Compound microbial agent and application thereof in fermentation of high-acidity Miao Jia red soup

By using a compound microbial agent of Lactobacillus plantarum MX14 and Pichia pastoris PY33 in the fermentation of red sour soup, the problems of unstable fermentation and high nitrite were solved, and the production of red sour soup with high acidity and low nitrite was achieved, thus improving the consistency and safety of the product.

CN119570694BActive Publication Date: 2025-11-21BEIJING ZHONGNONG KE SOUR AGRICULTURAL TECHNOLOGY CO LTD
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510130884.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-02-06
Publication Date
2025-11-21
Estimated Expiration
2045-02-06

AI Technical Summary

Technical Problem

The traditional fermentation process for red sour soup is unstable, with insufficient acidity, high nitrite content, posing food safety risks, and a long fermentation cycle.

Method used

A compound microbial agent composed of Lactobacillus plantarum MX14 and Pichia pastoris PY33 was used to optimize fermentation conditions, increase acidity, and reduce nitrite content by adding it in a targeted manner during fermentation.

Benefits of technology

It shortens the fermentation cycle, increases the titratable acid content by 32.95%, lowers the pH value, reduces the nitrite content to 87.21%, and improves product quality and safety.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119570694B_ABST
    Figure CN119570694B_ABST
Patent Text Reader

Abstract

The present application belongs to the technical field of microbial fermentation, and particularly relates to a compound microbial agent and application thereof in fermentation of high-acidity Miao family red sour soup. The present application utilizes the compound microbial agent prepared from newly screened Lactobacillus plantarum MX14 and Pichia membranaceum PY33 to ferment homogenate of tomato, pepper and other auxiliary materials, so as to produce red sour soup with high acidity and low nitrite content. Compared with natural fermentation sour soup, the prepared method of the present application has a short fermentation period, and the prepared red sour soup has higher titratable acid content, lower pH and lower nitrite content, which not only shortens the fermentation period of rapid acidification of the red sour soup, but also reduces the nitrite in the red sour soup, and improves the safety of the product.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of microbial fermentation, and specifically relates to a compound microbial agent and its application in the fermentation of high-acidity Miao red sour soup. Background Technology

[0002] Red sour soup is a traditional fermented food with a long history in southwestern China, especially in the Miao ethnic minority areas of Guizhou. It is widely loved for its unique sour taste, aroma and rich nutritional value. It is not only an important part of the daily diet of local residents, but also a traditional delicacy with health benefits.

[0003] The production of red sour soup relies on natural fermentation, through the synergistic action of various microorganisms such as lactic acid bacteria and yeast, to complete complex biochemical transformations in a low pH environment. However, traditional natural fermentation methods are easily affected by environmental conditions, leading to unstable fermentation results and thus impacting the consistency of the soup's quality and flavor. Uncontrollable microbial sources can cause fermentation failure, insufficient acidity, and even food safety issues such as microbial contamination and excessive nitrite levels.

[0004] In recent years, with the development of the food industry and fermentation technology, the application of microbial research in sour soup fermentation has gradually deepened. By screening and selectively adding functional microbial agents, fermentation efficiency can be effectively improved, the fermentation process optimized, and key indicators such as acidity, flavor and safety precisely controlled, thereby improving the product quality and consistency of red sour soup.

[0005] The application of compound microbial agents not only preserves the traditional flavor and nutrition of red sour soup, but also significantly shortens fermentation time and optimizes the production process, providing technical support for the industrialization and large-scale production of sour soup. As a food that integrates tradition and modern technology, red sour soup, through scientific and standardized production, not only continues the essence of local food culture, but also opens up new paths for the industrialization of traditional fermented foods, possessing broad application prospects and significant industrial value. Summary of the Invention

[0006] To address the shortcomings of existing technologies, this invention aims to propose a compound microbial agent and its application in the preparation of red sour soup. By screening and selectively adding functional microbial agents during the fermentation of sour soup, the problems of long fermentation cycle, insufficient acidity, and high nitrite content in traditional sour soup are solved.

[0007] To achieve the above objectives, in one aspect, the present invention provides a *Lactobacillus plantarum*, wherein the *Lactobacillus plantarum* is *Lactobacillus plantarum* MX14, and its classification name is *Lactobacillus plantarum*. Lactobacillus plantarumIt was deposited on January 13, 2025 at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC NO. 33391, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.

[0008] Secondly, the present invention provides a Pichia pastoris, wherein the Pichia pastoris is Pichia membranaceus PY33, and its classification name is Pichia membranaceus. Pichia membranifaciens It was deposited on January 13, 2025 at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC NO.33392. The deposit address is No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing.

[0009] Thirdly, the present invention provides a probiotic composition comprising *Lactobacillus plantarum* as described in the first aspect and *Pichia pastoris* as described in the second aspect. Additionally, the present invention provides a bacterial agent comprising *Pichia pastoris* PY33 and *Lactobacillus plantarum* MX14.

[0010] Furthermore, the probiotic composition also includes food-acceptable carriers, excipients, or additives.

[0011] Furthermore, the viable count of *Lactobacillus plantarum* and *Pichia pastoris* in the probiotic composition is not less than 1 × 10⁻⁶. 6 CFU / mL.

[0012] Fourthly, the present invention provides a compound microbial agent, the agent comprising the probiotic composition or its fermentation product described in the third aspect.

[0013] Furthermore, the preparation method of the compound microbial agent includes: activating and subculturing *Lactobacillus plantarum* in MRS medium, and activating and subculturing *Pichia pastoris* in PDB medium, wherein the viable count of both bacteria reaches 1×10⁻⁶. 8 Once the concentration of CFU / mL reaches a certain level, centrifuge to collect the bacterial cells, dissolve them in sterile water, and mix them at a volume ratio of 1~3:1~3.

[0014] Fifthly, the present invention provides the application of the microbial composition described in the present invention or the bacterial agent described in the fourth aspect in the preparation of red sour soup.

[0015] Furthermore, the application is at least one of the following:

[0016] (1) Application in increasing the titratable acid content of red sour soup;

[0017] (2) Application in lowering the pH value of red sour soup;

[0018] (3) Application in reducing the nitrite content in red sour soup.

[0019] Sixthly, the present invention provides a method for preparing a high-acidity, low-nitrite red sour soup, the preparation method comprising the following steps:

[0020] S1. Pre-treat the sour soup ingredients to obtain red sour soup base; the sour soup ingredients include tomatoes, chili peppers, ginger, garlic, glutinous rice flour, edible salt and / or white wine, and also include scallions, onions, mustard greens or coriander;

[0021] S2. The *Lactobacillus plantarum* described in the first aspect is cultured in MRS medium until the viable count reaches 1 × 10⁻⁶. 8 CFU / mL or higher; and the Pichia pastoris described in the second aspect is cultured in a PDA until the viable count reaches 1×10⁻⁶. 8 CFU / mL or higher; a compound microbial inoculant was prepared by mixing Lactobacillus plantarum culture and Pichia pastoris culture;

[0022] S3. Add the compound microbial agent obtained in step S2 to the red sour soup slurry obtained in step S1 for fermentation, and after post-fermentation, obtain a high-acidity, low-nitrite red sour soup.

[0023] Further, the pretreatment in step S1 involves blending and pulping the sour soup ingredients, including tomatoes and / or chili peppers. Preferably, the sour soup ingredients also include ginger, garlic, glutinous rice flour, salt, and white wine.

[0024] Furthermore, the pretreatment in step S1 specifically includes: selecting tomatoes, peppers, ginger, and garlic with uniform texture, free from pests and harmful microbial contamination; removing the stems, washing them thoroughly, and then mixing and pulping them to achieve rapid maturation of the materials in subsequent steps. Glutinous rice flour, salt, and white wine are added and pulped further, then boiled for 15-20 seconds and cooled for later use to obtain the original red sour soup syrup.

[0025] In one specific embodiment of the present invention, the proportions of each material are as follows: 500-2000g tomatoes, 100-300g chili peppers, 100-300g ginger, 20-150g garlic, 5-50g glutinous rice flour, 5-50g salt, and 5-50g white wine. Preferably, the proportions are: 2000g tomatoes, 200g chili peppers, 100g ginger, 50g garlic, 20g glutinous rice flour, 30g salt, and 50g white wine.

[0026] Furthermore, the volume ratio of the Lactobacillus plantarum culture to the Pichia pastoris culture in step 2 is 1~3:1~3.

[0027] Furthermore, in step S3, the inoculation amount of the compound microbial agent is 4-8% by volume.

[0028] Furthermore, in step S3, the fermentation and post-fermentation steps specifically include: in a sterile environment, the red sour soup slurry is aseptically filled into a sterile fermentation tank, and a compound microbial agent is added at 5% (by volume). The tank is then placed in an incubator at 25-35℃ for fermentation for 96-216 hours. After fermentation, the tank is placed in a low-temperature refrigerator at 0-10℃ for post-fermentation for 12-72 hours.

[0029] In one specific embodiment of the present invention, the cultivation temperature is 28-32℃, the fermentation time is 120-168 h, the low-temperature ripening temperature is 2-6℃, and the ripening time is 24-48 h.

[0030] In a seventh aspect, the present invention provides a red sour soup prepared by the preparation method described in the sixth aspect, wherein the acidity of the red sour soup is higher than 20 mg / g and the nitrite content is lower than 10 mg / kg by weight.

[0031] Compared with the prior art, the present invention has the following advantages:

[0032] (1) The present invention screened and obtained two probiotic strains that can increase the titratable acid content of Miaojia red sour soup. The two strains were identified as Lactobacillus plantarum (named MX14) and Pichia pastoris (named PY33).

[0033] (2) The present invention provides a method for preparing high-acidity Miao red sour soup using a compound microbial agent made of MX14 and PY33. The compound microbial agent has excellent fermentation performance, which not only shortens the fermentation cycle of rapid acidification of red sour soup, but also improves the consistency and quality stability of the product.

[0034] (3) Compared with naturally fermented sour soup, the red sour soup prepared by the method of the present invention has a higher titratable acid content (increased by 32.95%), a lower pH and a lower nitrite content (reduced by 87.21%), which not only reduces the nitrite in the red sour soup, but also improves the safety of the product. Attached Figure Description

[0035] Figure 1-2 Screening of 26 dominant lactic acid bacteria strains for fermenting Miaojia red sour soup;

[0036] Figure 3 Screening of 13 yeast strains for the dominant fermentation of Miaojia red sour soup;

[0037] Figure 4 Screening for the advantageous combinations of different lactic acid bacteria and yeast co-fermentation of red sour soup;

[0038] Figure 5 The images show the colony morphology of Lactobacillus plantarum MX14 and Pichia pastoris PY33 on plate, where A represents Lactobacillus plantarum MX14 and B represents Pichia pastoris PY33.

[0039] Figure 6 These are molecular-level phylogenetic trees of the strains, where A is the molecular-level phylogenetic tree of Lactobacillus plantarum MX14 and B is the molecular-level phylogenetic tree of Pichia pastoris PY33.

[0040] Figure 7 This study compares the physicochemical properties of Miao-style red sour soup fermented with compound microbial agents (INK) and naturally fermented (CK), where A represents titratable acid, B represents pH, C represents reducing sugar content, D represents total sugar content, and E represents nitrite content, showing the changes in these contents during the fermentation process. Detailed Implementation

[0041] The following detailed embodiments further illustrate the concept and technical effects of the present invention to fully understand its purpose, features, and effects. Unless otherwise specified, all methods described are conventional methods. Unless otherwise specified, all materials are available from publicly available commercial sources. The illustrative embodiments and descriptions of the present invention are used to explain the invention and do not constitute an undue limitation thereof. It should be noted that, unless otherwise specified, the embodiments and features described in the present invention can be combined with each other.

[0042] In the following examples, *Lactobacillus plantarum* and *Pichia pastoris* were derived from naturally fermented Miao-style sour soup, and the isolated strains were deposited at the China General Microbiological Culture Collection Center. All chemical reagents used were purchased from reputable chemical reagent suppliers and were of analytical purity.

[0043] Example 1: Isolation and Purification of Bacterial Strains

[0044] The collected naturally fermented Miao-style sour soup product was serially diluted 10-fold with sterile physiological saline in a laminar flow hood. 0.1 mL of each diluted bacterial solution was evenly spread onto MRS solid medium and PDA medium, and incubated at 30°C for 12-48 h. Subsequently, under sterile conditions, single colonies with a diameter of 1-2 mm and smooth surfaces were picked from the culture base and inoculated onto fresh MRS solid medium and PDA medium using the streak plating method. This process was repeated multiple times until pure colonies were isolated and purified. The selected microorganisms were serially diluted with sterile physiological saline and incubated at 30°C for 24 h on MRS solid medium and PDA medium. Then, based on colony size, color, luster, and transparency, smooth, milky-white single colonies were picked and purified by streak plating 2-3 times on MRS solid plates and PDA plates. The strains were then stored at 4°C.

[0045] Example 2: Screening of dominant microbial strains for fermentation of high-acidity Miao-style red sour soup

[0046] Select 1000g tomatoes, 200g peppers, 100g ginger, and 50g garlic. After rinsing with running water, add 20g glutinous rice flour, 30g salt, and 50ml white wine. Mix well and boil (about 10-20 seconds). Take 300g of the mixture and divide it into 500mL fermentation tanks. Let it cool for later use. Sterilize 250mL Erlenmeyer flasks at 105℃ for 20 minutes.

[0047] The 26 activated lactic acid bacteria strains were inoculated into pre-sterilized MRS liquid medium in a clean bench and passaged 3-4 times until the viable count reached 1×10⁶. 8 When the concentration of CFU / mL is above a certain level, prepare a seed culture for later use.

[0048] Thirteen activated yeast strains were inoculated into pre-sterilized PDB liquid medium in a clean bench and passaged 3-4 times until the viable cell count reached 1×10⁻⁶. 8 When the concentration of CFU / mL is above a certain level, prepare a seed culture for later use.

[0049] Twenty-six lactic acid bacteria seed cultures and thirteen yeast seed cultures were inoculated into glutinous rice homogenate at a 5% inoculation rate for fermentation. The fermentation conditions were: static incubation at 30℃ for 120 h, followed by post-fermentation at 4℃ for 48 h. During the post-fermentation period, pH and titratable acid content were measured every 24 h at seven time points: 0, 24, 48, 72, 96, 120, 144, and 168 h. The results of these multiple measurements were compared to select the most suitable fermentation strains.

[0050] The basic measurement indicators include:

[0051] Determination of titratable acid content: determined by titration with standard sodium hydroxide solution;

[0052] pH value measurement: Measured using a pH meter;

[0053] The data was processed, analyzed, and plotted using OrginPro 21.0 plotting software.

[0054] Analysis of test results: Titratable acid content of fermentation broths from different lactic acid bacteria strains, as shown in the figure. Figure 1 As shown in the figure. The 0-120 h period represents the trend of titratable acid content during fermentation at 30℃, and the 120-168 h period represents the trend of titratable acid content during post-ripening at 4℃. Figure 1It can be seen that during the entire fermentation and post-ripening process, the titratable acid content increases rapidly in the first 72 hours, then increases slowly or even stabilizes from 72 to 120 hours. During the post-ripening process, the titratable acid content tends to stabilize or decrease slightly, while the pH value shows a decreasing trend, stabilizing after 72 hours. The change in reducing sugar content reflects the microbial metabolism, showing an overall decreasing trend, while the titratable acid content tends to stabilize or decrease slightly during the post-ripening process.

[0055] Among the lactic acid bacteria strains, 12 strains, including MX14, showed good overall performance, exhibiting high acidity, low pH, and high metabolic levels, and were initially screened for further screening.

[0056] like Figure 2 As shown, the lactic acid content, free amino acid content, and volatile organic compound composition of the above 12 lactic acid bacteria strains were compared. The results showed that MX12 and MX14 not only produced high levels of lactic acid but also had high levels of flavor-enhancing free amino acids and abundant flavor compounds.

[0057] like Figure 3 As shown in Figure A, the titratable acid content of the fermented red sour soup by the fungal strain did not change significantly; therefore, ethanol content was used as the screening indicator. Figure 3 B), among which PY33 and PX11 have high ethanol content.

[0058] From the four strains mentioned above, one lactic acid bacteria and one yeast strain were selected for combination, resulting in four combinations: A (MX12, PX11), B (MX14, PX11), C (MX12, PY33), and D (MX14, PY33). Physicochemical, flavor, and safety indicators were measured to screen for the most advantageous combinations. Figure 4 As shown, combination C (MX12, PY33) has the highest acidity value, the most vigorous sugar metabolism, and the lowest nitrite content.

[0059] Therefore, based on the above experimental results, it can be concluded that *Lactobacillus plantarum* MX14 and *Pichia pastoris* PY33 exhibit strong adaptability in the Miao-style red sour soup system, and the prepared Miao-style red sour soup is superior to that of other strains. These two strains were deposited at the China General Microbiological Culture Collection Center (CGMCC) on January 13, 2025, for further research.

[0060] The strain preservation information is as follows:

[0061] Lactobacillus plantarum was classified and named Lactobacillus plantarum MX14. Lactobacillus plantarum It was deposited on January 13, 2025 at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC NO. 33391, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.

[0062] Pichia pastoris was classified and named Pichia pastoris PY33 as Pichia membranomycin. Pichia membranifaciens It was deposited on January 13, 2025 at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC NO.33392. The deposit address is No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing.

[0063] Example 3: Strain Identification

[0064] The purified strains were systematically identified using phenotypic characteristics, 16S rDNA, and ITS.

[0065] (1) The colony morphology characteristics of the isolated strains are as follows: Figure 5 As shown, the colonies of strain MX14 on MRS plates are all milky white with relatively regular circular edges and smooth surfaces; the colonies of strain PY33 on PDA plates are all milky white with serrated edges and wrinkled surfaces.

[0066] (2) The isolated MX14 was inoculated into MRS liquid medium and activated for 24 h. 1 mL of bacterial culture was transferred to a 1.5 mL sterile centrifuge tube, and the genome was extracted using Plant Zol (TransGen kit). The extracted genomic DNA was amplified using universal bacterial primers 27F (SEQ ID NO: 1 5′-AGAGT TTGAT CCTGG CTCAG-3′) and 1492R (SEQ ID NO: 2 5′-CTACG GCTAC CTTGT TACGA-3′). The PCR conditions were as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 57℃ annealing for 30 s, 72℃ extension for 1.5 min, 25 cycles; 72℃ extension for 7 min; 3% agarose gel electrophoresis detection. The amplified samples were then sent to Beijing Ruiboxingke Biotechnology Co., Ltd. for sequencing.

[0067] Log in to the NCBI website, perform BLAST homology analysis and comparison of the MX14 16S (SEQ ID NO:3) rDNA sequencing results and PY33 ITS sequencing results with relevant information in the website's database, identify the bacterial species, and construct a phylogenetic tree. The results are as follows: Figure 6 A and Figure 6 As shown in B; MX14 is Lactobacillus plantarum; PY33 is Pichia pastoris.

[0068] Sequence information for MX14 16S:

[0069]

[0070] PY33 16S sequence information:

[0071] AGGCATCTGTGATAACCACACCACACTGTGTGGGCGCACAAAACACCTAAACCTGGAGTATACACACGTCAACAAAAGATCTAAAAGAATAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAGCAGCGAAATGCGATACCTAGTGTGAATTGCAGCCATCGTGAATCATCGAGTTCTTGAACGCACATTGCGCCCGTCGGTATTCCGGCGGG CATGCCTGTCTGAGCGTCGTTTCCTTCTTGTGCACCGGGGTCTTTGCAGATCCTCTGTGCGCAGAGCTGGCCGTGCCACTGGCCCGGCCGAAAAGAAACGTTGCGGACGAAGCGAACTACATCGGGACGCTTTGGCCGCCGAGCGAAAAAAAAAACACCATTGAGCTCGACCTCAAATCAGGTAGGAGTACCCGCTGAACTTAAGCATATCATTAGGCGGAGG(SEQ ID NO:4).

[0072] Example 4: Comparison of the quality of Miao-style sour soup fermented with compound microbial agents

[0073] Preparation of Miao-style sour soup:

[0074] Step 1. Select 1000g of tomatoes, 200g of peppers, 100g of ginger, and 50g of garlic that are uniform in texture and free from pests and harmful microorganisms. After washing them clean, blend them with 20g of glutinous rice flour, 30g of salt, and 50g of white wine. Boil for 15-20 seconds, then cool and set aside to obtain the red sour soup base.

[0075] Step 2. Prepare three groups of sour soup products, namely the natural fermentation group (CK) and the compound microbial agent fermentation group (INK), as follows:

[0076] Natural fermentation group (CK) fermentation process: Select 1000g of tomatoes, 200g of peppers, 100g of ginger, and 50g of garlic with uniform texture, free from pests and harmful microbial contamination; after cleaning, mix them with 20g of glutinous rice flour, 30g of edible salt, and 50g of white wine, and place them in a 30℃ incubator for 5 days of fermentation.

[0077] The fermentation process of the compound microbial agent fermentation group (INK) involves culturing *Lactobacillus plantarum* MX14 in MRS medium until the viable count reaches 1×10⁻⁶. 8 CFU / mL or higher; and Pichia pastoris PY33 was cultured in PDA, with a viable count reaching 1×10⁻⁶. 8 CFU / mL or higher; mix Lactobacillus plantarum culture and Pichia pastoris culture to prepare a compound microbial agent. Add 5% (by volume) of the prepared compound microbial agent to the red sour soup slurry prepared in step 1, and place it in a 30℃ incubator for fermentation for 5 days.

[0078] like Figure 7 As shown in Figure A, during the fermentation cycle, the titratable acid value of the compound microbial inoculant fermentation group (INK) was consistently higher than that of the naturally fermented group (CK). In the inoculated fermentation group, the titratable acid content increased rapidly two days after inoculation, then continued to increase, but the rate of increase slowed, reaching 21 ± 0.19 at the end of fermentation. In contrast, the naturally fermented group showed a slower increase in titratable acid content during the first three days of fermentation, followed by an increased rate of increase, reaching 15.8 ± 0.06 at the end of fermentation. Figure 7 Both fermentation methods had initial pH values ​​higher than 4.0; however, the initial acidity of the CK group was higher than that of the INK group, which may be related to changes in the composition of the sour soup during sterilization. Throughout the 5-day fermentation period, the pH value of the INK group remained lower than that of the naturally fermented group. On day 1 of fermentation, the pH value of the INK group dropped sharply from 4.01±0.01 to 3.31±0.02. As fermentation time increased, the pH value continued to decrease, but the rate of decrease gradually slowed, eventually reaching 3.06±0.02 at the end of fermentation. In contrast, the pH value of the CK group showed no significant change in the first 3 days of fermentation, but the rate of decrease accelerated significantly on day 4, dropping from 4.01±0.01 to 3.54, and ending at 3.33±0.01. These results can be attributed to the rapid growth of MX14 and PY33 during inoculation and the five days following fermentation, leading to the accumulation of lactic acid and other organic acids, thus lowering the pH value. These results indicate that microbial inoculation plays an important role in enhancing the fermentation characteristics and overall quality of Miao-style red sour soup.

[0079] like Figure 7 As shown in C, although the reducing sugar content in the INK group was slightly higher than that in the CK group at the beginning of fermentation, the reducing sugar content in the INK group was much lower than that in the CK group during fermentation (p<0.05). Meanwhile, the total sugar content in the INK group ( Figure 7D) was consistently significantly lower than that of the CK group (p<0.05). This result may be due to the more vigorous microbial growth and metabolism in the INK group. Furthermore, the starch and other polysaccharides in Miao-style red sour soup were not directly utilized by the microorganisms, but rather, through complex microbial interactions, oligosaccharides and polysaccharides were broken down into reducing sugars, some of which were further metabolized. Overall, total sugar was converted into reducing sugars during fermentation, indicating that microbial activity plays a crucial role in altering the carbohydrate composition of Miao-style red sour soup.

[0080] like Figure 7 As shown in Figure E, the nitrite content in the INK group decreased from 0.76±0.03 mg / kg to 0.3±0.01 mg / kg during days 0-5. The nitrite content in the CK group showed a trend of first increasing and then decreasing, peaking at 1.21±0.07 mg / kg on day 2, and then gradually decreasing to 0.56±0.04 mg / kg. These results indicate that, compared with natural fermentation, the compound microbial agent composed of MX14 and PY33 can effectively control the nitrite content in red sour soup.

[0081] The embodiments described above are only some embodiments of the present invention, not all embodiments. Other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are all within the scope of protection of the present invention.

Claims

1. A Pichia pastoris, characterized in that, The Pichia membranifaciens mentioned is Pichia membranifaciens PY33, which was deposited at the China General Microbiological Culture Collection Center on January 13, 2025, with the accession number CGMCC NO.33392.

2. A probiotic composition, characterized in that, The microbial composition comprises a *Lactobacillus plantarum* and *Pichia pastoris* as described in claim 1. The Lactobacillus plantarum mentioned is Lactobacillus plantarum MX14, which is classified as Lactobacillus plantarum and was deposited at the China General Microbiological Culture Collection Center on January 13, 2025, with the accession number CGMCC NO.33391.

3. A compound microbial agent, characterized in that, The probiotic agent includes the probiotic composition of claim 2 or its fermentation product.

4. The use of the microbial composition of claim 2 or the inoculant of claim 3 in the preparation of red sour soup.

5. The application according to claim 4, characterized in that, The application is at least one of the following: (1) Application in increasing the titratable acid content of red sour soup; (2) Application in lowering the pH value of red sour soup; (3) Application in reducing the nitrite content in red sour soup.

6. A method for preparing a high-acidity, low-nitrite red sour soup, characterized in that, The preparation method includes the following steps: S1. Tomatoes, peppers, ginger, garlic, glutinous rice flour, edible salt, and white wine are pretreated to obtain red sour soup base; S2. The *Lactobacillus plantarum* of claim 2 is cultured in MRS medium until the viable count reaches 1 × 10⁻⁶. 8 CFU / mL or higher; and the *Pichia pastoris* strain described in claim 2 is cultured in a PDA to achieve a viable count of 1 × 10⁻⁶. 8 CFU / mL or higher; a compound microbial inoculant was prepared by mixing Lactobacillus plantarum culture and Pichia pastoris culture; S3. Add the compound microbial agent obtained in step S2 to the red sour soup slurry obtained in step S1 for fermentation, and after post-fermentation, obtain a high-acidity, low-nitrite red sour soup.

7. The preparation method according to claim 6, characterized in that, The pretreatment in step S1 involves washing tomatoes, peppers, ginger, and garlic, then mixing them with glutinous rice flour, salt, and white wine to make a paste.

8. The preparation method according to claim 7, characterized in that, The volume ratio of the Lactobacillus plantarum culture and the Pichia pastoris culture in step 2 is 1-3:1-3.

9. The red sour soup prepared by the preparation method according to any one of claims 6-8, characterized in that, The acidity of the red sour soup is higher than 20 mg / g, and the nitrite content is lower than 10 mg / kg by weight.

Citation Information

Patent Citations

  • Direct vat set leek red sour soup fermentation inoculant as well as preparation method and application thereof

    CN118546824A