Methods for prognosis and treatment of glioma

Abstract

The present invention relates to a method comprising detecting LOC105375914 RNA in a glioma sample obtained from a subject, wherein an elevated level of LOC105375914 RNA as compared to a reference indicates that the subject has a high level of glioma, has a likelihood of resistance to chemotherapy, has a likelihood of relapse, and / or may have a poor prognosis. The present invention also relates to a method of treating glioma expressing LOC105375914 RNA in a subject by administering to the subject an inhibitor of the LOC-DEAH cassette helicase 15 (DHX15) complex.

Description

Technical Field

[0001] The present invention generally relates to the field of cancer detection and treatment. In particular, the present specification teaches methods for prognosis, identification and treatment of glioma in a subject. Background Art

[0002] In the U.S., cancer is the second leading cause of death after cardiovascular disease. Glioma is a brain tumor that begins with glial cells, which are supporting cells of the brain and spinal cord. Glial cells include astrocytes, oligodendrocytes and ependymal cells. Astrocytoma is a tumor that affects astrocytes, and is the most common type of glioma in both adults and children. The most widely used scheme for glioma classification and grading is the scheme of the World Health Organization (World Health Organization), in which glioma is classified into I to IV grades according to its malignancy degree. Astrocytoma can be low-grade (i.e., grade I or grade II) or high-grade (grade III or grade IV). Grade 4 astrocytoma is also referred to as glioblastoma or glioblastoma multiforme (glioblastoma multiforme, GBM).

[0003] Isocitrate dehydrogenases (IDHs), such as IDH1, are frequently mutated in a broad spectrum of cancers, including gliomas. Unexpectedly, glioma patients carrying WT-IDH1 (wild-type IDH1) exhibited worse overall survival compared with patients with IDH1 mutations. Therefore, there remains an urgent need to identify new therapeutic strategies, especially for high-grade WT-IDH1 gliomas. Therefore, understanding the molecular players / signaling that are activated in WT-IDH1 gliomas and lead to worse outcomes may help design effective targeting strategies specifically for WT-IDH1 gliomas.

[0004] The major pathway activated in these cancers is the NFκB signaling pathway. However, to date, NFκB inhibitors have not been clinically approved because blocking this pathway can lead to substantial toxicity, as NFκB is involved in many housekeeping functions. Therefore, identifying "context-specific" regulators of NFκB signaling could yield new therapeutic targets.

[0005] It would be desirable to overcome or ameliorate at least one of the above problems, or at least provide a useful alternative. Summary of the invention

[0006] Disclosed herein are methods for determining glioma prognosis in a subject, the method comprising detecting LOC105375914 RNA in a glioma sample obtained from the subject, wherein an increased level of LOC105375914 RNA compared to a reference indicates that the subject has a high-grade glioma and / or may have a poor prognosis.

[0007] Disclosed herein are methods of identifying high-grade glioma in a subject, the method comprising: detecting LOC105375914 RNA in a cancer sample obtained from the subject, wherein an increased level of LOC105375914 RNA compared to a reference indicates that the subject suffers from high-grade glioma.

[0008] Disclosed herein are methods for identifying and treating high-grade glioma in a subject, the methods comprising: a) detecting LOC105375914 RNA in a cancer sample obtained from the subject, wherein an increased level of LOC105375914 RNA compared to a reference indicates that the subject suffers from high-grade glioma; and b) administering an anti-cancer agent to the subject found to suffer from high-grade glioma to treat the high-grade glioma.

[0009] Disclosed herein is a method for predicting a likelihood of resistance to chemotherapy in a subject having a glioma, the method comprising detecting LOC105375914 RNA in a glioma sample obtained from the subject, wherein an increased level of LOC105375914 RNA compared to a reference indicates a likelihood that the subject has resistance to chemotherapy.

[0010] Disclosed herein is a method for predicting the likelihood of glioma recurrence in a subject, the method comprising detecting LOC105375914 RNA in a glioma sample obtained from the subject, wherein an increased level of LOC105375914 RNA compared to a reference indicates that the subject has a likelihood of recurrence.

[0011] Disclosed herein are methods of treating glioma in the subject by administering to the subject an inhibitor of the LOC-DEAH box helicase 15 (DHX15) complex.

[0012] Disclosed herein are methods of inhibiting glioma stem cell proliferation in a subject, the method comprising administering to the subject an inhibitor of the LOC-DEAH box helicase 15 (DHX15) complex. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Embodiments of the present invention are described below, by way of non-limiting examples only, with reference to the accompanying drawings, in which:

[0014] Figure 1: LOC was identified as a novel NFκB regulator by high-throughput lncRNA siRNA screening. A) KEGG pathways of overexpression of genes significantly differentially expressed in wtIDH1 glioma patients compared to mIDH glioma patients. B) The average relative luminescence of the lncRNA siRNA screening is shown. LOC and the positive control RIPK1 are highlighted. C) LOC expression in normal brain tissue and different types of gliomas based on RNA-seq data from CGGA. Abbreviations: O: oligodendroglioma, rO: recurrent oligodendroglioma, OA: oligodendroglioma and astrocytoma, rOA: recurrent oligodendroglioma and astrocytoma, A: astrocytoma, rA: recurrent astrocytoma, AO: anaplastic oligodendroglioma, rAO: recurrent anaplastic oligodendroglioma, AOA: anaplastic oligodendroglioma and astrocytoma, rAOA: recurrent anaplastic oligodendroglioma and astrocytoma, AA: anaplastic astrocytoma, rAA: recurrent anaplastic astrocytoma, GBM: glioblastoma, rGBM: recurrent glioblastoma, sGBM: secondary glioblastoma, control: healthy control. D) Kaplan Meier survival curves of GBM patients from LOC-high group (n=108) or LOC-low group (n=113). E) RT-qPCR analysis of LOC expression in GBM patients with high LOC expression (LOC-high) (n=20) or low LOC expression (LOC low) (n=20). The top and bottom 20 patients were selected from a group of 59 GBM patients. The data were normalized to GAPDH, and the normalized ΔΔCt values ​​were shown in log10 scale. The p value was calculated by the Student t test method. F) Kaplan Meier survival curves of GBM patients from the LOC-high group or the LOC-low group. The p value was calculated using the Gehan-Breslow-Wilcoxon test. G to H) MRI images of skulls of 3 independent GBM patients in each group before surgery day (POD), on the day of surgery (OP), and after surgical resection, followed by TMZ (TMZ) and CCRT (chemo-radiation therapy). G) Treatment history and tumor phylogeny of patients with LOC-high expression and H) patients with LOC-low expression. The circles on the line represent the days on which the indicated MRI scans were obtained. The circles on the images represent the areas from which tumor tissue was removed. Abbreviations: POD, preoperative day; OP, procedure. Days are indicated from -1D to +245D.

[0015] Figure 2: LOC promotes GBM tumorigenesis in vitro and in vivo. A) RT-qPCR analysis of LOC expression in GBM patient-derived cells with LOC knockdown delivered by lentivirus. B) Primary cells derived from GBM patients treated with DMSO or TMZ with control shRNA or two independent shRNAs targeting LOC. Cell viability was measured by ATPlite assay, and the data were normalized relative to DMSO-treated control shRNA transduced cells. C) Limiting dilution assay (LDA) of in vitro tumor sphere formation in GBM patient-derived cells with LOC knockdown. The significance of LDA clone formation was measured by linear regression analysis. D) Patient-derived GBM cells were infected with control shRNA, LOC shRNA #1, and LOC shRNA #2 vectors. Cells with or without LOC knockdown were injected intracranially into mice (n=8) and survival analysis was performed. E) Representative H&E sections of mouse brains from D.Bar, 2 mm. F) Immunofluorescence staining of the cancer stem cell marker Nestin in tumor samples derived from PDX models. G) Quantification of immunofluorescence staining for the cancer stem cell marker nestin.

[0016] Figure 3 : LOC is associated with infiltration of GAMs in the GBM tumor ecosystem. A) Next-generation sequencing flow chart including whole exome sequencing, scRNA-seq, and bulk RNA-seq from matched GBM patients. B) Mutation spectrum of hotspot mutations in eight GBM patient samples. C) Uniform manifold approximation and projection (UMAP) map of all cell populations detected in glioblastoma patients and patients with squamous cell carcinoma of the lung. Squamous cell carcinoma samples were used as controls. D) Bar graphs show the relative proportions of each cell type in six glioblastoma patients, which can be divided into LOC-low (S5, S13, S3) groups and LOC-high (S2, S4, S7) groups. GAMs, glioblastoma-associated macrophages and microglia. E) Box plots show comparisons of relative cell type proportions between patients with low and high LOC expression. The p value of Student's t test (5.38×10e-4) indicates a significant difference in the proportion of GAM cells between the two groups of patients. F) UMAP plot of all cell populations detected in glioblastoma patients, the dataset is from 10X genomics website. G) LOC expression in different cell populations obtained from F).

[0017] Figure 4: The frequency of tumor regression caused by the deletion of Gm16685 from both the tumor and host compartments is most significant. A) Schematic diagram of the syngeneic model. Gm16685 WT or KO GL261-Luc cells were injected intracranially into Gm16685 WT and KO mice (WT-WT represents WT GL261-Luc cells injected into WT mice, WT-KO represents WT GL261-Luc cells injected into KO mice, KO-WT represents KO GL261-Luc cells injected into WT mice, and KO-KO represents KO GL261-Luc cells injected into KO mice. After 3 weeks, tumor formation was monitored by bioluminescent imaging. B to C) Bioluminescent imaging of tumor size from each group of syngeneic models with specified conditions B) and Kaplan-Meier survival analysis C) (n=6 or 8 mice / group). P values ​​were calculated using the Gehan-Breslow-Wilcoxon test. D to E) Immunofluorescence staining of glioma cell marker GFAP in syngeneic model-derived tumor samples. D). E) Quantification of immunofluorescence staining of glioma cell marker GFAP. F to G) Immunofluorescence staining of GAM marker IBA1 in syngeneic model-derived tumor samples. F). G) Quantification of immunofluorescence staining of GAM marker IBA1.

[0018] Figure 5: The helicase activity of DHX15 is essential for LOC-mediated removal of PPM1 from the NFκB p65 subunit. A) DHX15 expression in normal brain tissue and gliomas of different WHO grades based on RNA-seq data from CGGA. B) Kaplan Meier survival curves of GBM patients from DHX15-high or DHX15-low groups. C) 293T WT and LOC KO cells were transfected with control vector (Ctrl vector) or tag-DHX15 (Flag-DHX15) as indicated. DHX15 was immunoprecipitated by flag antibody, and co-purified proteins were analyzed by western blotting using PPM1D and flag antibodies. D) LN18 WT and LOC KO cells were treated with TNFα for the indicated time points, and endogenous DHX15 or p65 was immunoprecipitated with antibodies against DHX15 or p65. IP samples were analyzed by subsequent immunoblotting against the indicated proteins. E) Flag-tagged WT (Flag-WT-DHX15) or helicase dead mutant (Flag-Mut-DHX15 (Flag-Mut-DHX15)) DHX15 or control vector (Ctrl vector) were ectopically expressed in 293T cells and stimulated with TNFα for the indicated time points. DHX15 was immunoprecipitated by the tag antibody and the co-purified proteins were analyzed by western blot. F) LN18 WT cells were treated with TNFα for the indicated time points and endogenous DHX15 or DKC was immunoprecipitated with antibodies against DHX15 or DKC. DHX15 or DKC RIP followed by RT-qPCR showed enrichment of co-eluted LOC. DKC was used as a negative control. The figure shows the fold enrichment normalized to IgG. G) Figure shows the expression of TNFα gene in LN18 WT and LOC KO cells transfected with empty vector (Ctrl vector) or Flag-tagged-WT-DHX15 (WT-DHX15) or Flag-tagged-mut-DHX15 (mut-DHX15) and stimulated with TNFα for 90 minutes. The data are normalized to actin. **, p<0.01; ***, p 973<0.001. The p value is calculated by using the two-tailed student t test method. H) WT and LOC KO LN18 cells are transfected with control siRNA or PPM1D siRNA. 72 hours after transfection, cells are treated with or without TNFα and harvested for western blotting. Cell lysates are analyzed by western blotting for specified proteins.

[0019] Figure 6 :LOC:DHX15 is used as a targetable vulnerability in wtIDH1 high-grade gliomas. A) LOC expression under different IDH mutation states in gliomas of different WHO grades based on RNA-seq data from CGGA. B) qPCR of LOC expression in wtIDH1 LN18 cells or mIDH1 clones. Those clones were generated by base editing. C) qPCR of LOC expression in wtIDH1 and mIDH1 LN18 cells treated with or without the mIDH1 inhibitor AGI-5198. D) qPCR of LOC expression in wtIDH1 and mIDH1 LN18 cells treated with or without the DMNT inhibitor 5-Azac. E) The levels of phosphorylated and total p65 and p38 proteins in protein lysates from wtIDH1 and mIDH1 LN18 cells were analyzed by western blotting. F) wtIDH1 and mIDH1 LN18 cells were transfected with an empty vector (EV) or an expression vector of a LOC or LOC mutant form (LOC-M2). After 48 hours, cells were harvested and endogenous DHX15 or p65 was immunoprecipitated with antibodies against DHX15 or p65. At the indicated time points, IP samples were analyzed by subsequent immunoblotting for the indicated proteins. G to H) Cell viability assays of wtIDH1 G) and mIDH1 LN18 cells H) treated with or without DHX inhibitors. I) Fluorescence imaging of wtIDH1 and mIDH1 GBM orthotopic xenograft models treated with or without DHX inhibitors. J) Quantification of tumor signal intensity obtained from I). K to J) Kaplan-Meier survival analysis of wtIDH1 GBM xenograft models K) or mIDH1 GBM xenograft models L) treated with or without DHX inhibitors.

[0020] Figure 7: The LOC:DHX15-PPM1D-NFκB axis confers TMZ resistance. A to B) WT LN18 cells were transfected with control siRNA or LOC siRNAA) or DHX15 siRNAB). Cells were treated with or without TMZ 72 hours after transfection. Cell viability was analyzed by CCK8 kit. C) WT U251 cells were transfected with Ctrl vector or expression vector of LOC. Cells were treated with or without TMZ 48 hours after transfection. Cell viability was analyzed by CCK8 kit. D) WT LN18 cells were treated with TMZ or DHX inhibitor or combination treatment. Cell viability was analyzed by CCK8 kit. E) Fluorescence imaging of wtIDH1 GBM orthotopic xenograft model treated with DHX inhibitor, TMZ or combination treatment. F) Quantification of tumor signal intensity obtained from E). G) Kaplan-Meier survival analysis of wtIDH1 GBM xenograft model treated with TMZ or DHX inhibitor or combination treatment. H) RT-qPCR analysis of MGMT expression in GBM patient-derived cells with LOC knockdown delivered by lentivirus. I) RT-qPCR analysis of MGMT expression in LN18 cells with LOC knockdown by siRNA. J) RT-qPCR analysis of MGMT expression in GBM patient-derived cells with LOC knockdown or LOC expression overexpressed in the knockdown group. K) RT-qPCR analysis of MGMT expression in WT LN18 cells treated with or without DHX inhibitor. L) WT LN18 cells were transfected with Ctrl vector or expression vector of MGMT. After 48 hours after transfection, cells were treated with or without TMZ and DHX inhibitor combination therapy. Cell viability was analyzed by CCK8 kit.

[0021] Figure 8 Shown are A) LOC expression is lost in mutant IDH1 gliomas due to mutant IDH1-mediated hypermethylation phenotype. B) In WT-IDH1 high-grade gliomas, LOC can be unfolded by RNA helicase DHX15 to activate NFκB signaling, which leads to tumor growth and chemo-resistance of WT-IDH1 gliomas. C) Inhibition of LOC unfolding by DHX inhibitors will attenuate NFκB signaling, which can attenuate tumor growth and chemo-resistance of WT-IDH1 gliomas.

[0022] Fig. 9Combination treatment of TMZ with three other RNA helicase inhibitors: Rocaglamide, DDX3-IN, and RK-33 is shown. Rocaglamide, DDX3-IN, and RK-33 showed inhibition of cell viability in GBM cells. However, combination treatment of TMZ with Rocaglamide, DDX3-IN, and RK-33 did not show synergistic inhibition of cell viability.

[0023] Figure 10: wtIDH1 gliomas exhibit higher NFκB activity. A) Mutational landscape of hotspot mutations in glioma patients based on whole exome sequencing data from 1018 CGGA. B) Kaplan Meier survival curves of wtIDH1 and mIDH1 glioma patients based on clinical data from CGGA. C) Volcano plot of TNF / NFκB signaling genes significantly differentially expressed in GBM compared with healthy controls.

[0024] Fig.11 :LOC is highly expressed in high-grade gliomas. A) LOC expression in normal brain tissue and gliomas of different WHO grades based on RNA-seq data from CGGA. B) LOC expression in gliomas of different WHO grades based on RNA-seq data from TCGA. C) RT-qPCR of LOC expression in 59 GBM patients. ddCt was normalized by Gapdh.

[0025] Figure 12: LOC regulates NFκB / p38 activation and target gene expression. A) Schematic diagram of targeting LOC1ncRNA promoter (IL7-intron) with CRISPR-Cas9 editing. NFκB binding motif is shown in yellow in the promoter region of LOC. B to C) Expression analysis of B) TNFα and C) LOC in T98G treated with DMSO, IKK2 inhibitor in the presence or absence of TNFα stimulation by RT-qPCR. D to F) LN18 wild-type (WT) and LOC KO (KO) cells were stimulated with TNFα for the specified duration. Gene expression of D) LOC and E) TNFα was analyzed by RT-qPCR. F) The levels of phosphorylated and total p65 and p38 proteins in protein lysates were analyzed by western blotting. G to I) LN18 cells were transfected with control or LOC siRNA and after 72 hours, stimulated with TNFα for a specified duration and RNA was analyzed by RT-qPCR for G) LOC transcripts and H) TNFα transcripts. I) Total cell lysates were analyzed by western blot with specified antibodies. L) T98G WT and LOC KO (KO) cells were stimulated with TNFα for a specified time point. Gene expression was analyzed by RT-qPCR for J) LOC and K) TNFα. L) Cell lysates were analyzed by western blot for specified proteins.

[0026] Fig.13 :LOC:DHX15 axis is required for NKκB activation. A) T98G WT and LOC KO cells were treated with TNFα for the indicated time points, and endogenous DHX15 or p65 was immunoprecipitated with antibodies against DHX15 or p65. IP samples were analyzed by subsequent immunoblotting for the indicated proteins. B) The figure shows TNFα gene expression in T98G WT and LOC KO cells transfected with an empty vector (Ctrl vector) or a tag-tagged-WT-DHX15 (WT-DHX15) or a tag-tagged-mut-DHX15 (mut-DHX15) and stimulated with TNFα for 90 minutes. The data were normalized to actin. **, p<0.01; ***, p<0.001; ns, not significant. P values ​​were calculated by two-tailed student t test method.

[0027] Fig.14:LOC expression is weakened in mIDH1 gliomas. A) LOC expression in gliomas with or without IDH1 mutations based on RNA-seq data from TCGA. B) Sanger sequencing results of wtIDH1 and mIDH1 clones generated by base editing. C) Protein lysates were analyzed by western blotting using anti-IDH1 (R132H) for IDH1 (R132H). D) wtIDH1 and mIDH1 LN18 cells were treated with or without DHX inhibitors. DHX15 or p65 were immunoprecipitated with antibodies against DHX15 or p65. IP samples were analyzed by subsequent immunoblotting for the specified proteins.

[0028] Fig.15 :LOC:DHX15 contributes to TMZ resistance. A to B) WT T98G cells were transfected with Ctrl siRNA or LOC siRNAA) or DHX15 siRNAB). After 72 hours after transfection, cells were treated with or without TMZ. Cell viability was analyzed by CCK8 kit. C) WT SF295 cells were transfected with Ctrl vector or expression vector of LOC. After 48 hours after transfection, cells were treated with or without TMZ. Cell viability was analyzed by CCK8 kit. D) WT T98G cells were treated with TMZ or DHX inhibitor or combination treatment. Cell viability was analyzed by CCK8 kit. DETAILED DESCRIPTION

[0029] This specification teaches methods for determining cancer prognosis in an object. Provided herein are methods and compositions for determining cancer prognosis in an object using non-coding RNA. Specifically, providing the use of non-coding RNA to determine the prognosis of glioma in an object.

[0030] Disclosed herein are methods for determining a glioma prognosis in a subject, the method comprising detecting LOC105375914 RNA in a glioma sample obtained from the subject, wherein an increased level of LOC105375914 RNA compared to a reference indicates that the subject has a high-grade glioma and / or may have a poor prognosis.

[0031] Without being bound by theory, the inventors have performed high-throughput screening of long non-coding RNA (lncRNA) to identify new regulators of NFκB from non-coding genomes. The inventors have found that RNALOC105375914 (LOC) is a new component of NFκB signaling. LOC expression is regulated by WT-IDH1 and is missing in mutant IDH1 gliomas. Once activated by IDH1, LOC positively regulates NFκB activation and glioma progression. It was determined that LOC functions as an activator of NFκB and promotes gliomagenesis, and the LOC needs to be unfolded by the action of a specific ATP-dependent RNA helicase DHX15. Unwinding of LOC by DHX15 RNA helicase is necessary for NFκB activity and growth and chemotherapy resistance of WT-IDH1 gliomas. The targeted LOC-DHX15 complex, which blocks the RNA helicase activity of DHX15 by using a small molecule inhibitor, works synergistically with temozolomide (TMZ), which is currently the standard of care for gliomas. The term "prognosis" mentioned herein refers to the prediction of the possible course and outcome of a clinical condition or disease. The prognosis of a patient is usually performed by evaluating factors or symptoms of the disease that indicate a favorable or unfavorable course or outcome of the disease. The phrase "determining the prognosis" used herein refers to the process by which a person skilled in the art can predict the course or outcome of a patient's condition. The term "prognosis" does not refer to the ability to predict the course or outcome of a condition with 100% accuracy. On the contrary, it will be understood by those skilled in the art that the term "prognosis" refers to an increased probability that a certain course or outcome will occur; that is, when compared to individuals who do not exhibit a given condition, the probability of a course or outcome being more likely to occur in a patient exhibiting the condition increases. Prognosis can be expressed as the amount of time a patient can be expected to survive. Alternatively, prognosis can refer to the likelihood that a disease will enter remission or to the amount of time a disease can be expected to maintain remission. Prognosis can be expressed in a variety of ways; for example, the prognosis can be expressed as the percentage chance that the patient will be alive after one year, five years, ten years, and so on. Or the prognosis can be expressed as the average number of months a patient can be expected to live with the condition or disease. The prognosis of a patient can be considered a relativistic expression, with many factors influencing the ultimate outcome. For example, for patients with certain conditions, the prognosis may appropriately be expressed as the likelihood that the condition is treatable or curable, or the likelihood that the disease will go into remission, whereas for patients with more severe conditions, the prognosis may more appropriately be expressed as the likelihood of surviving a specific period of time.

[0032] The term "tumor" as used herein refers to any neoplastic cell growth and proliferation (whether malignant or benign) and all precancerous and cancerous cells and tissues. The terms "cancer" and "cancerous" refer to or describe physiological conditions in mammals that are typically characterized by uncontrolled cell growth. The term "cancer" as used herein refers to non-metastatic and metastatic cancers, including early and late stage cancers. The term "precancerous" refers to a condition or growth that usually precedes or develops into a cancer. "Non-metastatic" means a cancer that is benign or remains in the primary site and has not yet penetrated into the lymphatic or vascular system or penetrated into tissues other than the primary site. In general, non-metastatic cancer is any cancer that is 0, I or II stage cancer and occasionally III stage cancer. "Early stage cancer" means non-invasive or metastatic cancer, or a cancer that is classified as 0, I or II stage. The term "late stage cancer" generally refers to III stage or IV stage cancer, but may also refer to a substage of a II stage cancer or a II stage cancer. It will be understood by those skilled in the art that the classification of II stage cancer as early stage cancer or late stage cancer depends on the specific type of cancer. Illustrative examples of cancer include, but are not limited to, glioma, breast cancer, prostate cancer, ovarian cancer, cervical cancer, pancreatic cancer, colorectal cancer, lung cancer, hepatocellular carcinoma, gastric cancer, liver cancer, bladder cancer, urinary tract cancer, thyroid cancer, kidney cancer, epithelial cancer (carcinoma), melanoma, brain cancer, non-small cell lung cancer, head and neck squamous cell carcinoma, endometrial cancer, multiple myeloma, rectal cancer and esophageal cancer. In one embodiment, the cancer is a glioma. In one embodiment, the cancer is a metastatic cancer. In one embodiment, the cancer is a chemotherapy-resistant cancer. The chemotherapy-resistant cancer can be, for example, a TMZ-resistant glioma.

[0033] The term "glioma" is used herein according to its normal usage in the art and refers to a tumor arising from glial cells or their precursors of the brain or spinal cord. Gliomas include a variety of different tumor types, including but not limited to gliomas, glioblastoma multiforme (GBM), astrocytomas, and oligodendrogliomas.

[0034] In one embodiment, the high-grade glioma is a WT-IDH1 glioma. In one embodiment, the high-grade glioma is a World Health Organization (WHO) grade III or IV glioma. In one embodiment, the high-grade glioma is a glioblastoma multiforme (GBM).

[0035] The terms "subject", "individual" and "patient" used interchangeably herein are intended to refer to any subject for which treatment or prevention is desired, preferably a mammalian subject, and even more preferably a human subject. Mammalian subjects include humans, domestic animals, farm animals, athletic animals, and zoo animals, including, for example, humans, non-human primates, dogs, cats, mice, rats, guinea pigs, etc. In most embodiments, the subject has or is suspected of having a glioma, such as a glioblastoma multiforme (GBM), an astrocytoma, or an oligodendroglioma.

[0036] The term "sample" as used herein is used in its broadest sense. In a sense, it is meant to include specimens or cultures obtained from any source, as well as biological samples and environmental samples. Biological samples can be obtained from animals (including humans) and cover fluids, solids, tissues and gases. Biological samples include blood products, such as plasma, serum, etc. However, such examples should not be construed as limiting the sample types applicable to the present disclosure.

[0037] Sample can refer to the biological sample of such fact: it is derived from or obtained from living organisms. Organism can be in vivo (such as whole organism) or can be in vitro (such as cells or organs cultured in culture). "Biological sample" also refers to cells or cell groups or a certain amount of tissue or liquid from an object. Most commonly, the sample has been removed from the object, but the term "biological sample" can also refer to cells or tissues analyzed in vivo, that is, not removed from the object. Usually, "biological sample" will include cells from the object, but the term can also refer to non-cellular biological materials, such as non-cellular fractions of blood, saliva or urine. Biological samples can be from resections of primary, secondary or metastatic tumors, bronchoscopic biopsies or core needle biopsies, or cell blocks from pleural effusions. In addition, biological samples of fine needle aspiration are also available. In one embodiment, the biological sample is ascites. Biological samples also include explants and primary and / or transformed cell cultures derived from patient tissues. A biological sample can be provided by removing a sample of cells from a subject, but can also be accomplished by using previously isolated cells or cell extracts (e.g., isolated by another person at another time and / or for another purpose). Archival tissues, such as those with a history of treatment or outcome, can also be used. Biological samples include, but are not limited to, tissue biopsies, scrapings (e.g., oral scrapings), whole blood, plasma, serum, urine, saliva, cell culture, or cerebrospinal fluid.

[0038] The term "reference" may refer to a sample from a healthy individual (eg, an individual not suffering from a glioma), or may refer to a non-cancerous sample. It may also refer to a predetermined value.

[0039] With respect to the level of LOC105375914 RNA, the term "increased" or "increased" as used herein refers to a statistically significant and measurable increase in the level of LOC105375914 RNA compared to a reference. The increase is preferably at least about 10% increase, or at least about 20% increase, or at least about 30% increase, or at least about 40% increase, or at least about 50% increase.

[0040] In one embodiment, an elevated or increased level of LOC105375914 RNA compared to a reference indicates that the subject has a high grade glioma and / or is likely to have a poor prognosis. The increase in level can be an increase compared to a reference by a factor of: 1.1 times, 1.2 times, 1.3 times, 1.4 times, 1.5 times, 1.6 times, 1.7 times, 1.8 times, 1.9 times, 2 times, 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, 10 times, 11 times, 12 times, 13 times, 14 times, 15 times, 16 times, 17 times, 18 times, 19 times, 20 times, 21 times, 22 times, 23 times, 24 times, 25 times, 26 times, 27 times, 28 times, 29 times, 30 times, 31 times, 32 times, 33 times, 34 times, 35 times, 36 times, 37 times, 38 times, 39 times, 40 times, 41 times, 42 times, 43 times, 44 times, 45 times, 46 times, 47 times, 48 ​​times, 49 times, 50 times, 51 times, 52 times, 53 times, 54 times, 55 times, 56 times, 57 times, 58 times, 59 times, 60 times, 61 times, 62 times, 63 times, 64 times, 65 times, 66 times, 67 times, 68 times, 69 times, 70 times, 71 times, 72 times, 73 times, 74 times, 75 times, 76 times, 77 times, 78 times, 79 times, 80 times, 81 times, 82 times, 83 times, 84 times, 85 times, 86 times, 87 times, 88 times, 89 times, 90 times, 91 times, 92 times, 93 times, 94 times, 95 times, 96 times, 97 times, 98 times, 99 times or 100 times or any multiple in between.

[0041] Any patient sample suspected of containing a non-coding RNA as defined herein can be tested according to the methods of the present disclosure. By way of non-limiting example, the sample can be tissue (e.g., biopsy sample), blood, plasma, serum, urine, saliva, cell culture or cerebrospinal fluid.

[0042] In some embodiments, the patient sample is subjected to a preliminary treatment that is intended to separate or enrich samples for non-coding RNA or cells containing non-coding RNA. Various techniques known to those of ordinary skill in the art can be used for this purpose, including but not limited to: centrifugation, immune capture, cell lysis, nucleic acid amplification, and nucleic acid target capture. Non-coding RNA can be detected in multiple or combined (panel) form together with other markers.

[0043] Markers can be selected based on their predictive value alone or in combination with the non-coding RNAs described herein. Additional markers for cancer, disease, infection, and metabolic conditions are also contemplated for inclusion in multiplex or combination formats.

[0044] As used herein, the term "detection" and variations thereof may describe a general act of finding or discerning or a specific observation of a composition. Detecting a composition may include determining the presence or absence of a composition. Detection may include quantifying a composition. For example, detection includes determining the expression level of a composition. A composition may include a nucleic acid molecule. For example, a composition may include at least a portion of an ncRNA disclosed herein. Alternatively or in addition, the composition may be a detectably labeled composition.

[0045] The term "gene" refers to a nucleic acid (e.g., DNA) sequence containing a coding sequence necessary for producing a polypeptide, precursor, or RNA (e.g., rRNA, tRNA). A polypeptide may be encoded by a full-length coding sequence or by any portion of a coding sequence, as long as the desired activity or functional properties (e.g., enzyme activity, ligand binding, signal transduction, immunogenicity, etc.) of the full length or fragment are retained. The term also encompasses the coding region of a structural gene and sequences adjacent to the coding region at both the 5' and 3' ends, the distance of which on either end is about 1 kb or longer, so that the gene corresponds to the length of the full-length mRNA. The sequence located at the 5' of the coding region and present on the mRNA is referred to as a 5' non-translated sequence. The sequence located at the 3' or downstream of the coding region and present on the mRNA is referred to as a 3' non-translated sequence. The term "gene" encompasses both cDNA and genomic forms of a gene. The genomic form or clone of a gene includes a coding region interspersed with a non-coding sequence referred to as an "intron" or "insertion region" or "insertion sequence." Introns are gene segments that are transcribed into nuclear RNA (hnRNA); introns may contain regulatory elements such as enhancers. Introns are removed or "spliced ​​out" from the nuclear or primary transcript; therefore, introns are not present in the messenger RNA (mRNA) transcript. mRNA functions during translation to determine the sequence or order of amino acids in a nascent polypeptide.

[0046] The terms "polynucleotide" or "nucleic acid" are used interchangeably herein to refer to a polymer of nucleotides, which may be mRNA, RNA, cRNA, cDNA or DNA. The term generally refers to a polymeric form of nucleotides of at least 10 bases in length, either ribonucleotides or deoxynucleotides or a modified form of either type of nucleotide. The term encompasses single-stranded and double-stranded forms of DNA.

[0047] The term "oligonucleotide" as used herein refers to a single-stranded polynucleotide chain of short length. Oligonucleotides are generally less than 200 residues long (e.g., 15 to 100 residues long), however, as used herein, the term is also intended to encompass longer polynucleotide chains. Oligonucleotides are generally represented by their length. For example, 24 residue oligonucleotides are referred to as "24-mers". Oligonucleotides can form secondary and tertiary structures by self-hybridization or by hybridization with other polynucleotides. Such structures may include but are not limited to duplexes, hairpins, cruciforms, bends and triplexes.

[0048] The term "label" as used herein refers to any atom or molecule that can be used to provide a detectable (preferably quantifiable) effect and can be attached to a nucleic acid or protein. Labels include, but are not limited to, dyes; radioactive labels such as 2P; binding moieties such as biotin; haptens such as digoxgenin; luminescent, phosphorescent or fluorescent moieties; and fluorescent dyes alone or in combination with moieties that can inhibit or change the emission spectrum by fluorescence resonance energy transfer (FRET). Labels can provide signals that can be detected by fluorescence, radioactivity, colorimetry, gravimetric analysis, X-ray diffraction or absorption, magnetism, enzyme activity, and the like. The label can be a charged moiety (positive or negative charge), or alternatively, can be electrically neutral. The label can include or consist of a nucleic acid or protein sequence, as long as the sequence containing the label is detectable. In some embodiments, the nucleic acid is directly detected without a label (e.g., directly reading the sequence).

[0049] As used herein, the terms "complementary" or "complementarity" are used to refer to polynucleotides (i.e., nucleotide sequences) that are related by the base pairing rules. Complementarity can be "partial," in which only some of the bases of the nucleic acids match according to the base pairing rules. Alternatively, there can be "complete" or "total" complementarity between nucleic acids. The degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands. This is particularly important in amplification reactions and detection methods that depend on binding between nucleic acids.

[0050] The term "homology" refers to a degree of complementarity. There may be partial homology or complete homology (i.e., identity). A partially complementary sequence is a nucleic acid molecule that at least partially inhibits a fully complementary nucleic acid molecule from hybridizing with a "substantially homologous" target nucleic acid. The inhibition of hybridization of a fully complementary sequence with a target sequence can be examined under low stringency conditions using hybridization assays (Southern or Northern blots, solution hybridization, etc.). Substantially homologous sequences or probes will compete and inhibit the binding (i.e., hybridization) of fully homologous nucleic acid molecules to the target under low stringency conditions. This is not to say that low stringency conditions allow nonspecific binding; low stringency conditions require that the binding of two sequences to each other is a specific (i.e., selective) interaction. The absence of nonspecific binding can be tested by using a second target that is substantially non-complementary (e.g., less than about 30% identity); in the absence of nonspecific binding, the probe will not hybridize with the second non-complementary target.

[0051] The term "hybridization" as used herein refers to the pairing of complementary nucleic acids. Hybridization and hybridization strength (i.e., the strength of association between nucleic acids) are affected by factors such as the degree of complementarity between nucleic acids, the stringency of the conditions involved, the Tm of the hybrid formed, and the G:C ratio within the nucleic acids. A single molecule containing complementary nucleic acid pairing in its structure is referred to as "self-hybridization."

[0052] The term "stringency" as used herein refers to the conditions of temperature, ionic strength and the presence of other compounds (e.g., organic solvents) for nucleic acid hybridization. Under "low stringency conditions," the target nucleic acid sequence will hybridize with: its exact complementary sequence, a sequence with a single base mismatch, a closely related sequence (e.g., a sequence with 90% or more homology), and a sequence with only partial homology (e.g., a sequence with 50% to 90% homology). Under "medium stringency conditions," the target nucleic acid sequence will hybridize only with: its exact complementary sequence, a sequence with a single base mismatch, and a closely related sequence (e.g., 90% or more homology). Under "high stringency conditions," the target nucleic acid sequence will hybridize only with: its exact complementary sequence and (depending on conditions such as temperature) with a sequence with a single base mismatch. In other words, under high stringency conditions, the temperature can be raised to exclude hybridization with a sequence with a single base mismatch.

[0053] The non-coding RNA of the present disclosure can be detected using a variety of nucleic acid techniques known to those of ordinary skill in the art, including but not limited to nucleic acid sequencing, nucleic acid hybridization, and nucleic acid amplification.

[0054] In some embodiments, nucleic acid sequencing methods are used (e.g., for detecting amplified nucleic acids). In some embodiments, the technology provided herein can be used for second generation (i.e., next generation (Next Generation) or Next-Gen), third generation (i.e., Next-Next-Gen) or fourth generation (i.e., N3-Gen) sequencing technology, including but not limited to pyrophosphate sequencing, connection sequencing, single molecule sequencing, synthetic sequencing (sequence-by-synthesis, SBS), semiconductor sequencing, massive parallel cloning, massive parallel single molecule SBS, massive parallel single molecule real-time, massive parallel single molecule real-time nanopore technology. Those of ordinary skill in the art will recognize that because RNA is less stable in cells and more susceptible to nuclease attacks, experimental RNA is usually reverse transcribed into DNA before sequencing.

[0055] Also provided herein is a device for associating the level of the non-coding RNA being studied with the prognosis of the disease outcome. Such a device may include one or more of a variety of related technologies, including a linear or nonlinear combination of a lookup table, an algorithm, a multivariate model, and an expression model or an algorithm. The level may be converted into one or more probability scores, reflecting the possibility that the patient providing the sample may show a specific disease outcome. Models and / or algorithms may be provided in a machine-readable format, and may optionally further specify a treatment mode for a patient or a patient category.

[0056] Also provided herein is an output device for outputting disease state, prognosis and / or treatment mode. Such an output device can take any form of transmitting the result to the patient and / or health care provider, and can include a monitor, a print format or both. A computer system can be used to perform one or more steps provided.

[0057] The method as defined herein may comprise detecting wild-type isocitrate dehydrogenase 1 (IDH1). Methods for detecting wild-type or mutant IDH1 nucleic acids or polypeptides are well known in the art. In one embodiment, the method as defined herein comprises detecting elevated levels of LOC105375914 RNA and wild-type isocitrate dehydrogenase 1 (IDH1).

[0058] The method as defined herein may comprise detecting NFKB Inhibitor Alpha (NFKBIA). The method as defined herein may comprise detecting a deletion of the NFKBIA gene or a reduction in the expression level of NFKBIA.

[0059] The terms "protein" and "polypeptide" are used interchangeably and refer to any polymer of amino acids (dipeptides or more) linked by peptide bonds or modified peptide bonds. Polypeptides with less than about 10 to 20 amino acid residues are generally referred to as "peptides". The polypeptides of the present invention may contain non-peptide components, such as carbohydrate groups. Carbohydrates and other non-peptide substituents may be added to the polypeptide by the cell producing the polypeptide, and will vary with the type of cell. Polypeptides are defined herein according to their amino acid backbone structure; substituents (e.g., carbohydrate groups) are generally not specified, but may still be present.

[0060] In one embodiment, high-grade gliomas may be resistant to chemotherapy.

[0061] In one embodiment, the high-grade glioma has a likelihood of cancer recurrence following cancer treatment.

[0062] Disclosed herein are methods of identifying high-grade glioma in a subject, the method comprising: a) detecting LOC105375914 RNA in a cancer sample obtained from the subject, wherein an increased level of LOC105375914 RNA compared to a reference indicates that the subject suffers from high-grade glioma.

[0063] In one embodiment, the method classifies a subject into a subject having a high grade glioma or a low grade glioma.

[0064] Disclosed herein is a method for predicting the likelihood of resistance to chemotherapy in a subject having a glioma, the method comprising detecting LOC105375914 RNA in a glioma sample obtained from the subject, wherein an increased level of LOC105375914 RNA compared to a reference indicates that the subject has a likelihood of resistance to chemotherapy.

[0065] Disclosed herein is a method for predicting the likelihood of glioma recurrence in a subject, the method comprising detecting LOC105375914 RNA in a glioma sample obtained from the subject, wherein an increased level of LOC105375914 RNA compared to a reference indicates that the subject has a likelihood of recurrence.

[0066] The term "recurrence" as used herein may refer to a cancer that has recurred (comes back) after a period of time, usually when the cancer cannot be detected. The cancer may be referred to as a recurrent cancer. A recurrent cancer may recur to the same location as the original (primary) tumor or to another location in the body. When the cancer is in the same location or very close to the original cancer, the recurrence may be considered a "local recurrence". When a tumor has grown into lymph nodes or tissues near the original cancer, the recurrence may be a "regional recurrence". When cancer has spread to an organ or tissue far away from the original cancer, the recurrence may be referred to as a distant recurrence. When cancer spreads to distant locations of the body, a recurrent cancer may be referred to as a metastasis or metastatic cancer.

[0067] The term "likelihood of recurrence" can refer to how likely it is that cancer will recur in a subject. An increase in LOC105375914 RNA levels compared to a reference can indicate a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 99% or higher likelihood of recurrence in a subject.

[0068] Disclosed herein are methods for identifying and treating high-grade glioma in a subject, the methods comprising: a) detecting LOC105375914 RNA in a cancer sample obtained from the subject, wherein an increased level of LOC105375914 RNA compared to a reference indicates that the subject suffers from high-grade glioma; and b) administering an anti-cancer agent to the subject found to suffer from high-grade glioma to treat the high-grade glioma.

[0069] In one embodiment, the method includes treating a subject. As used herein, the term "treating" may refer to (1) preventing or delaying the onset of one or more symptoms of a disorder; (2) inhibiting the occurrence of a disorder or one or more symptoms of a disorder; (3) alleviating a disorder, i.e., causing regression of a disorder or at least one or more symptoms of a disorder; and / or (4) causing a reduction in the severity of one or more symptoms of a disorder.

[0070] When implementing the treatment and / or prevention methods described herein, any suitable method of administration or route can be used to deliver the active agent. In some embodiments, systemic administration can be adopted. "Systemic administration" means administering the active agent so that it enters the circulatory system, for example, by enteral, parenteral, inhalation or transdermal routes. Enteral administration routes involve the gastrointestinal tract, and include but are not limited to oral, sublingual, buccal and rectal delivery. Parenteral administration routes include routes other than the gastrointestinal tract, and include but are not limited to intravenous, intramuscular, intraperitoneal, intrathecal and subcutaneous.

[0071] In some embodiments (including but not limited to those in which one or more agents used cannot penetrate the blood-brain barrier), local administration can be used. "Local administration" means that the pharmaceutical composition is directly administered to the place where its effect is desired (e.g., at or near the site of a glioma), such as by intracranial (e.g., intracerebral) delivery, such as by direct intratumoral injection. For example, in some embodiments, pressure-driven infusion through an intracranial catheter, also known as convection-enhanced delivery (CED), can be used.

[0072] The selection of an appropriate route of administration is within the skill of one of ordinary skill in the art, taking into account the nature of the particular active agent used and the nature of the particular glioma to be treated.

[0073] The term "effective amount" or "therapeutically effective amount" as used herein refers to an amount of an active agent described herein that is sufficient to achieve or contribute to achieving one or more desired clinical outcomes, such as those described in the "treatment" and "prevention" descriptions above. In any individual case, an appropriate "effective" amount can be determined using standard techniques known in the art (e.g., dose escalation studies), and can be determined taking into account factors such as the desired route of administration (e.g., systemic vs. intracranial), the desired frequency of dosing, etc. In addition, an "effective amount" can be determined in the context of the co-administration method used.

[0074] The method may include administering to the subject an effective amount of an anticancer agent. The anticancer agent may be a standard of care chemotherapy. The anticancer agent may be temozolomide (TMZ).

[0075] As used herein, temozolomide (TMZ) (also known as and ) is an oral alkylating agent. TMZ is a derivative of imidazotetrazine and is a prodrug of MTIC (3-methyl-(triazene-1-yl)imidazole-4-carboxamide). TMZ undergoes rapid chemical conversion to the active compound MTIC (monomethyltriazene imidazolecarboxamide) in the systemic circulation at physiological pH. A non-limiting example of a TMZ analog is MTIC. Other examples of TMZ analogs are disclosed, for example, in US 6,844,434 and US 7,087,751.

[0076] In one embodiment, the anticancer agent is a chemotherapeutic agent. The anticancer agent can be an alkylating agent. Exemplary alkylating agents include, but are not limited to, nitrogen mustard, cyclophosphamide, ifosfamide, melphalan, chlorambucil, busulfan, and thiotepa, and nitrosourea alkylating agents such as carmustine and lomustine. In one embodiment, the anticancer agent is a platinum drug. Exemplary platinum drugs include, but are not limited to, cisplatin, carboplatin, oxaliplatin, satraplatin, picoplatin, nedaplatin, triplatin, and lipoplatin. In one embodiment, the anticancer agent is an antimetabolite. Exemplary antimetabolites include, but are not limited to, 5-fluorouracil (5-FU), 6-mercaptopurine (6-MP), capecitabine Cytarabine Floxuridine, fludarabine, gemcitabine Hydroxyurea, methotrexate, and pemetrexed In one embodiment, the anticancer agent is an antitumor antibiotic. Anthracyclines are antitumor antibiotics that interfere with enzymes involved in DNA replication. Exemplary anthracyclines include, but are not limited to, daunorubicin, doxorubicin, epirubicin, and idarubicin. Other antitumor antibiotics include actinomycin-D, bleomycin, mitomycin C, and mitoxantrone. In one embodiment, the anticancer agent is a topoisomerase inhibitor. Exemplary topoisomerase inhibitors include, but are not limited to, doxorubicin, topotecan, irinotecan (CPT-11), etoposide (etoposide) (VP-16), teniposide, and mitoxantrone. In one embodiment, the anticancer agent is a mitotic inhibitor. Exemplary mitotic inhibitors include, but are not limited to, paclitaxel. Docetaxel Ixabepilone Vinblastine Vincristine Vinorelbine and estramustine In one embodiment, the anticancer agent is a platinum-based chemotherapeutic agent, such as oxaliplatin.

[0077] Disclosed herein are methods of treating glioma in a subject by administering to the subject an inhibitor of the LOC-DEAH box helicase 15 (DHX15) complex.

[0078] As used herein, "inhibitor" is a molecule that binds to a substrate and reduces its activity. Such a substrate can be an enzyme, protein or small molecule. Blocking the activity of a substrate can kill pathogens or correct metabolic imbalances. The binding of an inhibitor can prevent another molecule (biomolecule) from entering the active site of a substrate and / or hinder the substrate from catalyzing its reaction. Inhibitor binding is reversible or irreversible. Irreversible inhibitors usually react with a substrate and chemically change it (e.g., by covalent bond formation). These inhibitors modify the key amino acid residues required for enzymatic activity. In contrast, reversible inhibitors are non-covalently bound and produce different types of inhibition according to binding and complexing. For example, inhibition can be competitive, uncompetitive, non-competitive or mixed.

[0079] As used herein, "inhibition" refers to the act of reducing the activity of a substrate as described above. This action can be performed by a molecule that can be an inhibitor.

[0080] In one embodiment, the inhibitor of the LOC-DHX15 complex is a DHX inhibitor. The DHX inhibitor can be, for example, YK-4-279. The DHX inhibitor can be a DHX15 inhibitor. Alternatively, the inhibitor of the LOC-DHX15 complex can be a LOC inhibitor.

[0081] As referred to herein, inhibitors include and encompass any agent that reduces the accumulation, function or stability of DHX or reduces the expression of the DHX gene. The inhibitor may also include any agent that reduces the accumulation, function or stability of LOC RNA or reduces the expression of the LOC gene. The inhibitor may also include any agent that directly disrupts the LOC-DHX15 interaction. Such inhibitors include, but are not limited to, small molecules and macromolecules, such as nucleic acids, peptides, polypeptides, peptide mimetics, carbohydrates, polysaccharides, lipopolysaccharides, lipids or other organic (carbon-containing) or inorganic molecules.

[0082] In some embodiments, a DHX inhibitor is an antagonist nucleic acid molecule that acts to inhibit the transcription or translation of a DHX transcript. Representative transcripts of this type include nucleotide sequences corresponding to any of the following sequences: (1) a human DHX nucleotide sequence as set forth, for example, in GenBank Accession No. NM_001358.3; (2) a nucleotide sequence that shares at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% sequence identity with any of the sequences mentioned in (1); (3) a nucleotide sequence that hybridizes to the sequence mentioned in (1) under at least low, medium or high stringency conditions; (4) a nucleotide sequence encoding any of the following amino acid sequences: No.O43143.2 shows the human DHX amino acid sequence; (5) encoding a sequence having at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% sequence similarity with any of the sequences mentioned in (4). and nucleotide sequences encoding amino acid sequences that have at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% sequence identity with any of the sequences mentioned in (4).

[0083] Illustrative antagonistic nucleic acid molecules include antisense molecules, aptamers, ribozymes and triplex forming molecules, RNAi and external guide sequences. The nucleic acid molecules can act as effectors, inhibitors, regulators and stimulators of a specific activity possessed by a target molecule, or functional nucleic acid molecules can have de novo activity independent of any other molecules.

[0084] Antagonistic nucleic acid molecules can interact with any macromolecule (e.g., DNA, RNA, polypeptide, or carbohydrate chain). Thus, antagonistic nucleic acid molecules can interact with DHX mRNA or genomic DNA of DHX, or they can interact with DHX polypeptides. Typically, antagonistic nucleic acid molecules are designed to interact with other nucleic acids based on sequence homology between target molecules and antagonistic nucleic acid molecules. In other cases, the specific recognition between antagonistic nucleic acid molecules and target molecules is not based on sequence homology between antagonistic nucleic acid molecules and target molecules, but on the formation of a tertiary structure that allows specific recognition to occur.

[0085] In some embodiments, antisense RNA or DNA molecules are used to directly block the translation of DHX by binding to target mRNA and preventing protein translation. Antisense molecules are designed to interact with target nucleic acid molecules through typical or atypical base pairing. The interaction between antisense molecules and target molecules can be designed to promote the destruction of target molecules through RNAseH-mediated RNA-DNA hybrid degradation, for example. Alternatively, antisense molecules can be designed to interrupt processing functions that usually occur on target molecules, such as transcription or replication. Antisense molecules can be designed based on the sequence of the target molecule. There are a large number of methods for optimizing antisense efficiency by finding the most accessible region of the target molecule. Non-limiting methods include in vitro selection experiments and DNA modification studies using DMS and DEPC. In some specific examples, antisense molecules are used with less than or equal to 10 -6 , 10 -8 , 10 -10 or 10 -12 The dissociation constant (K d ) binds to the target molecule. In some embodiments, antisense oligodeoxyribonucleotides derived from the translation start site (e.g., the region between -10 and +10) are used.

[0086] Aptamers are molecules that interact with target molecules in a specific way. Aptamers are usually small nucleic acids with a length of 15 to 50 bases that are folded into defined secondary and tertiary structures (e.g., stem-loops or G-quadruplexes). Aptamers can bind small molecules (e.g., ATP and theophylline) as well as macromolecules (e.g., reverse transcriptase and thrombin). Aptamers can be expressed in small molecules with a size of less than 10 -12 The aptamer binds very tightly to the target molecule with a Kd of less than 10 -6 , 10 -8 , 10 -10 or 10 -12Aptamers can bind to a target molecule with a very high degree of specificity. For example, aptamers have been isolated that have a greater than 10,000-fold difference in binding affinity between a target molecule and another molecule that differs at only a single position on the molecule. d The ratio is the K of the molecule bound to the background d A suitable method for generating aptamers for a target of interest (e.g., PHD, FIH-1, or vHL) is "Systematic Evolution of Ligands by EXponential Enrichment, SELEX TM ). SELEX TM Methods are described in U.S. Patent No. 5,475,096 and U.S. Patent No. 5,270,163 (also see WO 91 / 19813). In brief, a nucleic acid mixture is contacted with a target molecule under conditions conducive to binding. Unbound nucleic acid is separated from bound nucleic acid, and the nucleic acid-target complex is dissociated. Then, the dissociated nucleic acid is amplified to produce a ligand-rich nucleic acid mixture, which is subjected to repeated cycles of binding, distribution, dissociation and amplification as required to produce a high-affinity nucleic acid ligand highly specific to the target molecule.

[0087] In other embodiments, anti-DHX ribozymes can be used to catalyze the specific cleavage of DHX RNA. The mechanism of ribozyme action involves sequence-specific hybridization of ribozyme molecules with complementary target RNA, followed by cleavage by endonucleases. There are several different types of ribozymes that catalyze nuclease or nucleic acid polymerase type reactions, which are based on ribozymes present in natural systems, such as hammerhead ribozymes, hairpin ribozymes, and Tetrahymena ribozymes. There are also many ribozymes that do not exist in natural systems, but have been modified to catalyze specific reactions from scratch. Representative ribozymes cleave RNA or DNA substrates. In some embodiments, ribozymes that cut RNA substrates are used. The specific ribozyme cleavage site in the potential RNA target is initially identified by scanning the ribozyme cleavage site of the target molecule, which includes the following sequences: GUA, GUU, and GUC. Once identified, the predicted structural features of the short RNA sequence of 15 to 20 ribonucleotides corresponding to the target gene region containing the cleavage site can be evaluated (for example, a secondary structure that can make the oligonucleotide sequence inappropriate). The suitability of candidate targets can also be assessed by testing their accessibility for hybridization to complementary oligonucleotides using ribonuclease protection assays.

[0088] A functional nucleic acid molecule that forms a triplex is a molecule that can interact with a double-stranded or single-stranded nucleic acid. When a triplex molecule interacts with a target region, a structure called a triplex is formed, in which three DNA strands form a complex that relies on both Watson-Crick and Hoogsteen base pairing. Triplex molecules are preferred because they can bind to the target region with high affinity and specificity. It is generally desirable that triplex-forming molecules have a molecular mass of less than 10 -6 , 10 -8 , 10 -10 or 10 -12 K d Bind to target molecule.

[0089] The external guide sequence (EGS) is a molecule that binds to a target nucleic acid molecule to form a complex, and the complex is recognized by RNase P, which cuts the target molecule. EGS can be designed to specifically target the selected RNA molecule. RNase P helps to process the transfer RNA (tRNA) in the cell. By using EGS, bacterial RNase P can be recruited to cut almost any RNA sequence, and the EGS causes the target RNA:EGS complex to mimic the natural tRNA substrate. Similarly, RNA cleavage guided by eukaryotic EGS / RNase P can be used to cut the desired target in eukaryotic cells.

[0090] In other embodiments, RNA molecules that mediate RNA interference (RNA interference, RNAi) of the DHX gene or DHX transcript can be used to reduce or eliminate gene expression. RNAi refers to the interference or destruction of the product of the target gene by introducing single-stranded RNA or usually double-stranded RNA (double-stranded RNA, dsRNA) homologous to the target gene transcript. RNAi methods, including double-stranded RNA interference (double-stranded RNA interference, dsRNAi) or small interfering RNA (small interfering RNA, siRNA), have been widely documented in many organisms, including mammalian cells and the nematode Caenorhabditis elegans (C.elegans) (Fire et al., 1998. Nature 391, 806-811). In mammalian cells, RNAi can be triggered by small interfering RNA (siRNA) duplexes of 21 to 23 nucleotides (nt) (Chiu et al., 2002 Mol. Cell. 10:549-561; Elbashir et al., 2001. Nature 411:494-498), or micro-RNA (miRNA), functional small hairpin RNA (shRNA) or other dsRNA expressed in vivo using a DNA template with an RNA polymerase III promoter.

[0091] (Zeng et al., 2002. Mol. Cell 9: 1327-1333; Paddison et al., 2002. GenesDev. 16: 948-958; Lee et al., 2002. Nature Biotechnol. 20: 500-505; Paul et al., 2002. Nature Biotechnol. 20: 505-508; Tuschl, T., 2002. Nature Biotechnol. 20: 440-448; Yu ct al., 2002. Proc. Natl. Acad. Sci. USA 99(9): 6047-6052; McManus et al., 2002. RNA 8: 842-850; Sui et al. al., 2002.Proc.Natl.Acad.Sci.USA 99(6):5515-5520).

[0092] In some specific embodiments, dsRNA itself and in particular a dsRNA-producing construct corresponding to at least a portion of the DHX gene are used to reduce or eliminate its expression. RNAi-mediated inhibition of gene expression can be achieved using any technique reported in the art, such as by transfecting a nucleic acid construct encoding a stem-loop or hairpin RNA structure into the genome of a target cell, or by expressing a transfected nucleic acid construct having homology with a DHX gene between convergent promoters, or as a head-to-head or tail-to-tail replication behind a single promoter. Any similar construct can be used, as long as it produces a single RNA with the ability to fold itself and produce dsRNA, or as long as it produces two independent RNA transcripts, which are then annealed to form a dsRNA with homology to the target gene.

[0093] RNAi does not require absolute homology, with a lower threshold being described as about 85% homology for dsRNAs of about 200 base pairs (Plasterk and Ketting, 2000, Current Opinion in Genetics and Dev. 10: 562-67). Thus, RNAi encoding nucleic acids may vary in the level of homology they contain to the target gene transcript, depending on the length of the dsRNA, i.e., 100 to 200 base pairs where the dsRNA has at least about 85% homology to the target gene, and longer dsRNAs, i.e., 300 to 100 base pairs where the dsRNA has at least about 75% homology to the target gene. Constructs expressing RNA encoding a single RNA transcript designed to anneal to a separately expressed RNA or a single construct expressing a single transcript from a convergent promoter are suitably at least about 100 nucleotides in length. Constructs expressing RNA encoding a single RNA designed to form a dsRNA by internal folding are typically at least about 200 nucleotides in length.

[0094] If the dsRNA produced is specific to the gene product in the cell lineage of targeted destruction, the promoter for expressing the construct forming the dsRNA can be any type of promoter. Alternatively, the promoter can be lineage-specific because it is only expressed in cells of a specific developmental lineage. This can be advantageous when it is observed that there are some homology overlaps with genes expressed in non-targeted cell lineages. The promoter can also be induced by externally controlled factors or by intracellular environmental factors.

[0095] In some embodiments, RNA molecules of about 21 to about 23 nucleotides can be used to mediate RNAi, which directly cleaves the specific mRNA corresponding thereto, as described, for example, in Tuschll et al., U.S. 2002 / 0086356. Such 21 to 23 nucleotide RNA molecules can contain a 3' hydroxyl group, can be single-stranded or double-stranded (as two 21 to 23 nt RNAs), wherein the dsRNA molecules can be blunt-ended or contain overhanging ends (e.g., 5', 3').

[0096] In some embodiments, the antagonist nucleic acid molecule is siRNA. siRNA can be prepared by any suitable method. For example, reference may be made to International Publication WO 02 / 44321, which discloses siRNAs that can sequence-specifically degrade target mRNA when paired with 3' protruding terminal bases, which is incorporated herein by reference. Sequence-specific gene silencing can be achieved in mammalian cells using synthetic, short double-stranded RNAs that simulate siRNAs produced by dicer enzymes. siRNAs can be chemically synthesized or synthesized in vitro, or can be the result of short double-stranded hairpin-like RNAs (shRNAs) being processed into siRNAs inside cells. Algorithms and conventional DNA / RNA synthesizers are typically used to design synthetic siRNAs. Suppliers include

[0097] Ambion (Austin, Tex.), ChemGenes (Ashland, Mass.), Dharmacon (Lafayette, Colo.), Glen Research (Sterling, Va.), MWB Biotech (Esbersberg, Germany), Proligo (Boulder, Colo.), and Qiagen (Vento, The Netherlands).

[0098] Kits (such as Ambion's SILENCER TM siRNA was synthesized in vitro using siRNA Construction Kit.

[0099] The production of siRNA from a vector is more commonly accomplished by transcription of short hairpin RNA (shRNA). Kits are available for producing vectors containing shRNA, such as, for example, the GENESUPPRESSOR from Imgenex. TM Construction kit and Invitrogen's BLOCK-IT TM Inducible RNAi plasmids and lentiviral vectors. In addition, methods for preparing siRNA and delivering it to a subject are also known in the art. See, for example,

[0100] US 2005 / 0282188; US 2005 / 0239731; US ​​2005 / 0234232; US 2005 / 0176018; US2005 / 0059817; US 2005 / 0020525; US 2004 / 0192626; US 2003 / 0073640; US 2002 / 0150936; US 2002 / 0142980; and US2002 / 0120129.

[0101] Each of which is incorporated herein by reference.

[0102] The present invention also contemplates small molecule agents that bind to or reduce the RNA helicase activity of DHX. Candidate agents cover many chemical categories, but they are generally organic molecules, preferably small organic compounds with a molecular weight greater than 50 and less than about 2,500 Daltons. Candidate agents contain functional groups (especially hydrogen bonds) necessary for structural interactions with proteins, and generally include at least one amine, carbonyl, hydroxyl or carboxyl, desirably including at least two chemical functional groups. Candidate agents generally include cyclic carbocyclic or heterocyclic structures, or aromatic or polycyclic aromatic structures substituted with one or more of the above functional groups. Candidate agents are also present in biomolecules, including but not limited to: peptides, carbohydrates, fatty acids, steroids, purines, pyrimidines, derivatives, structural analogs or combinations thereof.

[0103] Small (non-peptide) molecule modulators of DHX are particularly advantageous. In this regard, small molecules are desirable because such molecules are more easily absorbed after oral administration, have fewer potential antigenic determinants, or are more likely to pass through cell membranes than larger protein-based drugs. Small organic molecules may also have the ability to enter appropriate cells and affect gene expression (e.g., by interacting with regulatory regions or transcription factors involved in gene expression); or affect the activity of genes by inhibiting or enhancing the binding of auxiliary molecules.

[0104] Alternatively, libraries of natural compounds in the form of bacterial, fungal, plant and animal extracts are available or easily generated. In addition, natural or synthetically produced libraries and compounds are easily modified by conventional chemical, physical and biochemical methods and can be used to generate combinatorial libraries. Known pharmacological agents can be subjected to directed or random chemical modifications (e.g., acylation, alkylation, esterification, amidation, etc.) to produce structural analogs.

[0105] Screening can also be directed to known pharmacologically active compounds and their chemical analogs. Screening for DHX inhibitors according to the present invention can be achieved by any suitable method. For example, the method may include contacting cells expressing polynucleotides corresponding to genes encoding DHX with agents suspected of having regulatory activity and screening for the following: regulation of the level or functional activity of DHX, or regulation of the level of transcripts encoded by the polynucleotides, or regulation of the activity or expression of downstream cellular targets (hereinafter referred to as target molecules) of polypeptides or transcripts. Detection of such regulation can be achieved using techniques including but not limited to: ELISA, cell-based ELISA, inhibition ELISA, Western blotting, immunoprecipitation, slot blot or dot blot assays, immunostaining, RIA, scintillation proximity assays, fluorescent immunoassays using antigen-binding molecule conjugates or antigen conjugates of fluorescent substances (e.g., fluorescein or rhodamine), Ouchterlony bidirectional diffusion analysis, immunoassays using avidin-biotin or streptavidin-biotin detection systems, and nucleic acid detection assays, including reverse transcriptase polymerase chain reaction (RT-PCR).

[0106] It should be understood that the polynucleotides regulating or expressing DHX may be naturally present in the cells as the test object, or may be introduced into the host cell for the purpose of testing. In addition, the naturally occurring or introduced polynucleotides may be constitutively expressed, thereby providing a model of a medicament that can be used to screen for the expression of the coded product of the down-regulation sequence, wherein the down-regulation may be at the nucleic acid or expression product level. In addition, with respect to the introduction of the polynucleotide into the cell, the polynucleotide may comprise the entire coding sequence encoding DHX, or it may comprise a portion of the coding sequence (e.g., the active site of DHX) or a portion (e.g., the DHX promoter) that regulates the expression of the corresponding gene encoding DHX. For example, a promoter naturally associated with the polynucleotide may be introduced into the cell as the test object. In this case, when only a promoter is utilized, the regulation of detecting promoter activity may be achieved, for example, by operably linking the promoter to a suitable reporter polynucleotide, which includes, but is not limited to, green fluorescent protein (green fluorescent protein, GFP), luciferase, β-galactosidase, and catecholamine acetyl transferase (catecholamine acetyl transferase, CAT). Modulation of expression can be determined by measuring the activity associated with the reporter polynucleotide.

[0107] These methods provide a mechanism for high throughput screening of putative modulators (e.g., proteins or non-protein agents comprising synthetic, combinatorial, chemical, and natural libraries). These methods will also help detect agents that bind to polynucleotides encoding target molecules or that regulate the expression of upstream molecules and subsequently regulate the expression of polynucleotides encoding target molecules. Therefore, these methods provide a mechanism for detecting agents that directly or indirectly regulate the expression or activity of target molecules according to the present invention.

[0108] The compounds can be further tested in animal models to identify those with the most potent in vivo effects. These molecules can serve as "lead compounds" for further drug development, such as through sequential modification of compounds, molecular modeling, and other conventional procedures used in rational drug design.

[0109] The methods defined herein may also include administering chemotherapy to the subject. The chemotherapy may be standard of care chemotherapy. For example, the chemotherapy may be temozolomide (TMZ). The chemotherapy may be an anticancer agent as described herein.

[0110] In one embodiment, the method includes inhibiting glioma stem cells in a subject. The glioma stem cells can be stem cells expressing LOC105375914 RNA. The glioma stem cells can be cells expressing elevated levels of LOC105375914 RNA.

[0111] In one embodiment, an inhibitor of the LOC-DHX15 complex is provided for use in the preparation of a medicament for treating glioma in a subject.

[0112] In one embodiment, there is provided a use of an inhibitor of the LOC-DHX15 complex for the preparation of a medicament for treating glioma in a subject.

[0113] In certain embodiments, the present invention provides compositions, such as pharmaceutical compositions. The term "pharmaceutical composition" as used herein refers to a composition comprising at least one active agent described herein and one or more other components that can be used to formulate a composition for delivery to a subject, such as a diluent, a buffer, saline (e.g., phosphate buffered saline), a cell culture medium, a carrier, a stabilizer, a dispersant, a suspending agent, a thickening agent, an excipient, a preservative, etc. A "pharmaceutical composition" allows for the biological activity of the active agent and does not contain components that are unacceptably toxic to the living subject to which the composition will be administered.

[0114] Provided herein are pharmaceutical compositions comprising inhibitors of the LOC-DEAH box helicase 15 (DHX15) complex. The pharmaceutical composition may also comprise TMZ. The pharmaceutical composition may comprise a pharmaceutically acceptable carrier. "Pharmaceutically acceptable carrier" means a pharmaceutical carrier comprising a substance that is not biologically or otherwise undesirable, i.e., the substance can be administered to a subject together with the selected active agent without causing any or substantial adverse reactions. The carrier may include excipients and other additives, such as diluents, detergents, colorants, wetting agents or emulsifiers, pH buffers, preservatives, and the like.

[0115] Representative pharmaceutically acceptable carriers include any and all solvents, dispersion media, coatings, surfactants, antioxidants, preservatives (e.g., antibacterial agents, antifungal agents), isotonic agents, absorption delaying agents, salts, preservatives, drugs, drug stabilizers, gelling agents, binders, excipients, disintegrants, lubricants, sweeteners, flavoring agents, dyes, the like, and combinations thereof, as known to those of ordinary skill in the art (see, e.g., Remington's Pharmaceutical Sciences, 18th Ed. Mack Printing Company, 1990, pp. 1289-1329, which is incorporated herein by reference). Unless any conventional carrier is incompatible with the active ingredient, its use in the pharmaceutical composition is contemplated.

[0116] The pharmaceutical composition can be in a variety of dosage forms, for example, tablets, capsules, liquids, solutions, soft gels, suspensions, emulsions, syrups, elixirs, tinctures, films, powders, hydrogels, ointments, pastes, creams, lotions, gels, mousses, foams, lacquers, sprays, aerosols, inhalants, atomizers, eye drops, patches, suppositories and / or enemas. The choice of dosage form and excipients will depend on the active agent to be delivered and the specific disease or condition to be treated or prevented, and can be selected by one of ordinary skill in the art without any undue experimentation.

[0117] Also provided herein are compositions for carrying out one or more of the methods as defined herein. The compositions may comprise probes, amplification oligonucleotides, and the like.

[0118] Also provided herein are kits for performing one or more of the methods defined herein. The kits may comprise probes, amplification oligonucleotides, etc. The kits may also comprise one or more buffers and reagents, and instructions for use.

[0119] As used herein, "and / or" refers to and encompasses any and all possible combinations of one or more of the associated listed items, as well as the lack of combination when interpreted in the alternative (or).

[0120] As used in this application, unless the context clearly dictates otherwise, the singular includes plural references. For example, the term "agent" includes a plurality of agents, including mixtures thereof.

[0121] Throughout this specification and the accompanying statements, unless the context requires otherwise, the word "comprise" and variations will be understood to imply the inclusion of stated integers or steps or groups of integers or steps but not the exclusion of any other integers or steps or groups of integers or steps.

[0122] Reference in this specification to any previous publication (or information derived therefrom) or any known matter is not and should not be taken as an acknowledgement or approval or any form of suggestion that the previous publication (or information derived therefrom) or known matter forms part of the common general knowledge in the field of endeavor to which this specification relates.

[0123] Those skilled in the art will appreciate that the invention described herein is susceptible to variations and modifications other than those specifically described. It should be understood that the present invention includes all such variations and modifications that fall within the spirit and scope. The present invention also includes all steps, features, compositions and compounds mentioned or indicated in this specification, either individually or collectively, and any and all combinations of any two or more of the steps or features.

[0124] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0125] Certain embodiments of the invention will now be described with reference to the following examples, which are for illustrative purposes only and are not intended to limit the general scope described above.

[0126] Example

[0127] method

[0128] Cell culture and treatment

[0129] GL261-Luc cells were cultured in RPMI medium, and all other cell lines were maintained in Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 10% FBS (Gibco) and penicillin / streptomycin (Gibco) and grown using standard cell culture techniques at 37°C and 5% CO2. Cells were treated with 10 ng / ml TNFα (Calbiochem) or 100 ng / ml LPS (Sigma, 595L2654) for the indicated time points.

[0130] RNA-Seq data analysis

[0131] The raw RNA expression data (RSEM matrix) of 1018 glioma patient samples and 20 non-glioma samples were downloaded from the Chinese Glioma Genome Atlas (CGGA). The IDH mutation status of 966 samples was obtained. Differential gene expression analysis was performed using the glmFit() function in the edgeR V.3.28.1 package. Significant differentially expressed genes (DEGs) were defined as genes with an expression fold change ≥ 2 and a false discovery rate (FDR) < 0.05. With reference to the KEGG database, the ClusterProfilerV.3.14.3 package was used to measure the up-regulated and down-regulated genes in the over-represented pathway, respectively.

[0132] scRNA-seq data analysis

[0133] The raw count matrix of single cell RNA-Seq (scRNA-Seq) data from 9 GBM patients was downloaded from NCBI GEO (GSE117891). The scRNA-Seq samples were divided into three groups based on the expression level of LOC, referring to the expression data of the same patients from bulk RNA-Seq. The following downstream data analysis was completed using the functions in the Seurat v3.2.3R package. First, expression normalization and scaling were achieved, and then dimensionality reduction analysis was performed using the RunPCA() and RunTSNE() functions. All cells were then clustered based on the expression profile. Gene markers representing each cluster were identified, and the cell types of each cluster were classified by comparison with a database of known cell type markers (CellMarkerdatabase). R was then used to calculate the proportion of each cell type, and the Student t test was used to test the significance of the change in proportion between patients with high and low LOC expression.

[0134] RNA interference and real-time qPCR

[0135] For siRNA knockdown, control siRNA and siRNA specific for LOC (CAACCTCTCTAATCAGTCTCTTTCT (SEQ ID NO: 1)) were purchased from IDT (Integrated DNA Technologies) as dicer-substrate siRNA. siRNA was transfected into T98G cells using Lipofectamine RNAiMAX siRNA transfection reagent in Opti-MEM according to the manufacturer's instructions, and the culture medium was supplemented with fresh DMEM after 8 hours. After 72 hours, cells were harvested and total RNA was extracted by Trizol and column purified using the RNeasy Mini kit for gene expression analysis. 1 μg of RNA was used as a template for the reverse transcription reaction using the Maxima First Strand cDNA Synthesis Kit (Thermo Scientific). Real-time PCR was then performed from the diluted cDNA using SsoAdvanced Universal SYBR Green Supermix (BioRad). Relative gene expression was analyzed by the AACT method by normalizing the experimental Ct values ​​to β-actin. For lentiviral-mediated knockdown, lines were transduced with pLKO-puro lentiviral vector containing shRNA against LOC transcripts (LOC shRNA #1: CKiAATAATGATAGCAACTACT (SEQ ID NO: 2) and LOC shRNA #2: GTTGCTAACAGTATGAGTTCT (SEQ ID NO: 3) in the presence of 5 μg / ml polybrene and subsequently selected with puromycin for 72 hours.

[0136] 5' and 3' RACE:

[0137] loc105375914 was subjected to 5' and 3' cDNA end rapid amplification (Rapid Amplification of cDNA End, RACE). Briefly, for 5', 1 μg of total RNA from A375 cells was reverse transcribed using a gene-specific primer for reverse transcription (acgatgccaagtcgtctttt (SEQ ID NO: 4) using SuperScript II reverse transcriptase to generate a cDNA template. To append a Poly-A tail to the 5' site of the cDNA product, a terminal deoxynucleotidyl transferase reaction was performed. The 5'-end tailed cDNA pool was used for nested PCR amplification using Q5 High-Fidelity DNA Polymerase (NEB). The second PCR product was cloned into pLenti CMV GFP using XbaI and Sail sites. Puro vector. Sanger sequencing was performed on at least 10 different independent bacterial clones to obtain the 5' end site of the LOC, and the sequence was aligned (blasted) with the human genome for mapping. For 3'RACE, the same protocol as described above was used with minor changes to generate the cDNA library. For reverse transcription, 100 ng / gl of QT-primer (ccagtgagcagagtgacgaggactcgagctcaagcttttttttttttttttttt (SEQ ID NO: 5)) and first incubate the RNA-primer mixture containing the reverse transcription components at 25°C for 5 minutes and incubate under the same conditions as discussed above. The cDNA library was diluted to 1 ml with RNase / DNase-free water and the same protocol as 5'RACE was used for the first set of amplifications. The second PCR product was cloned into the Puc19 vector using the XbaI and SalI sites. Sanger sequencing was performed on at least 10 different independent bacterial clones to obtain the 3' end site of loc105375914, and the sequence was aligned with the human genome for mapping.

[0138] Removal of the LOC promoter region by CRISPR / Cas9 editing

[0139] The pX458-GFP plasmid was modified by removing Cas9-GFP and inserting DsRed (pX458-DsRed) gene sequence under the Cbh promoter to select double positive cells in FACS. gRNA1 was cloned into the pX458-GFP plasmid, and gRNA2 was cloned into the px458-DsRed plasmid. X-tremeGENE 9 transfection reagent (Sigma) was used to co-transfect cells in 6-well plates. Double positive single cells were sorted into 96-well plates (1 cell / well) by MoFlo XDP 4 laser systems (Beckman Coulter), and each clone was genotyped by PCR using outward primers from the target region. For the Gml6685 deletion genotyping primers were as follows: F: GCATTCCCTTAGGTAGACCTCC (SEQ ID NO: 6) and reverse: GGGAGTGATTATGGGTGGTGAG (SEQ ID NO: 7), and for the LOC deletion genotyping: forward: ATTAAGCTCCGGGAGGACAT (SEQ ID NO: 8) and reverse: CAGGGTCCTGGGAGTGACTA (SEQ ID NO: 9). The presence of the deletion in each positive clone was also verified by Sanger sequencing.

[0140] Western blot analysis

[0141] Total protein was extracted using Totex buffer (20 mM Hepes, 0.35 M NaCl, 20% glycerol, 1% NP-40, 1 mM MgCl2, 0.5 mM EDTA, 0.1 mM EGTA, 50 mM NaF and 0.3 mM NaV03 at pH 7.9) supplemented with complete protease and phosphatase inhibitor cocktail (Roche). Immunoblotting was performed with the following antibodies: anti-p-p38 (Thrl80 / Tyrl82) 3D7 (Cell signalling; #9215S), anti-p38 (Santa Cruz; #sc-728), anti-p-p65 (Ser536) (Cell signalling; #3031L), anti-p65 (Santa Cruz; #sc-8008), anti-actin (Sigma; #A2066), anti-HSP90α / β (F-8) (Santa Cruz; #sc-13119), anti-PPMlD (Santa Cruz; #sc-376257), p-IKKa / β (Serl 76 / 180) (Cell signalling; #2697S), IKKa / β (H-470) (Santa Cruz; #sc-13119). Cruz; #7607), (Origene; #sc-TAl90113).

[0142] GBM patient-derived specimens and primary cell culture

[0143] After obtaining informed consent, tumor specimens or malignant ascites with corresponding clinical records were obtained from patients undergoing surgery or puncture at Samsung Medical Center (SMC) in accordance with its Institutional Review Board (IRB file #201004004). Patient-derived primary GBM cells were cultured as previously described. For sphere culture, GSCs were cultured under "NBE" neurosphere culture conditions.

[0144] Limiting dilution assay (LDA).

[0145] For LDA, cells were plated with control lentivirus or knockdown lentivirus. Infected cells and control cells were plated in 96-well plates. After 2 to 3 weeks, the number of wells without spheres was counted. When quantified, the formation of tumor spheres in each well was checked. Extreme limiting dilution analysis (ELDA (http: / / bioinf.wehi.edu.au / software / elda / )) was used to calculate stem cell frequency.

[0146] PDC-based chemical screening and analysis

[0147] PDCs forming tumor spheres cultured in serum-free medium were dissociated into single cells and seeded into 384-well plates (500 cells / well). PDCs were treated with 2 mM TMZ. After incubation at 37°C in a 5% CO2 humidified incubator for 6 days, the firefly luciferase-based adenosine triphosphate (ATP) monitoring system (ATPLite TM Cell viability was assessed using EnVision Multilabel Reader (PerkinElmer). Relative cell viability for each dose was obtained by normalization with dimethyl sulfoxide (DMSO).

[0148] Orthotopic glioma model

[0149] All mouse experiments were performed in accordance with the guidelines of the Animal Use and Care Committees of Samsung Medical Center and the guidelines approved by the Association for Assessment and Accreditation of Laboratory Animal Care. Six-week-old female BALB / c nude mice were used for intracranial transplantation. Patient-derived glioma cells (1×105 / mouse) were injected into the mouse brain by stereotactic intracranial injection (coordinates: 2 mm in front of the dura mater, 2 mm on the side, and 2.5 mm in depth). When 25% weight loss or neurological symptoms (lethargy, ataxia, and seizures) were observed, the mice were killed.

[0150] Syngeneic glioma mouse model

[0151] 6-week-old female Gm16685 WT and Gm16685 KO mice were used for intracranial transplantation. Basically, 25,000 cells (GL261-Luc Gm16685 WT or GL261-Luc Gm16685 KO) in a volume of 2 μl of CO2-independent culture medium (Thermofisher.#18045088) were injected into the striatum using a 2.5 μl Hamilton syringe equipped with a 33G needle without a bevel; i.e., 0.5 mm in front of the bregma at a depth of 3 mm from the dura mater and 2 mm to the left of the sagittal suture. When a 25% weight loss or neurological symptoms (lethargy, ataxia, and seizures) were observed, the mice were killed.

[0152] Fluorescence in situ hybridization

[0153] Quasar 570-conjugated Stellaris oligonucleotide probes against LOC were obtained from LGC Biosearch Technologies (Petaluma, CA). Cells were hybridized using the Stellaris RNA FISH probe set according to the manufacturer's instructions. In brief, cells were fixed with a 4% formaldehyde solution in PBS for 10 minutes at room temperature. After fixation, cells were placed in 70% (volume / volume) ethanol for 4 hours at 4°C. 70% ethanol was aspirated and washing buffer was added for 5 minutes. The probe was diluted to a concentration of 125nM in hybridization buffer. The hybridization solution with the probe was added to each sample and then placed overnight at 37°C. The samples were then washed twice at 37°C with washing buffer for 5 minutes each. DAPI was added, followed by sealing and imaging.

[0154] In vitro RNA-protein interactions followed by mass spectrometry analysis

[0155] RNA protein interaction assay was performed as previously described. In brief, LOC positive and antisense strands, and human telomerase RNA (Terc) was transcribed in vitro using biotin RNA labeling mixture (Roche) and T7 RNA polymerase (Promega). Biotin-labeled RNA probes were folded by adding an equal volume of RNA structure buffer (20mM Tris [pH 7.0], 0.2M KCl and 20mM MgCl2), heated at 70°C for 5 minutes and cooled at room temperature for 30 minutes to allow secondary structure formation. Cells were treated with TNFα for 1.5 hours and sonicated in RIP buffer (150mM KCl, 25mM Tris pH: 7.4, 0.5mM DTT, 0.5% NP-40, 1mM PMSF, Promega recombinant RNasin ribonuclease inhibitor (150 units / 1ml), 50mM NaF, 0.3mM NaVO3 and complete protease inhibitors). Subsequently, the cell lysate was pre-clarified with streptavidin agarose beads (Invitrogen) at 4°C for 1 hour. The pre-clarified protein lysate was rotated and incubated at 4°C for 4 hours with 3 μg of folded LOC probe or Terc probe, and incubated with streptavidin-agarose beads for another 2 hours. Next, the beads were washed 5 times with RIP buffer, and protein was recovered by boiling the beads in 40 μl 2 × NuPAGE LDS sample buffer for 10 minutes. After centrifugation at room temperature for 3 minutes at 1000 rpm, the supernatant was collected in a new microcentrifuge tube. These eluted samples (30 μl) were analyzed by mass spectrometry, and the remaining eluted samples of 10 μl were silver-stained using ProteoSilver silver staining kit (Sigma).

[0156] Sample processing and mass spectrometry analysis

[0157] The samples were run on 4% to 12% NuPage Novex Bis-Tris gels (Invitrogen). The gels were subsequently stained with a Colloidal Blue Staining Kit (Invitrogen). The protein bands were excised and trypsin digested after protein extraction. The samples were analyzed on an Orbitrap (Thermo Fisher) with the following parameters: A survey full scan MS spectrum ranging from m / z 310 to 1400 was acquired. This was acquired at a resolution of r=60,000 at m / z 400, an AGC target of 1e6, and a maximum injection time of 500 milliseconds. The top 10 strong peptide ions were selected and sequentially fragmented by collision-induced dissociation in a linear ion trap with a normalized collision energy of 35%. Dynamic exclusion was applied using a maximum exclusion list of 500 with a repeat count and exclusion duration of 30 seconds. Using X! The data were searched by Tandem Vengeance (2015.12.15.2) with fixed modification of cysteine ​​carbamidomethyl, variable modification of oxidized methionine and N-acetylation, and maximum missed cleavages of 2, parent ion tolerance of 10 ppm and fragment ion tolerance of 0.5 Da - against human and human decoy databases (185868 entries). Spectral counts of peptides and proteins were derived using Scaffold Proteomics software (version 3, MatrixScience) with 95% confidence intervals and a minimum of 2 peptides as criteria.

[0158] MS2 pull-down assay

[0159] LOC-MS2 vector or Terc-MS2 vector is co-transfected with MS2-GFP plasmid into 293T cells. After 48 hours, cells are harvested and lysed in IP lysis buffer (50mM Tris-HCl pH8.0, 150mM NaCl, 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS). Cell lysate is incubated with GFP antibody for 6 hours, and then immunoprecipitated overnight with protein G agarose beads (GE Healthcare). The beads are washed three times with washing buffer (10mM Tris-HCl pH 7.5, 1mM EDTA, 1mM EGTA, 150mM NaCl, 1% Triton X-100). Immunoprecipitated proteins are eluted by boiling beads in 2×LDS buffer (Invitrogen). Immunoblotting was performed as described above with the following antibodies: anti-GFP antibody (1:1000, Invitrogen; #A-11122), anti-DHX15 antibody (1:1000, Santa Cruz; #sc-271686).

[0160] RNA immunoprecipitation

[0161] T98G cells were washed with ice-cold PBS in 6-well plates and lysed in 100 μl RIP lysis buffer (50 mM Tris pH: 8, 150 mM NaCl, 0.5% NP-40, 0.5% sodium deoxycholate, 0.05% SDS, supplemented with protease inhibitor cocktail and 100 U / ml RNase inhibitor). The cell lysate was collected in a microcentrifuge tube and further incubated on ice for 20 minutes. Subsequently, the cells were sonicated with a Bioruptor for 5 minutes and centrifuged at maximum speed for 15 minutes. The supernatant was then transferred to a clean tube and immunoprecipitated with DHX15 antibody overnight at 4°C. The next day, Dynabeads were added. TM Protein G and incubate for 3 hours. The beads were washed three times with IP wash buffer (10mM Tris pH: 7.5, 1mM EDTA, 1mM EGTA, 150mM NaCl, 1% Trition-X). RNA was extracted and isolated from the beads using TRIzol reagent. RNA was reverse transcribed and RNA enrichment was quantified by RT-qPCR using the % input method.

[0162] Cross-linking immunoprecipitation and qPCR

[0163] Cells were UV cross-linked according to previously published protocols (71)(81)(83)(87). Briefly, 293T overexpressing DHX15 cells were irradiated at 150 mJ / cm2 in CL-1000UVP UV cross-linker and subsequently subjected to cell lysis buffer (50 mM Tris-HCl pH 7.4, 100 mM NaCl, 1% NP-40, 0.1% SDS, and 0.5% sodium deoxycholate) in the presence of protease and RNase inhibitors. DNA was removed from the cell lysate by Turbo DNase treatment, and RNA was fragmented by treatment with RNase I for 5 minutes at 37°C. The clarified lysate was incubated with label M2 beads at 4°C overnight, and the beads were washed in lysis buffer. Proteinase K was added and incubated at 55°C for 30 minutes. Total RNA was isolated using the Qiagen RNA Mini Kit using DNase I treatment. After RNA isolation, RT-qPCR was performed using 12 primer pairs covering the full length of LOC or 4 pairs for Terc. Data were normalized to control vector.

[0164] Immunoprecipitation assay

[0165] Cells were harvested and lysed in IP lysis buffer (50mM Tris-HCl pH 8.0, 150mM NaCl, 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS). Protein concentration was determined by the Bradford method. Cell lysates were incubated with antibodies for 6 hours and incubated with protein G agarose beads (GE Healthcare) for an additional 2 hours before DHX15, p65 or p38 immunoprecipitation. The beads were washed three times with wash buffer (10mM Tris-HCl pH 7.5, 1mM EDTA, 1mM EGTA, 150mM NaCl, 1% Triton X-100) and the immunoprecipitated proteins were eluted by boiling the beads in 2×LDS buffer (Invitrogen) for 10 minutes. Immunoblotting was performed as described above with the following antibodies: anti-PPM1D antibody (1:1000, Santa Cruz; #sc-376257), anti-p65 antibody (1:1000, Santa Cruz; sc-8008), and anti-p38 antibody (1:1000, Santa Cruz sc; sc-728).

[0166] Cell viability assay

[0167] For cell viability assays, 5000 cells / well were plated in 96-well plates and treated with serially diluted DHX inhibitors (0 to 200 μM) or TMZ (0 μM to 1600 μM). Cell viability was measured using a cell counting kit-8 (Dojindo). IC50 values ​​were calculated as the average drug concentration required to inhibit cell proliferation by 50% compared to vehicle-treated controls.

[0168] Drug treatment in glioma xenograft models

[0169] In brief, according to the previous protocol, GBM cell LN18 was first transformed to express luciferase protein. In order to test DHX inhibitors in wtIDH1 and mIDH1 GBM cells, a total of 2.5×105 wtIDH1LN18-Luc or mIDH1 LN18-Luc cells in 5 μl PBS were intracranially injected into the brain of 6-week-old female NSG mice (Invivos). Six mice were injected in each group. Mice with established orthotopic xenografts were randomly assigned to treatment with vehicle (10% DMSO, 40% PEG400, and 50% PBS) or 20 mg / kg DHX inhibitors, once a day. For combined treatment, after tumor establishment on days 8 to 10, mice were randomly assigned to the following treatments: vehicle, or 20 mg / kg DHX inhibitors once a day, or TMZ (20 mg / kg) once a day (starting from day 8 by intraperitoneal injection for 5 days), or both. Tumor growth was assessed using an IVIS Spectrum imager (PerkinElmer), and survival dates until the onset of neurological symptoms were recorded to generate survival curves.

[0170] Animal studies

[0171] All animal studies were performed in accordance with the Institutional Animal Care and Use Committee of A*STAR (Singapore). All procedures were approved under IACUC protocols ID#221680 and ID#201572.

[0172] Statistical analysis

[0173] The two-tailed Student t test was used for statistical analysis between the two groups. Two-way ANOVA was used for statistical analysis of tumor volume. PRISM software version 7 was used to draw figures and perform statistical analysis.

[0174] Example 1

[0175] result

[0176] TNF / NFκB signaling serves as a central signaling hub in wtIDH1 gliomas

[0177] Mutations in IDH1 are common in human malignancies (e.g., gliomas). The somatic mutation landscape from this cohort also showed that mIDH1 is a hotspot mutation, accounting for approximately 47% of the patient. Interestingly, the lack of IDH1 mutations predicts an unfavorable disease outcome with a worse median survival (Figure 10B). In order to systematically characterize the targetable weaknesses in wtIDH1 gliomas, transcriptome analysis was performed using RNA-seq data from wtIDH1 and mIDH1 glioma patients. KEGG pathway analysis found that TNF / NFκB signaling was highly activated in mIDH1 gliomas, indicating that TNF / NFκB signaling can play a potential dependent role in wtIDH1 gliomas (Figure 1A).

[0178] High-throughput screening of new NFκB regulators

[0179] Since TNF / NFκB signaling is involved in many housekeeping functions, this study aims to identify new NFκB regulators that can function in a context-specific manner. Therefore, high-throughput screening of lncRNA has been performed using NFκB luciferase reporter cell lines. The results of preliminary screening for more than 2000 lncRNAs are shown (Figure 1B). The well-known NFκB regulator RIPK1 is used as a positive control. LOC (LOC 105375914), a new lncRNA located in the antisense direction of the IL-7 gene, has been found to play an indispensable role in gliomas by fine-tuning NFκB activity. Using 5' and 3' RACE and sequencing, LOC located on human chromosome 8q21.13 (+) was identified as a transcript of 1508 nucleotides (SEQ ID NO: 10) with 4 exons. LOC is highly expressed in high-grade gliomas, especially GBM (Figure 1C, Fig.11 A, B). To evaluate the clinical significance of LOC in GBM, the expression of LOC in 219 GBM tumors was analyzed based on RNA-seq data, and patients were grouped as LOC-high (n=108) or LOC-low (n=111) based on LOC expression levels (Figure 1D). Patients with high LOC expression had significantly lower survival rates compared with low LOC expression (Figure 1D). To further evaluate the clinical significance of LOC in another independent cohort, the expression of LOC in 59 GBM patient tumors was analyzed by RT-qPCR, and patients were grouped as LOC-high (n=20) or LOC-low (n=20) based on LOC expression levels (Figure 1E, Fig.11C). Similarly, patients with high LOC expression showed significantly lower survival rates compared to patients with low LOC expression (Figure 1F). In addition, magnetic resonance imaging (MRI) data after surgical resection and standard treatment showed that the resected tumors always recurred and significantly reduced the survival of patients with high LOC expression (Figure 1G, marked by dotted lines). However, due to reduced tumor growth after treatment, patients with low LOC expression had better clinical prognosis after surgical resection and standard treatment (Figure 1H, marked by dotted lines). These findings indicate that LOC expression is associated with poor prognosis in GBM patients.

[0180] LOC overexpression confers drug resistance and promotes tumorigenesis in GBM patient-derived cells

[0181] The role of LOC in cancer development and drug resistance in human gliomas was further investigated. TMZ is commonly used in the clinic for the treatment of GBM patients. However, about 50% of patients develop resistance during treatment. To evaluate the role of LOC on chemotherapy resistance, two separate shRNAs were used to generate stable LOC knockdown GBM patient-derived primary cells. These cells were treated with or without TMZ. Cells infected with LOC shRNA showed a significant decrease in cell viability in response to TMZ, but the control group did not ( Figure 2 A, B), indicating that LOC can contribute to TMZ resistance. Recently, cancer stem cells have been shown to contribute to chemotherapy resistance. Using two different groups of GBM patient-derived primary cells, the stemness of GBM cells in the presence and absence of LOC was analyzed by in vitro tumor sphere formation using a limiting dilution assay (LDA). LDA clonogenic significance showed that LOC depletion impaired stemness in 2 independent GBM patient-derived cells ( Figure 3 C). Consistent with in vitro experiments, depletion of LOC resulted in decreased tumorigenicity in in vivo patient-derived xenograft (PDX) models ( Figure 3 D, E). Staining of the cancer stem cell marker nestin in tumors from PDX models further demonstrated that tumor formation was inhibited in the LOC-deficient group ( Figure 3 F, G). These results highlight the potential oncogenic role of LOC-mediated cell proliferation, stem cell properties, and drug resistance in GBM. High LOC expression in the TME is associated with greater infiltration of GAM

[0182] To further explain the role of LOC in the real tumor microenvironment, we performed scRNA-seq to map the tumor ecosystem ( Figure 3A). Whole-exome sequencing (WES) and bulk RNA sequencing (RNA-seq) using matched glioblastoma patient material ( Figure 3 A). The somatic genomic landscape of glioblastoma shows previously reported genes (e.g., TP53, PTEN, EGFR, and PIK3CA), but not IDH1 ( Figure 3 B), which led to the study focusing on the wtIDH1 group, as the mutational status of glioma IDH1 has been reported to shape the brain TME. Unsupervised clustering using Louvain community detection revealed seven clusters with distinct gene expression patterns within the TME ( Figure 3 C). Specific lung clusters from patients with squamous cell carcinoma of the lung served as controls, highlighting the specificity of the cell populations derived from patients with glioblastoma ( Figure 3 C). Glioblastoma patients were classified into LOC-low (S3, S5, S13) and LOC-high (S2, S4, S7) groups based on LOC expression ( Figure 3 D). Cluster analysis revealed significant changes in immune composition ( Figure 3 D). In particular, significant changes in the phenotype and proportion of myeloid cells were observed, including the presence of increased GAM in the LOC-high group ( Figure 3 D to E), suggesting a potential role for LOC in myeloid infiltration. Next, we used scRNA-seq data to explore the cellular origin of LOC in the tumor niche at a higher resolution ( Figure 3 F to G). LOC expression profile analysis showed that LOC was mainly expressed in glioma cells and immune cells, especially in GAMs ( Figure 3 G), indicating that LOC may play multifaceted roles in both glioma cells and immune cells.

[0183] Deletion of the mouse LOC ortholog from both the tumor and host compartments resulted in the most dramatic tumor regression frequency

[0184] Having observed potential applications of LOC in TME reprogramming, these findings were next confirmed in a mouse glioma TME panel using a syngeneic mouse model ( Figure 4A). A previously discovered evolutionarily conserved lncRNA (i.e., Gm16685) is an ortholog of mouse LOC. The same strategy was applied to generate the isogenic mouse glioma cell line GL261-Luc by deleting the p65 binding motif (the same method for generating Gm16685 knockout mice). The deletion of the p65 motif was confirmed by genotyping PCR. In order to test whether both tumor cells and host cells derived from LOC / Gm16685 can play a key role in TME, the inventors injected WT (WT-WT, WT-KO) or KO (KO-WT, KO-KO) GL261-Luc cells intracranially into WT and KO mice, and compared tumor growth in the GL261 model with Gm16685 deficiency on the tumor, host, and two compartments based on luminescence intensity ( Figure 4 B). Consistent with previous observations, loss of Gm16685 in either the tumor or host compartment resulted in tumor regression and prolonged survival ( Figure 4 B to C). However, the highest tumor regression rates and most favorable survival were observed when neither tumor nor host cells expressed Gm16685 ( Figure 4 B to C), indicating that Gm16685 / LOC has an indispensable role in the tumor immune microenvironment of glioblastoma. Immunofluorescence staining of glioma cells (GFAP) and GAM (IBA1) further emphasized the synergistic tumor-promoting effects of Gm16685 / LOC on both tumor and host compartments ( Figure 4 D to G).

[0185] Human GBM with higher LOC expression displays an enhanced NFκB signature

[0186] Next, the potential mechanisms of how LOC promotes GBM progression were explored. Since LOC had been identified as a novel NFκB regulator from the screen, the correlation between LOC expression and NFκB gene signatures in GBM was evaluated. Available in-house RNA-seq data from patients in the LOC-high (n=12) and LOC-low (n=12) groups were analyzed. Overall, NFκB target genes were highly expressed in GBM patients with higher LOC expression compared to GBM patients with low LOC expression levels, and this was associated with a significant negative impact on overall survival (Figure 1F). To evaluate the functional relevance of LOC, loss-of-function and gain-of-function studies of patient-derived primary cancer cells were evaluated. Knockdown of LOC by shRNA in GBM patient-derived primary cells inhibited the expression of downstream target genes of the NFκB signaling pathway, namely TNFα and IL-8 (not shown). In gliomas, IL8 is known to be a key mediator responsible for NFκB-induced tumor progression. Subsequently, overexpression of LOC in LOC-deficient primary cancer cells restored the expression of TNFα and IL-8 ( Figure 4 E to G). Given that NFκB signaling is a well-known contributor to stem cell identity, cell survival, and chemotherapeutic resistance, these results collectively suggest that the LOC-NFκB axis is a potential cause of the poorer clinical outcomes in patients with high LOC expression.

[0187] LOC regulates the phosphorylation of p65 and p38

[0188] The detailed mechanistic basis of LOC action was further studied. First, two NFκB binding sites (also located in the first intron of IL-7) were found in the promoter region of LOC, indicating that LOC can be regulated by NFκB (Figure 12A). Subsequent experiments using NFκB inhibitors revealed that LOC can be induced by TNFα, and the induction can be prevented by blocking NFκB activity (Figure 12B, C), indicating that there is a potential positive feedback loop between LOC and NFκB. In order to further clarify the detailed mechanism of this feedback loop, isogenic cell lines were generated by removing NFκB motifs using CRISPR-Cas9 genome editing. LOC expression was eliminated in LN18 KO cells (Figure 12D), and LN18 KO cells also showed a significant reduction in NFκB target genes (such as TNFα) (Figure 12E). Interestingly, after treatment with TNFα, reduced phosphorylation of p65 and p38 was observed in KO cells (Figure 12F), but no other upstream events were observed (data not shown). These results show that LOC can regulate NFκB activity through p65 and p38 activation, and thus regulate the expression of NFκB and p38 target genes (such as TNFα). In order to exclude the off-target effect of CRISPR genome editing, the knockdown experiment by siRNA in GBM cancer cell line LN18 was adopted (Figure 12G to I). According to the results obtained from primary GBM cells and human GBM cell lines, weakening LOC expression inhibited NFκB target genes (such as TNFα) (Figure 12H) and NFκB / p38 activation (Figure 12I), and this observation was extended to other cell types, and it was found that in T98G-KO cells, LOC expression was no longer induced in response to TNFα (Figure 12J). In fact, compared with WT cells, TNFα expression in LOC KO cells was significantly lower (12K). Compared with WT cells, it was found that p65 and p38 activation were also reduced in LOC KO cells (Figure 12L), indicating the universality of the observations. Furthermore, ectopic expression of LOC was sufficient to rescue the loss of p65 and p38 phosphorylation following TNFα treatment in LOC KO cells (not shown). These results further confirmed that the differences observed in LOC-deficient cells were mediated by LOC and were not due to changes in genomic structure or alterations in neighboring genes through genome editing.

[0189] Identification of the DHX15 RNA helicase as a LOC lncRNA binding partner

[0190] FISH analysis of LOC and Gm16685 showed that both of them were mainly located in the cytoplasm. An attempt was made to identify LOC interacting proteins using RNA pull-down assays by incubating in vitro transcribed biotinylated LOC with protein extracts of cells treated with TNFα. Biotinylated RNA protein complexes were pulled down using streptavidin-agarose beads and resolved on SDS-PAGE gels for visualization by silver staining, or sent to mass spectrometry. In vitro transcribed and biotinylated human telomerase RNA (Terc) was used as a positive control. As expected, compared with the bead control, the RNA pull-down of Terc specifically promoted dyskerin (DKC) protein, ensuring the robustness of the experimental conditions. In order to prioritize candidate interactors after mass spectrometry analysis, the data set was screened so that there were zero or no exclusive unique spectrum counts in the bead control, and under the condition of TNFα treatment, there were at least three exclusive unique spectrum counts in the LOC probe. Analysis of the LOC interactome by mass spectrometry identified DHX15 (a member of the DEAH box RNA helicase family), a pre-mRNA splicing factor ATP-dependent RNA helicase, as a potential interacting partner. Indeed, the analysis showed that DHX15 is highly expressed in high-grade gliomas, including GBM ( Figure 5 A), and patients with high DHX15 expression showed significantly lower survival rate compared with patients with low DHX15 expression ( Figure 5 B). These data suggest that DHX15 may play an important role in GBM by complexing LOC.

[0191] LOC permits active DHX15 to sequester PPM1D phosphatase from its substrate p65

[0192] Previous studies have shown that the PPM1D phosphatase negatively regulates inflammatory transcriptional programs by dephosphorylating p65 or p38 kinase activation. In fact, in the absence of LOC, phosphorylation of p65 and p38 was reduced (results not shown). It was speculated that PPM1D could bind to LOC and dephosphorylate p65 and p38. However, PPM1D was not shown to act as an RNA binding protein in previous literature. It was then hypothesized that DHX15 could be involved in PPM1D-mediated dephosphorylation of p65 and p38. To test the hypothesis that DHX15 could bind to PPM1D, DHX15 was immunoprecipitated and it was found that DHX15 interacted with PPM1D, and this interaction was enhanced in WT cells after TNFα treatment ( Figure 5 C, lanes 4 to 6). However, this interaction was significantly disrupted in LOC KO cells ( Figure 5C, lanes 10 to 12). In addition, immunoprecipitation of DHX15 in LOC KO cells ectopically expressing full-length or 3' truncated LOC (Δ3'-loc) showed that the 3' region of LOC is required for DHX15-PPM1D interaction (results not shown). Together, these results indicate that LOC is essential for permitting DHX15 to interact with PPM1D. Similar to the pull-down results obtained from ectopically expressed DHX15, immunoprecipitation of endogenous DHX15 pulled down PPM1D in WT cells, but was significantly lower in LOC KO cells ( Figure 5 D, Fig.13 A). Interestingly, the helicase activity of DHX15 was observed to be required for optimal PPM1D and DHX15 interaction, as TNFα-induced DHX15-PPM1D interaction was impaired when a helicase-dead mutant form of DHX15 was used in the pull-down assay ( Figure 5 E). TNFα treatment also enhanced the interaction between LOC and DHX15 ( Figure 5 F), reflecting the interaction between PPM1D and DHX15 ( Figure 5 C, lanes 4 to 6), indicating that LOC:DHX15 induction by TNFα is required for PPM1D inhibition and that the level of LOC limits the formation of this complex in unstimulated cells ( Figure 5 C, lanes 1 to 3) and the level of this complex increases after TNFα stimulation ( Figure 5 A, lanes 4 to 6). The requirement for LOC and DHX15 helicase activity for the interaction of DHX15 with PPM1D suggests that LOC provides an RNA scaffold for DHX15 binding to PPM1D, but that the interaction is successful only when the LOC RNA is opened by DHX15 helicase activity. Indeed, if this is the case, it is hypothesized that the DHX15-LOC complex is responsible for sequestering PPM1D from p65 and p38 in TNFα-induced cells. To test this, the PPM1D-p65 interaction was analyzed in WT cells treated with TNFα. In untreated cells, PPM1D interacted strongly with p65, presumably to keep p65 inactive, but this interaction was reduced after TNFα treatment ( Figure 5 D, lanes 1 to 3; Fig.13 A, lanes 1 to 3), probably due to the concomitant LOC expression and formation of the LOC DHX15 scaffold ( Figure 5 F). However, in LOC KO cells, PPM1D still strongly binds to p65 ( Figure 5 D, lanes 4 to 6; Fig.13A, lanes 1 to 3), indicating that in the absence of LOC, DHX15 is unable to sequester PPM1D from p65 due to the lack of a LOC-DHX15 scaffold. This could underlie the reduced levels of p-p65 and p-p38 observed in LOC KO cells throughout this study. In fact, both DHX15 and PPM1D are barely associated in unstimulated cells, and it is the activation and binding of LOC (whose levels are limited) that permits DHX15 to sequester PPM1D upon NFκB activation.

[0193] To address whether the LOC lncRNA plays a role in mediating these effects in trans, it was ectopically expressed in LOC KO cells. Reconstitution of LOC in LOC KO cells restored the phosphorylation of PPM1D targets p38 and p65 (not shown). These results also further confirmed that LOC plays a role in trans-regulating PPM1D targets through DHX15. To further explore whether DHX15 executes its effects through LOC, wt-DHX15 and mut-DHX15 were expressed in WT and LOC KO cells. Indeed, when wt-DHX15 but not mut-DHX15 was expressed in WT cells, activation of NFκB targets (e.g., TNFα) was observed ( Figure 5 G). However, when DHX15 was expressed in LOC KO cells, activation of NFκB targets was significantly inhibited ( Figure 5 G). These results suggest that the LOC lncRNA can function in trans by acting as a scaffold in complex with DHX15 to sequester the PPM1D phosphatase from its substrates. To further understand whether PPM1D mediates its effects primarily through LOC, it was also shown that PPM1D knockdown restored phosphorylation of p38 and p65 in LOC KO cells, further suggesting that PPM1D is a key determinant of LOC action ( Figure 5 H). It is possible that other substrates of PPM1D may also play a role in the phenomena following LOC induction. Given that this induction is dependent on the p65 subunit of NFκB, LOC may be a key permissive factor required to initiate a full inflammatory response in an evolutionarily conserved manner. wtIDH1 glioma cells are more sensitive to pharmacological inhibition of the LOC:DHX15-PPM1D-NFκB axis.

[0194] Next, we investigated whether the LOC:DHX15 axis could explain the increased NFκB-dependent transcription in wtIDH1 glioma cells (addition). LOC expression profiling in patients with wtIDH1 and mIDH1 gliomas of different WHO grades showed that LOC was highly expressed in wtIDH1 high-grade gliomas ( Figure 6 A, Fig.14A). To further evaluate the effect of IDH1 mutation on LOC expression, single-base editing was used to introduce heterozygous IDH1 R132H mutation (IDH1 R132H / WT ), in which a single guanine (G) base is replaced by adenosine (A). The heterozygous IDH1R132H point mutation was identified by Sanger sequencing ( Fig.14 B) and western blot analysis using a specific antibody against R132H IDH1 ( Fig.14 In two independent clones, LOC expression was significantly attenuated by IDH1 R132H mutation ( Figure 6 B) In addition, selective mutant IDH1 R132H Administration of inhibitors restored IDH1 R132H / WT LOC expression in cells ( Figure 6 C). Since IDH1 mutations are known to induce a DNA hypermethylation phenotype, we explored whether LOC dysregulation is triggered by this epigenetic reprogramming. Similarly, treatment with 5-AzaC (5-azacytidine, a DNA methyltransferase inhibitor that inhibits DNA methylation) was able to eliminate this hypermethylation phenotype, indicating that the hypermethylation phenotype induced by IDH1 mutations can reduce LOC expression ( Figure 6 D). We hypothesized that LOC could be a key factor in the activation of TNF / NFκB signaling in wtIDH1 gliomas. Significant increases in p65 and p38 phosphorylation were also observed, suggesting enhanced activity of TNF / NFκB in wtIDH1 gliomas ( Figure 6 E). Furthermore, decreased p65-PPM1D interaction and significant DHX15-PPM1D interaction were detected in wtIDH1 GBM cells compared with mIDH1 GBM cells, indicating that the LOC:DHX15 axis is essential for turning on TNF / NFκB signaling in wtIDH1 glioma cells ( Figure 6 F, Lanes 3 to 4 vs. Lanes 1 to 2). In mIDH1 cells, ectopic expression of wild-type LOC, but not mutant LOC (which cannot bind to DHX15), is able to complex with DHX15 to sequester PPM1D from its substrate p65 ( Figure 6 F, Lanes 5 to 6 vs. Lanes 3 to 4 and Figure 6 F, lanes 7 to 8 vs. lanes 3 to 4). Administration of DHX inhibitors can inhibit DHX15-PPM1D interaction ( Fig.14 C, lanes 3 to 4 vs. lanes 1 to 2) and enhanced p65-PPM1D complex ( Fig.14 C, lanes 3 to 4 vs. lanes 1 to 2) specifically reversed this phenotype in wtIDH1 GBM cells but not in mIDH1 GBM cells ( Fig.14 C, lanes 7 to 8 vs. lanes 5 to 6). Consistently, DHX inhibitor treatment could significantly inhibit cell growth in the wtIDH1 group ( Figure 6 G), while the cell growth was not inhibited in the mIDH1 group ( Figure 6 H). In addition, decreased tumor growth was observed only in the wtIDH1 group ( Figure 6 I, J) and prolonged survival ( Figure 6 K, L), which was not observed in the mIDH1 group, further emphasizing that the RNA:RNA helicase LOC:DHX15 could serve as a promising weakness in wtIDH1 glioma cells ( Figure 6 H to I).

[0195] LOC:DHX15-PPM1D-NFκB axis confers TMZ resistance in wtIDH1 glioma cells

[0196] The MRI data and drug response data highlight the important role of LOC in conferring TMZ resistance. To further investigate whether the LOC:DHX15-PPM1D-NFκB axis plays a role in TMZ resistance, loss- and gain-of-function studies were performed in wtIDH1 GBM cells. As a result, depletion of LOC by siRNA ( Figure 7 A, Fig.15 A) or DHX15( Figure 7 B, Fig.15 B) Sensitizes GBM cells to TMZ. Ectopic expression of LOC leads to higher resistance to TMZ ( Figure 7 C, Fig.15 C). Given the potential role of the LOC:DHX15-PPM1D-NFκB axis in TMZ response, we investigated whether the combination of TMZ with DHX inhibitors could have synergistic effects ( Figure 7 D, Fig.15 D). The results showed that the combination treatment produced more significant effects than single drug treatment in two different GBM cell lines ( Figure 7 D, Fig.15 D). This combination therapy strategy was applied to an in vivo xenograft model. Consistent with the in vitro experiments, enhanced inhibition of tumor growth was also observed in the combination of TMZ and DHX inhibitor groups ( Figure 7 E, F) and improved survival ( Figure 7 G). MGMT (O-6-methylguanine-DNA methyltransferase) has been described as a well-known factor leading to TMZ resistance due to its direct role in combating DNA alkylation damage in gliomas. After LOC knockdown using shRNA or siRNA, a significant decrease in MGMT expression was observed ( Figure 7H, I), and this reduction could be further abolished by overexpression of LOC ( Figure 7 J). Similarly, MGMT expression can also be attenuated by administration of DHX inhibitors ( Figure 7 K). Most importantly, the inhibition of cell growth after TMZ combined with DHX inhibitor treatment was abolished by MGMT overexpression, indicating that MGMT is indeed critical for TMZ resistance induced by the LOC:DHX15-PPM1D-NFκB axis ( Figure 7 L). Together, these results suggest that the LOC:DHX15-PPM1D-NFκB axis plays a key role in TMZ resistance and could be used as a promising drug target. This study suggests that combination therapy with TMZ and DHX inhibitors is an effective treatment for GBM patients.

Claims

1. A method for determining the prognosis of a glioma in a subject, the method comprising detecting LOC105375914 RNA in a glioma sample obtained from the subject, wherein an increased level of LOC105375914 RNA compared to a reference indicates that the subject suffers from a high-grade glioma and / or may have a poor prognosis.

2. The method of claim 1, wherein the method comprises detecting wild-type isocitrate dehydrogenase 1 (IDH1).

3. The method of claim 1 or 2, wherein the high-grade glioma is a World Health Organization (WHO) grade III or IV glioma.

4. The method of any one of claims 1 to 3, wherein the high-grade glioma is glioblastoma multiforme (GBM).

5. The method of any one of claims 1 to 4, wherein the high-grade glioma may be resistant to chemotherapy.

6. The method of any one of claims 1 to 5, wherein the subject suffering from the high-grade glioma has a likelihood of cancer recurrence.

7. The method of any one of claims 1 to 6, wherein the reference is a sample from a healthy subject.

8. A method for identifying a high-grade glioma in a subject, the method comprising: Detecting LOC105375914 RNA in a cancer sample obtained from the subject, wherein an increased level of LOC105375914 RNA compared to a reference indicates that the subject has a high-grade glioma.

9. A method of identifying and treating high-grade glioma in a subject, the method comprising: a) detecting LOC105375914 RNA in a cancer sample obtained from the subject, wherein an increased level of LOC105375914 RNA compared to a reference indicates that the subject suffers from a high-grade glioma; and b) administering an anti-cancer agent to the subject found to suffer from a high-grade glioma to treat the high-grade glioma.

10. A method for predicting the likelihood of resistance to chemotherapy in a subject suffering from glioma, the method comprising detecting LOC105375914 RNA in a glioma sample obtained from the subject, wherein an increased level of LOC105375914 RNA compared to a reference indicates the likelihood that the subject has resistance to chemotherapy.

11. The method of claim 10, wherein the chemotherapy is a standard of care treatment.

12. The method of claim 11, wherein the standard of care treatment is temozolomide (TMZ).

13. A method for predicting the likelihood of glioma recurrence in a subject, the method comprising detecting LOC105375914 RNA in a glioma sample obtained from the subject, wherein an increased level of LOC105375914 RNA compared to a reference indicates that the subject has a likelihood of recurrence.

14. The method of claim 13, wherein the subject has undergone chemotherapy, radiation therapy, or surgery.

15. A method of treating glioma in a subject by administering to the subject an inhibitor of the LOC-DEAH box helicase 15 (DHX15) complex.

16. The method of claim 15, wherein the glioma is a high-grade glioma.

17. The method of claims 15 and 16, wherein the glioma has wild-type IDH1.

18. The method of any one of claims 15 to 17, wherein the glioma expresses LOC105375914 RNA.

19. The method of any one of claims 15 to 18, wherein the inhibitor is a DHX15 inhibitor.

20. The method of any one of claims 15 to 19, wherein the method further comprises administering chemotherapy to the subject.

21. The method of claim 20, wherein the chemotherapy comprises temozolomide.

22. The method of any one of claims 15 to 21, wherein the method comprises inhibiting glioma stem cells in the subject.

23. A method of inhibiting glioma stem cell proliferation in a subject, the method comprising administering to the subject an inhibitor of the LOC-DEAH box helicase 15 (DHX15) complex.

Images