strand: AGUACGUGCCUCGAUAACUCUGU (SEQ ID NO: 486); 3) positive strand: GAGGCACGUACUCCACCACUG (SEQ ID NO: 491), Antisense strand: CAGUGGUGGAGUACGUGCCUCGA (SEQ ID NO: 492); 4) sense strand: AGUUAUCGAGGCACAUACUCC (SEQ ID NO: 531), antisense strand: GGAGUAUGUGCCUCGAUAACUCU (SEQ ID NO: 532); and 5) Sense strand: CUGCCAAGCUUGGUCAUCUAU (SEQ ID NO: 119), antisense strand: AUAGAUGACCAAGCUUGGCAGGU (SEQ ID NO: 120).

6. The dsRNA molecule according to claim 1, characterized in that: The sequences of the sense strand and the antisense strand of the dsRNA include or are selected from any one of the following groups: 1) Justice Chain: CmsAmsGmAmGmUmUfAmUfCfGfAmGmGmCmAmCmAmUmUmCm (SEQ ID NO:9), Antisense strand: GmsAfsAmUmGmUmGmCmCmUmCmGmAmUfAmAfCmUmCmUmGmsG msCm (SEQ ID NO: 10); 2) Justice Chain: AmsGmsAmGmUmUmAfUmCfGfAfGmGmCmAmCmGmUmAmCmUm (SEQ ID NO:1) Antisense strand: AmsGfsUmAmCmGmUmGmCmCmUmCmGmAfUmAfAmCmUmCmUmsG msUm (SEQ ID NO: 2) 3) Justice Chain: GmsAmsGmGmCmAmCfGmUfAfCfUmCmCmAmCmCmAmCmUmGm (SEQ ID NO:3) Antisense strand: CmsAfsGmUmGmGmUmGmGmAmGmUmAmCfGmUfGmCmCmUmCmsG msAm (SEQ ID NO:4) 4) Justice Chain: AmsGmsUmUmAmUmCfGmAfGfGfCmAmCmAmUmAmCmUmCmCm (SEQ ID NO:5) Antisense strand: GmsGfsAmGmUmAmUmGmUmGmGmCmCmUmCfGmAfUmAmAmCmUmsC msUm (SEQ ID NO: 6); and 5) Justice Chain: CmsUmsGmCmCmAmAfGmCfUfUfGmGmUmCmAmUmCmUmAmUm (SEQ ID NO:7) Antisense strand: AmsUfsAmGmAmUmGmAmCmCmAmAmGmCfUmUfGmGmCmAmGms GmsUm (SEQ ID NO: 8); wherein Am, Um, Cm and Gm represent 2'-O-methyl modified ribonucleotides A, U, C and G, respectively; Af, Uf, Cf and Gf represent 2'-fluoro modified ribonucleotides A, U, C and G, respectively; s represents that the two nucleotides before and after are connected by a thiophosphate backbone.

7. The dsRNA molecule of claim 6, further comprising at least one asialoglycoprotein receptor (ASGPR) ligand.

8. The dsRNA molecule according to claim 7, wherein the ligand is linked to the 5' terminal or 3' terminal nucleotide of the dsRNA sense strand or antisense strand nucleotide sequence through a phosphodiester bond or a phosphorothioate diester bond.

9. The dsRNA molecule according to any one of claims 1 to 8, wherein the ASGPR ligand is one or more GalNAc derivatives linked by a divalent or trivalent branched structure.

10. The dsRNA molecule of claim 9, wherein the GalNAc derivative comprises the following structure:

11. The dsRNA molecule according to claim 10, wherein the GalNac derivative is L96, and the structure of L96 is as follows:

12. The dsRNA molecule according to claim 11, wherein the L96 is linked to the 3' terminal nucleotide of the dsRNA sense strand nucleotide sequence via a phosphodiester bond or a thiophosphodiester bond; the structure of the L96 and the manner in which it is linked to the sense strand nucleotide are as follows:

13. A use of dsRNA, selected from any one of the following groups: (I) Use of the dsRNA molecule according to any one of claims 1 to 12 in inhibiting Lp(a) gene expression or in preparing a product for inhibiting Lp(a) gene expression; (II) Use of the dsRNA molecule of any one of claims 1 to 12 in a product for reducing the level of Lp(a) particles; (III) Use of a dsRNA molecule according to any one of claims 1 to 12 for preventing and / or treating a condition, pathology or syndrome associated with elevated levels of Lp(a) particles or for preparing a product for preventing and / or treating a condition, pathology or syndrome associated with elevated levels of Lp(a) particles; Preferably, the disease associated with an elevated level of Lp(a) particles is selected from any one or more of the following: stroke, atherosclerosis, thrombosis, cardiovascular disease, and aortic valve stenosis.

Images