A nucleic acid aptamer binding to GPRIN1 protein, its application and screening method
By using SELEX technology to screen and modify the nucleic acid aptamer GRIN1-19, the problems of insufficient affinity and stability in GPRIN1 protein detection and targeted drug development have been solved, achieving highly sensitive and specific detection and therapeutic effects.
Patent Information
- Application Number
- CN202411538778.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-10-31
- Publication Date
- 2025-10-28
- Estimated Expiration
- 2044-10-31
AI Technical Summary
There is a lack of high-affinity and high-specificity nucleic acid aptamers for the detection of GPRIN1 protein and the development of targeted drugs in the current technology, and existing nucleic acid aptamers have shortcomings in terms of modification and stability.
The nucleic acid aptamer GRIN1-19 with a specific nucleotide sequence was screened using SELEX technology, and its binding affinity and stability were improved by modification such as phosphorylation and methylation. At the same time, it was modified by combining fluorescent labeling and radioactive substances to form nucleic acid aptamer derivatives.
Nucleic acid aptamers with high affinity, good specificity, and easy modification and preservation were obtained, which are suitable for high-sensitivity detection and targeted drug development, and have broad application prospects.
Smart Images

Figure CN119570798B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, and in particular to a nucleic acid aptamer that binds to the GPRIN1 protein, its application, and a screening method thereof. Background Technology
[0002] GRIN1 (Glutamate Ionotropic Receptor NMDA Type Subunit 1) is a novel protein with no substantial homology to known protein domains. It is primarily expressed in the brain and specifically binds to activated G(z)alpha, G(o)alpha, and G(i)alpha via its C-terminal region. The protein KIAA0514 (GRIN2) shares C-terminus homology with GRIN1 and also binds to activated G(o)alpha. Both GRIN1 and G(o)alpha are membrane-bound proteins enriched in neurite growth cones. Co-expression of GRIN1 or GRIN2 with activated G(o)alpha leads to the formation of a fine process network in Neuro2a cells, suggesting that these pathways may function downstream of G(o)alpha to control neurite growth.
[0003] GRIN1-related disorders include neurodevelopmental disorders with or without ADHD and seizures, autosomal dominant and neurodevelopmental disorders with or without ADHD and seizures, and autosomal recessive inheritance. Related pathways include NMDA receptor unblocking, glutamate binding and activation, and the MAPK family signaling cascade.
[0004] Nucleic acid aptamers are DNA or RNA molecules isolated through systematic evolution of ligands using exponential enrichment (SELEX) technology. They can bind with high affinity and specificity to other targets such as proteins, metal ions, small molecules, peptides, and even whole cells, thus showing broad prospects in biochemical analysis, environmental monitoring, basic medicine, and new drug synthesis. Compared with antibodies, nucleic acid aptamers have advantages such as smaller molecular weight, better stability, ease of modification, no immunogenicity, and shorter production cycle, eliminating a series of processes such as animal immunization, feeding, protein extraction, and purification. Therefore, finding nucleic acid aptamers with higher affinity and high specificity for GPRI N1 protein will help achieve high-sensitivity and high-specificity detection of GPRI N1 protein and facilitate drug development targeting GPRI N1 protein.
[0005] Therefore, there is an urgent need to find a nucleic acid aptamer that has high binding affinity for GPRI N1 protein, good specificity, maintains high binding affinity even after precise truncation, is easy to modify and synthesize artificially, has good stability, and is convenient to use. Summary of the Invention
[0006] To overcome at least one of the defects described in the prior art, the present invention provides a nucleic acid aptamer that binds to the GPRI N1 protein, its application, and a screening method thereof. This addresses the problem.
[0007] The technical solution adopted by this invention to solve its problem is:
[0008] A nucleic acid aptamer that binds to the GPRI N1 protein, said nucleic acid aptamer having a nucleotide sequence as shown in SEQ ID NO.1; or a nucleotide sequence having at least 30% homology to SEQ ID NO.1 and binding to the GPRI N1 protein; or an RNA sequence transcribed from a nucleotide sequence as shown in SEQ ID NO.1.
[0009] Based on SELEX technology, the inventors designed and synthesized a random single-stranded DNA library and corresponding primers to screen for nucleic acid aptamers that have small molecular weight, stable chemical properties, are easy to store and label, and can bind to GPRI N1 protein with high affinity. A nucleic acid aptamer with high affinity for binding to GPRI N1 protein, GRI N1-19 (SEQ ID NO.1), was obtained through screening. This nucleic acid aptamer has high affinity for GPRI N1 protein and high specificity.
[0010] It is understood that any nucleotide sequence of the nucleic acid aptamer provided by the present invention that has at least 30%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 92%, at least 94%, at least 96%, at least 98%, or at least 99% homology with the GPRI N1 protein and binds to it, for example, by deleting or adding a portion of the nucleotide sequence of any of the above-described nucleic acid aptamers, still has a high affinity for the GPRI N1 protein and is still within the protection scope of the present invention.
[0011] In some approaches, as an improvement to the above-mentioned technical solutions, a certain position on the nucleotide sequence of the nucleic acid aptamer can be modified, for example, by phosphorylation, methylation, aminoation, thiolation, substitution of oxygen with sulfur, substitution of oxygen with selenium, or isotopization, provided that the nucleic acid aptamer sequence obtained after such modification has the desired properties. For example, it can have the same or higher affinity for binding GPRIN1 protein as the original parent nucleic acid aptamer sequence before modification, or it can have higher stability even if the affinity is not significantly improved.
[0012] Therefore, in some embodiments, the nucleotide sequence of the nucleic acid aptamer is modified and the modified nucleic acid aptamer specifically binds to the GPRIN1 protein. The modification is selected from at least one of phosphorylation, methylation, amination, thiolation, substitution of oxygen with sulfur, substitution of oxygen with selenium, and isotopization, which is still within the scope of protection of this invention.
[0013] Furthermore, the nucleic acid aptamer has a sequence obtained by modifying the nucleotide sequence of the GPRIN1 protein to have at least 30% homology with any one of the sequences in SEQ ID NO.1.
[0014] Furthermore, the modification includes at least one of the following modification methods:
[0015] (1) Connect fluorescent markers to nucleic acid aptamers;
[0016] (2) Connecting radioactive materials to nucleic acid aptamers;
[0017] (3) Attach therapeutic substances to nucleic acid aptamers;
[0018] (4) Link biotin onto the nucleic acid aptamer;
[0019] (5) Connect digoxigenin to the nucleic acid aptamer;
[0020] (6) Connecting nanoluminescent materials to nucleic acid aptamers;
[0021] (7) Link small peptides to nucleic acid aptamers;
[0022] (8) Link siRNA onto the nucleic acid aptamer.
[0023] The nucleic acid aptamer conjugates described in this invention refer to nucleic acid aptamers to which other groups are attached, such as fluorescent markers with labeling functions, such as FAM, radioactive substances, therapeutic substances, biotin, digoxigenin, nanoluminescent materials, small peptides, siRNA, or enzyme labels, so that the modified nucleic acid aptamer sequence has the desired properties. For example, it can have the same or higher affinity for binding GPRIN1 protein as the original parent nucleic acid aptamer sequence before modification, or although the affinity is not significantly improved, it has higher stability.
[0024] In other words, all of the above-mentioned nucleic acid aptamers, whether partially substituted or modified, have the same or similar molecular structure, physicochemical properties and functions as the original nucleic acid aptamers, and can all be used to bind to the GPRIN1 protein.
[0025] The present invention also provides a derivative of a nucleic acid aptamer, employing the above-mentioned nucleic acid aptamer that binds to GPRIN1 protein, wherein the derivative of the nucleic acid aptamer comprises a phosphate thioester backbone or peptide nucleic acid that binds to GPRIN1 protein, modified from the nucleotide sequence backbone of the nucleic acid aptamer or a conjugate of the nucleic acid aptamer.
[0026] The term "thiophosphate backbone" as used in this invention has the meaning commonly understood by those skilled in the art, referring to the fact that the non-bridging oxygen atoms of the phosphodiester backbone of RNA and DNA nucleic acid aptamers can be replaced by one or two sulfur atoms, respectively, to produce a thiophosphate backbone with thiophosphate or dithiophosphate bonds. Such thiophosphate backbones are known to have increased binding affinity to their targets and enhanced resistance to nuclease degradation.
[0027] The term "peptide nucleic acid" as used in this invention has the meaning commonly understood by those skilled in the art, referring to a synthetically produced DNA molecule analog first reported by Nielsen et al. in 1991. By replacing the sugar-phosphate backbone with N-(2-aminoethyl)-glycine units as repeating structural units, oligonucleotide analogs linked by peptide bonds were synthesized, called peptide nucleic acids. Because peptide nucleic acids (PNAs) lack phosphate groups like those on DNA or RNA, there is no electrostatic repulsion between PNAs and DNA, resulting in a stronger binding strength between them than between DNA molecules.
[0028] The present invention also provides a use of a nucleic acid aptamer and a nucleic acid aptamer derivative, including at least one of the following:
[0029] (1) Quantitative or qualitative detection of GPRIN1 protein;
[0030] (2) Purify GPRIN1 protein;
[0031] (3) Imaging of GPRIN1 protein;
[0032] (4) Prepare drugs that target the GPRIN1 protein;
[0033] (5) Prepare reagents or drugs for the diagnosis and treatment of abnormal GPRIN1 expression;
[0034] This invention also provides a method for screening nucleic acid aptamers that bind to the GPRIN1 protein, comprising the following steps:
[0035] S1. Synthesize random single-stranded DNA libraries and primers;
[0036] S2, Magnetic bead screening: Perform at least 7 rounds of reverse screening and selection, and add serum starting from the 4th round.
[0037] Furthermore, in step S2, serum is added after the fourth round. Specifically, 5% serum is added in the fourth round and 20% serum is added in the fifth round; the serum is normal human serum.
[0038] Nucleic acid aptamer screening is routinely performed in ion-buffered saline. However, under these screening conditions, a certain concentration of serum is gradually added. This is because serum contains abundant proteins that can competitively bind to the library along with the proteins on the magnetic bead surface, thereby removing sequences that have weak binding affinity to the target GPRI N1 protein or are merely adsorbed. Furthermore, the aptamer binding to the target in a serum environment better meets the practical detection requirements for future applications developed based on nucleic acid aptamers.
[0039] Studies have shown that using higher concentrations of serum in the final rounds of screening can yield nucleic acid aptamers with higher affinity and better specificity.
[0040] In summary, the nucleic acid aptamer for binding GPRI N1 protein, its application, and its screening method provided by this invention have the following technical effects:
[0041] 1. By improving the screening conditions, a nucleic acid aptamer with small molecular weight, stable chemical properties, easy storage and labeling was obtained, which can bind to GPRI N1 protein with high affinity and high specificity;
[0042] 2. The structure is relatively stable, simple, easy to modify, and can be artificially synthesized in a short period of time; it is chemically stable, easy to store, and easy to label.
[0043] 3. It can be used in detection, diagnosis, imaging and treatment, such as for purification or high-sensitivity, high-specificity detection of GPRI N1 protein; for the preparation of drugs targeting GPRI N1 protein; and for reagents or drugs for the diagnosis and treatment of abnormal GPRI N1 expression, etc., with broad application prospects. Attached Figure Description
[0044] Figure 1 This is a schematic diagram illustrating the binding ability of the enriched libraries obtained from rounds 1 to 7 of screening to the target protein, as detected by qPCR (quantitative real-time PCR) in Example 1.
[0045] Figure 2 This is a schematic diagram of the melting curves of the enriched libraries and target proteins obtained from the first to seventh rounds of screening, as shown in Example 1, using qPCR (quantitative real-time PCR).
[0046] Figure 3 This is a schematic diagram showing the retention rates of the positive screening libraries obtained in rounds 1 to 7 of Example 1;
[0047] Figure 4 This is a graph showing the affinity test data between the nucleic acid aptamer GRIN1-19 and the GRIN1 protein in Example 2;
[0048] Figure 5 This is a schematic diagram of the affinity detection data between nucleic acid aptamer GRIN1-19 and B-Amyloid in Example 3;
[0049] Figure 6 This is a schematic diagram of the affinity detection data between nucleic acid aptamer GRIN1-19 and TF in Example 3;
[0050] Figure 7 This is a schematic diagram of the affinity detection data between nucleic acid aptamer GRIN1-19 and SNCA in Example 3;
[0051] Figure 8 This is a schematic diagram of the affinity detection data between nucleic acid aptamers GRIN1-19 and ADP7 in Example 3;
[0052] Figure 9 This is a schematic diagram showing the results of the dot blot hybridization experiment of nucleic acid aptamers in Example 4 to detect the specificity of GPRIN1 protein.
[0053] Figure 10 This is a schematic diagram showing the results of the dot blot hybridization experiment of nucleic acid aptamers in Example 4 to detect the concentration gradient of GPRIN1 protein. Detailed Implementation
[0054] For better understanding and implementation, the technical solutions in the embodiments of the present invention will be clearly and completely described and discussed below in conjunction with the drawings of the present invention. Obviously, what is described here is only a part of the examples of the present invention, not all the examples. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention.
[0055] To facilitate understanding of the embodiments of the present invention, further explanations and descriptions will be provided below with reference to the accompanying drawings and specific embodiments, and these embodiments do not constitute a limitation on the embodiments of the present invention.
[0056] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used herein in the description of the invention is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.
[0057] Example 1: Screening of ssDNA aptamers binding to GPRIN1 protein
[0058] The method for screening ssDNA aptamers that bind to the GPRIN1 protein in this embodiment includes the following steps:
[0059] 1. Synthesize the random single-stranded DNA library and primers shown in the following sequences:
[0060] Random single-stranded DNA library:
[0061] 5'-TTCAGCACTCCACGCATAGC(36N)CCTATGCGTGCTACCGTG AA-3'(SEQ ID NO.2);
[0062] "36N" indicates a sequence consisting of 36 arbitrary nucleotide bases linked together. This library was synthesized by Sangon Biotech (Shanghai) Co., Ltd.
[0063] Primer information is shown in Table 1, synthesized by Nanjing GenScript Biotech Co., Ltd.
[0064] Table 1. Primers and their sequences
[0065] Primer name Sequence (5'-3') Lib13S1 TTCAGCACTCCACGCATAGC(SEQ ID NO.3) Lib13-FAM-S1 FAM-TTCAGCACTCCACGCATAGC(SEQ ID NO.4) Lib13-Biotin-A2 Biotin-TTCACGGTAGCACGCATAGG(SEQ ID NO.5) Lib13A2 TTCACGGTAGCACGCATAGG(SEQ ID NO.6)
[0066] In the primer names, S represents the forward primer and A represents the reverse primer.
[0067] Primers were prepared into 100 μM stock solutions using DPBS buffer (calcium chloride 0.1 g / L, potassium chloride 0.2 g / L, potassium dihydrogen phosphate 0.2 g / L, magnesium chloride hexahydrate 0.1 g / L, sodium chloride 8 g / L, disodium hydrogen phosphate dodecahydrate 2.8915 g / L; pH 7.4, 25℃) and stored at -20℃ for later use.
[0068] 2. Magnetic bead screening method
[0069] The magnetic bead method was used for screening, and a total of 7 rounds of screening were conducted. The screening process for each round is shown in Table 2.
[0070] Table 2. Screening process for GPRIN1 protein aptamers
[0071]
[0072]
[0073] The specific screening process is as follows:
[0074] 1) Immobilization of GPRIN1 protein with carboxyl magnetic beads
[0075] Take 50 μl of carboxyl magnetic beads (Jiangsu Zecheng Biotechnology Co., Ltd., catalog number: FM2221), wash them four times with 200 μl of ultrapure water, and use a magnet to fish out the magnetic beads, then remove the supernatant. Take 100 μl each of the prepared NHS (N-hydroxysuccinimide; 0.1M aqueous solution) and EDC (1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride; 0.4M aqueous solution), mix them in equal volumes, add them to the magnetic beads, and incubate at 25°C for 20 minutes to activate the carboxyl groups on the surface of the magnetic beads. Wash the magnetic beads twice with DPBS buffer before use.
[0076] Take 32 μl of GPRIN1 protein (purchased from Ibsen Scientific, P03428PA, concentration of 1 mg / ml after dissolution), add 468 μl of 10 mM sodium acetate at pH 5.5, mix well, and then add to the activated magnetic beads. Incubate at 25°C on a vertical mixer for 60 minutes. The GPRIN1 protein will couple to the surface of the magnetic beads through the amino groups on its surface.
[0077] After coupling, place the coupling tube on a magnetic rack, discard the supernatant, and add 500 μl of 1M ethanolamine (pH 8.5) to the magnetic beads. Incubate at 25°C on a vertical mixer for 10 minutes to block unreacted activation sites on the surface of the magnetic beads. Place the tube on a magnetic rack and discard the blocking solution. Wash the magnetic beads four times with 250 μl of DPBS and label them MB-GPRIN1.
[0078] 2) Reverse screening and screening
[0079] Preparation of reverse screening magnetic beads: His peptides were coupled to magnetic beads. The His peptides were chemically synthesized by Nanjing Genscript Biotech Co., Ltd. The coupling steps for the His peptides were the same as those for the GPRIN1 protein. The concentration of the His peptides was 10 mg / ml, diluted with 10 mM NaAc solution at pH 4.5. Specifically, 10 μl of His peptides was added to 90 μl of 10 mM NaAc solution at pH 4.5 and mixed thoroughly. The remaining steps were the same. The coupled magnetic beads were labeled MB-His.
[0080] Library dissolution and renaturation: Take 1 OD of random single-stranded nucleotide library, centrifuge at 14000 rpm for 5 minutes, and centrifuge to the bottom of the tube. Dissolve in DPBS buffer to 10 μM, mix well, and aliquot into PCR tubes for renaturation. The process is as follows: Set the PCR instrument to 95℃ for 10 minutes to unfold the strands, then incubate at 4℃ for 5 minutes, and then equilibrate to room temperature. Add the treated library to 50 μl of MB-His magnetic beads, mix well, and incubate at room temperature for a period of time on a vertical mixer. Place on a magnetic rack, collect the supernatant, and label it pool-. The supernatant is used as a single-stranded nucleic acid library for positive screening with MB-GPRIN1 magnetic beads. In each round of magnetic bead screening, before performing positive screening targeting GPRIN1 protein, perform reverse screening with MB-His. The supernatant from the reverse screening is used as a single-stranded nucleotide library for positive screening with MB-GPRIN1 magnetic beads. Specifically, the pooled library after reverse screening was added to 50 μl of MB-GPRIN1 magnetic beads and incubated at 25°C for 40 minutes on a vertical mixer. The mixture was then placed on a magnetic rack, the supernatant was discarded, and the magnetic beads were retained. The beads were washed four times with 200 μl of DPBS. Finally, 200 μl of DPBS was added to the washed magnetic beads, and the mixture was incubated in a boiling water bath for 10 minutes. The supernatant was collected and labeled as elution-GPRIN1.
[0081] Using the nucleic acid molecules in elution-GPRIN1 as templates, amplification was performed using conventional PCR. The method is as follows: All elution-GPRIN1 template was added to 2 ml of PCR mix and mixed thoroughly. The template and PCR mix mixture was then aliquoted into 100 μl tubes and added to PCR tubes. The amplification conditions were as follows: 95℃ pre-denaturation for 2 minutes, 95℃ denaturation for 60 seconds, 60℃ annealing for 60 seconds, and 72℃ extension for 60 seconds, for a total of 25 cycles. The mixture was stored at 4℃. The PCR mix was prepared using dNTPs (P031-02) purchased from Novizan and rtaq enzyme (R500Z) purchased from Takara Bio.
[0082] The amplification products were purified using commercially available Tiandiren SA magnetic beads (SM017100) to prepare a secondary library for the next round of screening. 2 mL of PCR product was mixed with 1 / 5 volume of 4M sodium chloride, followed by 160 μL of SA magnetic beads that had been washed with DPBS and had their supernatant removed. The mixture was incubated on a shaker at room temperature for 30 min, after which the PCR supernatant was removed. The magnetic beads were then washed three times with DPBS containing 0.02% Tween 20, and after removing the supernatant, 100 μL of 40 mM sodium hydroxide solution was added. After incubation for three minutes, the magnetic beads were magnetically removed. 4 μL of 1M hydrochloric acid was added to the supernatant to neutralize the single strands, followed by 104 μL of 2*DPBS for salt dilution and neutralization. Finally, 208 μL of the secondary library dissolved in 1*DPBS was obtained, which can be used as the library for the next round of screening.
[0083] The magnetic bead screening method was repeated seven times. Each operation used the secondary library obtained from the previous operation as the starting nucleic acid library. After renaturation treatment, the library was incubated with MB-GPRIN1 magnetic beads. During the screening process, SPR was used to detect changes in the recognition ability of the DNA single-stranded library for the GPRIN1 protein. When the recognition ability of the DNA single-stranded library for the GPRIN1 protein met the requirements, i.e., the binding ability of the screened DNA single-stranded library to the target protein was higher than that of the initial library used in the screening (…), the screening was successful. Figure 1 ), Figure 1 In the diagram, p1, p2, p3, p4, and p6 represent the libraries obtained in rounds 1, 2, 3, 4, and 6, respectively. It can be seen that the libraries obtained in rounds 5 and 6 have high affinity for the target, and p6 has much higher affinity than p1 and p2, which meets the sequencing requirements. The obtained libraries were then analyzed by high-throughput sequencing.
[0084] 3. Analysis and identification of nucleic acid aptamers obtained after screening: After high-throughput sequencing analysis of the enriched library products, several sequences were selected and synthesized by Genewiz Biotechnology (Jiangsu) Co., Ltd., and their affinity was tested.
[0085] In subsequent testing, from the 100 sequences obtained in the final 7th round, one sequence with the strongest binding ability was identified. This nucleic acid aptamer, with the nucleotide sequence shown in SEQ ID NO.1, was named GRIN1-19. The specific sequence of SEQ ID NO.1 is TTCAGCACTCC ACGCATAGCACGGTCTGTGCCTGCGGTTGTTCAAGGGCTGTATTGCC TATGCGTGCTACCGTGAA.
[0086] Example 2: Surface plasmon resonance (SPR) detection of the affinity between GPRIN1 protein aptamers and GPRIN1 protein.
[0087] The nucleic acid aptamer GRIN1-19 (SEQ ID NO.1) was synthesized by Suzhou Genewiz Biotechnology Co., Ltd., and diluted to 500 nM with DPBS buffer.
[0088] 1. GPRIN1 protein was coupled to channel 2 of the CM5 chip surface using the following method: First, the chip was cleaned with 50 mM NaOH, and 20 μL was injected at a flow rate of 10 μL / min. Then, 50 μL of a mixture of equal volumes of EDC (1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride; 0.4 M aqueous solution) and NHS (N-hydroxysuccinimide; 0.1 M aqueous solution) was injected to activate the chip at a flow rate of 5 μL / min. GPRIN1 protein was diluted with 10 mM sodium acetate at pH 5.5 to a final concentration of 20 μg / mL and then injected at a flow rate of 5 μL / min, resulting in a GPRIN1 protein coupling amount of 3359 Ru. After injection, 100 μL of ethanolamine was injected to block the chip at a flow rate of 10 μL / min. Channel 1 was treated similarly, with the same activation and blocking steps, serving as a control channel.
[0089] 2. Detection: Using a surface plasmon resonance spectrometer (GE Healthcare, model: Biacore 8K), the detection parameters were set. One diluted aptamer sample was sequentially flowed through channels 1 and 2. The procedure for each aptamer was as follows: injection 30 μL / min, time 2 min; dissociation 30 μL / min, time 2 min; regeneration 30 μL / min of 1M NaCl, time 30 s. One diluted nucleic acid aptamer was then sequentially injected.
[0090] Affinity assay data for nucleic acid aptamer GRIN1-19 and GPRIN1 protein are shown in [link to data]. Figure 4 The KD values are shown in Table 3 below, illustrating the binding affinity of the corresponding nucleic acid aptamers to the target protein GPRIN1. These data demonstrate that all of these nucleic acid aptamers exhibited strong binding to the GPRIN1 protein as detected by the SPR instrument.
[0091] Table 3. Affinity between nucleic acid aptamers and GPRIN1 protein (the smaller the KD value, the greater the affinity).
[0092] Nucleic acid aptamers Affinity to GPRIN1 protein KD (nM) GRIN1-19 (SEQ ID NO.1) 8.90
[0093] As can be seen from Table 3, the nucleic acid aptamer (SEQ ID NO.1) obtained from the screening of 100 sequences has a particularly high affinity for the GPRIN1 protein.
[0094] Example 3: Specificity study of nucleic acid aptamers
[0095] In this embodiment, B-Amyloid, TF, SNCA, and ADP7 were used instead of GPRIN1 protein, following the same method as in Example 4 where GPRIN1 protein was immobilized onto the SPR chip for testing. B-Amyloid, TF, SNCA, and ADP7 proteins were coupled to the second channel of four channels on the CM5 chip surface, with coupling amounts of 322 RU, 2268 RU, 1413 RU, and 3824 RU, respectively. One diluted GRIN1-19 aptamer was then sequentially injected.
[0096] Affinity assay data for nucleic acid aptamer GRIN1-19 and β-Amyloid are shown in [link to data]. Figure 5 Affinity test data with TF can be found in Figure 6 Affinity test data with SNCA can be found in [link to relevant data]. Figure 7 Affinity test data with ADP7 can be found in [link to relevant data]. Figure 8 ;
[0097] It is evident that the nucleic acid aptamer GRIN1-19 exhibits very high specificity.
[0098] Example 4: Detection of GPRIN1 protein using dot blot hybridization based on nucleic acid aptamers
[0099] The dot blot hybridization experiment performed on GRIN1-19, a nucleic acid aptamer with high affinity and high specificity, in this embodiment is as follows:
[0100] 1. Take two 8cm×2cm nitrocellulose membranes (purchased from Millipore), dilute GPRIN1 protein to 1mg / ml with DPBS, and also dilute control proteins B-Amyloid, TF, SNCA, and ADP7 to 1mg / ml. Spot 2ul of each sample onto the nitrocellulose membrane and allow it to air dry for 40 minutes.
[0101] 2. After drying, block with 10% BSA at room temperature for 1 hour. After blocking, wash 3 times with DPBST (DPBS containing 0.5% Tween 20) and aspirate.
[0102] 3. After the cellulose membrane is cleaned, the nucleic acid aptamer synthesized by Genewiz in Example 3 is modified with biotin and diluted to 0.5 μM. The diluted nucleic acid aptamer is then incubated with the protein on the nitrocellulose membrane on a shaker at room temperature for 30 min. After incubation, the membrane is washed three times with DPBST, with each wash placed on a shaker for 5 minutes.
[0103] 4. Transfer the test strip to a new centrifuge tube. Dilute HRP-Streptavidin (1 mg / ml from Beyotime Biotech) with DPBS buffer at a ratio of 1:2000. Add 3 mL of the diluted solution to the tube and incubate at room temperature in the dark for 30 minutes. After incubation, wash with DPBS-T for 2 minutes, repeating the washing process 3 times. Aspirate the solution thoroughly.
[0104] 5. Transfer the test strip to a clean PE glove, take the ECL colorimetric kit (purchased from Beyotime Biotech), mix 100uL of solution A and 100uL of solution B, wet the surface of the test strip, and incubate in the dark for 5 minutes.
[0105] 6. Imaging system observation and photography: The instrument used was the ImageQuant™ LAS 4000 digital imaging system from GE Healthcare Life Sciences.
[0106] The results are as follows Figure 9 The image shown is a result of specificity testing using GRIN1-19.
[0107] Depend on Figure 9 It can be seen that the biotin-modified nucleic acid aptamer GRIN1-19 can be used for the detection of GPRIN1 protein in membrane hybridization. Compared with the spots of control proteins B-Amyloid, TF, SNCA, and ADP7, the GPRIN1 protein spots are more prominent, indicating that this nucleic acid aptamer can be used to accurately detect GPRIN1 protein. Therefore, the nucleic acid aptamer GRIN1-19 is used for the detection of GPRIN1 protein.
[0108] This embodiment also uses a concentration gradient of GRIN1-19 for the detection of GPRIN1 protein. GRIN1-19 was diluted with DPBS to 1 mg / mL, 0.50 mg / mL, 0.250 mg / mL, 0.125 mg / mL, 0.063 mg / mL, and 0.032 mg / mL, and then the dot blot hybridization experiment was performed as described above. The results are as follows. Figure 10 As shown, the nucleic acid aptamer GRIN1-19 can be used to accurately detect 0.032 mg / mL of GPRIN1 protein.
[0109] Therefore, GRIN1-19 is the optimal choice, as it offers the highest sensitivity and accuracy in detection results.
[0110] The technical means disclosed in this invention are not limited to those disclosed in the above embodiments, but also include technical solutions composed of any combination of the above technical features. It should be noted that those skilled in the art can make various improvements and modifications without departing from the principles of this invention, and these improvements and modifications are also considered within the scope of protection of this invention.
Claims
1. A nucleic acid aptamer that binds to the GPRIN1 protein, characterized in that, The nucleic acid aptamer is a nucleotide sequence as shown in SEQ ID NO.
1.
2. The nucleic acid aptamer for binding GPRIN1 protein according to claim 1, characterized in that, The sequence obtained by modifying the nucleic acid aptamer to bind to the nucleotide sequence of the GPRIN1 protein, wherein the modification includes at least one of the following modification methods: (1) Connect fluorescent markers to nucleic acid aptamers; (2) Connecting radioactive materials to nucleic acid aptamers; (3) Link biotin onto the nucleic acid aptamer; (4) Connect digoxigenin to the nucleic acid aptamer.
3. The use of the nucleic acid aptamer according to any one of claims 1-2, characterized in that, Includes at least one of the following: (1) Detection of GPRIN1 protein; (2) Imaging of GPRIN1 protein; All of the above uses are for non-diagnostic and therapeutic purposes.
Citation Information
Patent Citations
Nucleic acid aptamer for specifically recognizing sST2 protein and application of nucleic acid aptamer
CN118406685A
Aptamer combined with Trop2 protein and application thereof
CN118726365A