Application of PvALS mutant in improving herbicide resistance of switchgrass

Abstract

The invention provides application of a PvALS mutant in improving herbicide resistance of switchgrass, and relates to the technical field of gene engineering. According to the method, a switchgrass single base editing system is established by infecting switchgrass calluses with agrobacterium, a new method is provided for switchgrass gene editing, and a foundation is laid for switchgrass functional gene research and breeding work. The PvALS mutant plant obtained by the invention has excellent herbicide resistance, provides a new herbicide-resistant resource for switchgrass, and can be widely planted in various environments as an energy crop.

Description

Technical Field

[0001] The present application relates to the field of genetic engineering technology, and in particular to the application of a PvALS mutant in improving the herbicide resistance of switchgrass. Background Art

[0002] Renewable energy, especially energy crops, is a new hot spot in energy research. Switchgrass (Panicum virgatum) is a perennial warm-season grass (C4) of the Gramineae family, Panicum genus, native to the North American prairies. Switchgrass has high biomass yield, strong adaptability, low requirements for water and nutrient input, and is environmentally friendly, making it an ideal energy crop.

[0003] However, there are few studies on single-base editing and herbicide resistance of switchgrass. Summary of the invention

[0004] The technical problem to be solved by the present invention is to provide an application of a PvALS mutant in improving the herbicide resistance of switchgrass. For the first time, a PvALS specific site of switchgrass is subjected to directed mutation to obtain a PvALS mutant and a nucleic acid molecule encoding the PvALS mutant, revealing sites related to herbicide resistance and beneficial mutation directions in switchgrass. The present invention also provides a method for establishing a single-base editing system for switchgrass by infecting callus tissue with Agrobacterium. The method of the present invention can efficiently transform switchgrass callus tissue to obtain switchgrass single-base editing plants.

[0005] On the one hand, the present application provides the use of a PvALS mutant in improving the herbicide resistance of switchgrass, wherein the PvALS mutant is obtained by mutation of the proline (Pro) residue at position 163 of the wild-type PvALS, and the wild-type PvALS amino acid sequence includes an amino acid sequence as shown in SEQ ID No.1 or having at least 98% identity with the SEQ ID No.1 sequence.

[0006] Furthermore, the mutation is from a proline (Pro, CCC) residue to a leucine (Leu, CTT) residue or a serine (Ser, TCC) residue.

[0007] Furthermore, the editing is to mutate the PvALS gene from CCC to CTT or TCC.

[0008] Further, the amino acid sequence of the PvALS mutant includes an amino acid sequence as shown in SEQ ID No.3 or a sequence that has at least 98% identity with SEQ ID No.3; preferably, the nucleotide sequence encoding the PvALS mutant includes a nucleotide sequence as shown in SEQ ID No.4 or a sequence that has at least 98% identity with SEQ ID No.4.

[0009] Further, the amino acid sequence of the PvALS mutant includes an amino acid sequence as shown in SEQ ID No.5 or an amino acid sequence that is at least 98% identical to the SEQ ID No.5 sequence; preferably, the nucleotide sequence encoding the PvALS mutant includes a nucleotide sequence as shown in SEQ ID No.6 or a nucleotide sequence that is at least 98% identical to the SEQ ID No.6 sequence.

[0010] Furthermore, the herbicide is an acetolactate synthase inhibitory herbicide.

[0011] Furthermore, the acetolactate synthase inhibitory herbicide includes one or more of sulfonylurea herbicides, imidazolinone herbicides, triazole pyrimidine herbicides, pyrimidineoxy (sulfur) benzoic acid herbicides, and sulfonamide hydroxytriazolinone herbicides.

[0012] Furthermore, the herbicide is bensulfuron-methyl herbicide; preferably, the concentration of the bensulfuron-methyl herbicide is 1-2000 mg / L; more preferably, 1000 mg / L.

[0013] On the other hand, the present application also provides a nucleic acid molecule for improving the herbicide resistance of switchgrass, wherein the nucleic acid molecule includes a nucleotide sequence as shown in SEQ ID No.4 or having at least 98% identity with the SEQ ID No.4 sequence, or a nucleotide sequence as shown in SEQ ID No.6 or having at least 98% identity with the SEQ ID No.6 sequence.

[0014] On the other hand, the present application also provides a single base editing method for switchgrass, the method comprising the following steps:

[0015] Step 1: Obtain gene editing vector;

[0016] Step 2: Transfer the gene editing vector into Agrobacterium to obtain Agrobacterium carrying the target gene;

[0017] Step 3: Use Agrobacterium carrying the target gene to infect switchgrass callus tissue.

[0018] Furthermore, the gene editing vector includes sgRNA, and the sgRNA includes the sequence shown in SEQ ID No. 7 and / or SEQ ID No. 8.

[0019] On the other hand, the present application also provides a single base editing method for improving the herbicide resistance of switchgrass.

[0020] Preferably, the target gene is a PvALS mutant gene.

[0021] It is understandable that those skilled in the art can select a suitable gene editing system and gene editing method to complete the mutation modification according to actual conditions.

[0022] In a preferred embodiment, the gene editing vector may be a PH-A3A-PBE vector.

[0023] In a preferred embodiment, the Agrobacterium may be Agrobacterium tumefaciens EHA105.

[0024] The present invention has the following beneficial effects:

[0025] 1. This application is the first to carry out targeted mutagenesis of the PvALS specific site of switchgrass to obtain the PvALS mutant and the nucleic acid molecule encoding the PvALS mutant, revealing the sites related to herbicide resistance and the direction of beneficial mutations in switchgrass, and providing a new theoretical basis for gene editing research and breeding research related to herbicide resistance of switchgrass.

[0026] 2. The PvALS mutant plants obtained in this application have excellent herbicide resistance, providing a new herbicide-resistant germplasm for switchgrass, which can be widely planted as an energy crop in a variety of environments.

[0027] 3. This application established a single-base editing system for genetic transformation of switchgrass by infecting switchgrass callus tissue with Agrobacterium, providing a new method for switchgrass gene editing and laying a foundation for switchgrass gene research and breeding work. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] The drawings described herein are used to provide a further understanding of the present application and constitute a part of the present application. The illustrative embodiments of the present application and their descriptions are used to explain the present application and do not constitute an improper limitation on the present application. In the drawings:

[0029] Figure 1The phylogenetic tree analysis diagram of ALS in Arabidopsis, Brassica napus, peanut, rice, apple, citrus, tomato, and switchgrass, among which Pavir.1NG249295 and Pavir.1KG292200 are switchgrass ALS, BnALS1 and BnALS3 are Brassica napus ALS, AtALS1 is Arabidopsis ALS, CsALS is citrus ALS, AhALS2A and AhALS2B are peanut ALS, MdALS is apple ALS, SlALS is tomato ALS, and OsALS1 is rice ALS;

[0030] Figure 2 The base sequence comparison of ALS in Arabidopsis, Brassica napus, peanut, rice, apple, citrus, tomato, and switchgrass, among which Pavir.1NG249295 and Pavir.1KG292200 are switchgrass ALS, BnALS1 and BnALS3 are Brassica napus ALS, AtALS1 is Arabidopsis ALS, CsALS is citrus ALS, AhALS2A and AhALS2B are peanut ALS, MdALS is apple ALS, SlALS is tomato ALS, and OsALS1 is rice ALS;

[0031] Figure 3 This is a schematic diagram of a single base editing vector;

[0032] Figure 4 This is a positive detection image of transgenic switchgrass;

[0033] Figure 5 This is a statistical diagram of the efficiency and pattern of single-base editing in switchgrass PvALS;

[0034] Figure 6 This is a diagram of the single-base editing PCR stock solution and single clone sequencing results of switchgrass PvALS;

[0035] Figure 7 This is the phenotypic diagram of switchgrass resistance to bensulfuron-methyl herbicide after PvALS editing. The right figure is a partial enlarged view of the treatment in the left figure. From left to right in the left figure are ctrl_1, ctrl_2, ctrl_3, PvALS_12, PvALS_27, and PvALS_40. Specifically, ctrl_1 is the wild-type control group 1, ctrl_2 is the wild-type control group 2, ctrl_3 is the wild-type control group 3, PvALS_12 is the P163S experimental group, PvALS_27 is the P163L experimental group 1, and PvALS_40 is the P163L experimental group 2. DETAILED DESCRIPTION

[0036] Technical terms:

[0037] Identity: refers to the degree of similarity between the nucleotide sequences of two nucleic acid molecules or between the amino acid sequences of two protein molecules in molecular evolution research.

[0038] In order to more clearly explain the overall concept of the present application, the following is described in detail in conjunction with the accompanying drawings of the specification by way of embodiment. In the following description, a large number of specific details are provided to provide a more thorough understanding of the present invention. However, it is obvious to those skilled in the art that the present invention can be implemented without one or more of these details. In other examples, in order to avoid confusion with the present invention, some technical features well known in the art are not described.

[0039] It should be noted that the following detailed descriptions are illustrative and are intended to provide further explanation of the present application. Unless otherwise specified, all technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art to which the present application belongs.

[0040] It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit the exemplary embodiments according to the present application. As used herein, unless the context clearly indicates otherwise, the singular form is also intended to include the plural form. In addition, it should be understood that when the terms "comprise" and / or "include" are used in this specification, it indicates the presence of features, steps, operations, devices, components and / or combinations thereof.

[0041] Unless otherwise specified, in the following embodiments, the reagents or instruments used without indicating the manufacturer are all conventional products that can be purchased commercially. The plasmids, endonucleases, PCR enzymes, column-based DNA extraction kits and DNA gel recovery kits used in the following examples are commercial products, and the specific operations are performed according to the kit instructions.

[0042] Before further describing the specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terms used in the examples of the present invention are intended to describe specific embodiments, rather than to limit the scope of protection of the present invention. The test methods in the following examples without specifying specific conditions are generally carried out under conventional conditions or under conditions recommended by the manufacturers.

[0043] When the embodiments give numerical ranges, it should be understood that, unless otherwise specified in the present invention, both endpoints of each numerical range and any numerical value between the two endpoints can be selected. Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those generally understood by those skilled in the art. In addition to the specific methods, equipment, and materials used in the embodiments, according to the grasp of the prior art by those skilled in the art and the record of the present invention, any methods, equipment, and materials of the prior art similar or equivalent to the methods, equipment, and materials described in the embodiments of the present invention can also be used to realize the present invention.

[0044] Unless otherwise stated, the experimental methods, detection methods, and preparation methods disclosed in the present invention all adopt conventional techniques in botany, microbiology, biochemistry, analytical chemistry, cell culture, and related fields in the technical field, and can be specifically carried out according to Molecular Cloning: A Laboratory Manual (Fourth Edition).

[0045] Among them, the switchgrass materials used in this patent are all derived from the embryonic callus line of the lowland switchgrass variety Alamo established in this laboratory. The callus line is derived from the same seed and has a single genotype.

[0046] In addition, the "water" mentioned in the present invention includes any feasible water that can be used in the art, such as deionized water, distilled water, ion exchange water, double distilled water, high-purity water, and purified water.

[0047] In the present specification, the amino acids at the corresponding positions are represented by the recognized IUPAC single-letter abbreviations, wherein each amino acid and its abbreviation are: alanine (Ala or A), arginine (Arg or R), asparagine (Asn or N), aspartic acid (Asp or D), cysteine ​​(Cys or C), glutamine (Gln or Q), glutamic acid (Glu or E), glycine (Gly or G), histidine (His or H), isoleucine (Ile or I), leucine (Leu or L), lysine (Lys or K), methionine (Met or M), phenylalanine (Phe or F), proline (Pro or P), serine (Ser or S), threonine (Thr or T), tryptophan (Trp or W), tyrosine (Tyr or Y) and valine (Val or V).

[0048] In the present specification, amino acid mutations are represented by “original amino acid, position, substituted amino acid.” For example, mutation of proline P at position 163 to serine S is represented by P163S.

[0049] In the following examples, unless otherwise specified, % means wt %, i.e. weight percentage.

[0050] The biosynthesis of branched-chain amino acids (valine, leucine and isoleucine) in plants and microorganisms requires the catalytic action of four enzymes, including: acetolactate synthase (ALS), ketol reductoisomerase, dihydroxy acid dehydratase, and branched-chain amino acid transaminase. Among them, acetolactate synthase (ALS) is the key enzyme in the first stage of the biosynthesis process. The working principle of ALS inhibitor herbicides is to inhibit the activity of ALS enzymes in plants, thereby preventing the synthesis of branched-chain amino acids, resulting in the destruction of protein synthesis. As a result, cells cannot complete mitosis, which in turn stops the growth of plants and eventually leads to the death of individual plants. ALS-related genes have been found in many plants, such as Figure 1 and Figure 2 As shown. However, due to the differences in species, the sequence of ALS in different species is not exactly the same, and the efficiency and success rate of single-base editing at the same ALS site cannot be estimated in different species. Even if they are all ALS163 sites, there are still some species that can perform single-base editing while others cannot. In addition, due to the huge differences in the regulatory networks of each organism, their functions and effects also vary in different species. There is currently no research on genes related to switchgrass's resistance to herbicides.

[0051] 1. Target gene cloning

[0052] 1.1 Switchgrass DNA Extraction

[0053] a. Take fresh switchgrass leaves, cut them into pieces and place them in a 2mL centrifuge tube. Add 1mL of 2×CTAB extract and 3-4 steel beads. Use a grinder to crush them and mix them thoroughly. Place them in a 65℃ water bath for 15min, during which time the centrifuge tube is inverted 2-3 times. After the water bath, cool them to room temperature.

[0054] b. Add 200 μL of chloroform, shake vigorously, invert 7-8 times to mix evenly, and centrifuge at 12000 rpm for 10 min.

[0055] c. Gently aspirate the supernatant into a new 1.5 mL centrifuge tube, add isopropanol of equal volume to the supernatant, mix by inverting 5-8 times, and centrifuge at 12,000 rpm for 10 min after settling at -20°C for 20 min.

[0056] d. Discard the supernatant, add 1 mL of 70% ethanol to wash the precipitate, and centrifuge at 12,000 rpm for 5 min.

[0057] e. Repeat step d above and use a pipette to absorb the supernatant solution.

[0058] f. Use circulating air from the clean bench to dry the DNA precipitate.

[0059] i. Add 30-50 μL of deionized water to dissolve the DNA, and measure the DNA concentration using an ultramicrometer to obtain total DNA of switchgrass.

[0060] 1.2 RNA extraction from switchgrass

[0061] In this embodiment, RNA was extracted from switchgrass leaves for gene amplification, and the extraction steps were specifically performed as follows (the entire extraction process strictly complies with the RNAase-free requirement):

[0062] a. Preparation: Disinfect the mortar with alcohol and pre-cool the centrifuge tube, tweezers, and scissors in liquid nitrogen.

[0063] b. Sampling: Select fresh, tender and clean switchgrass leaves, cut them with scissors and tweezers, wrap them tightly with tin foil, and quickly freeze them in liquid nitrogen for later use.

[0064] c. Grinding sample: Add liquid nitrogen into the mortar, put the leaves into the mortar and quickly grind them into powder.

[0065] d. Take an appropriate amount of powder and put it into a 1.5mL centrifuge tube. Add 1mL of trizol extract and mix well. Let it stand at room temperature for 5 minutes.

[0066] e. Add 200 μL of chloroform, shake vigorously upside down for 15 seconds, and centrifuge at 12,000 rpm at 4°C for 15 minutes.

[0067] f. Transfer the supernatant to a new centrifuge tube and repeat step e above.

[0068] g. Transfer the supernatant to a new centrifuge tube, add isopropanol (pre-cooled) with an equal volume to the supernatant, and precipitate at -20°C for 20 min.

[0069] h. Centrifuge at 4℃12000r / min for 10min, remove the supernatant and keep the precipitate.

[0070] j. Add 1 mL of 70% ethanol to wash the precipitate, centrifuge at 7500 r / min at 4°C for 5 min and discard the supernatant.

[0071] g. Repeat step j above.

[0072] k. Centrifuge empty tube at 4℃12000r / min for 2min.

[0073] l. Use the clean bench to circulate air to dry the RNA precipitate.

[0074] m. Add 20 μL of RNAase-free water to dissolve RNA, pipette and mix well to obtain total RNA from Panicum virgatum.

[0075] 1.3 RNA Reverse Transcription

[0076] The total RNA of switchgrass was reverse transcribed into cDNA using ThransScipt One-Step RT-PCR SuperMix reverse transcription kit purchased from Quanshijin Biotechnology Co., Ltd. The reaction system is shown in Table 1 below (the entire extraction process strictly complies with the RNAase-free requirement).

[0077] Table 1

[0078]

[0079] The above reaction reagents were added into the PCR tube according to the reaction amount and mixed thoroughly. The reaction was carried out at 42°C for 30 min and then at 85°C for 5 s. The temperature was controlled by a PCR instrument and the reaction product was stored at -80°C to obtain total cDNA of Panicum virgatum.

[0080] 1.4 PCR amplification

[0081] In order to accurately obtain the switchgrass PvALS gene sequence, the switchgrass total DNA and cDNA were used as templates for amplification in this example. The primer sequences involved are shown in Table 2, the amplification reaction system is shown in Table 3, and the amplification program is shown in Table 4.

[0082] Table 2 Primers involved in PCR amplification

[0083]

[0084] Table 3 PCR reaction system

[0085]

[0086] Table 4 PCR reaction program:

[0087]

[0088] 1.5 Recovery of PvALS gene target fragment

[0089] The PCR product was detected by electrophoresis using 1% agarose gel at 130V for 20min. After the electrophoresis, the product was recovered by gel extraction to obtain the full-length fragment of the PvALS gene. The specific operation is as follows: the bright, single full-length DNA / cDNA band of the switchgrass PvALS gene was quickly cut from the agarose gel under ultraviolet light, and the amplified product was recovered using the Novozyme Gel DNA Extraction Mini Kit. The specific steps are as follows:

[0090] a. Place the excised gel containing the full-length DNA / cDNA fragment of the switchgrass PvALS gene into a 2 mL centrifuge tube, weigh the gel (minus the weight of the empty tube), and add an equal volume of Buffer GDP sol solution (0.10 g gel plus 300 μL sol solution).

[0091] b. Allow to gel in a 56°C water bath for 5-10 minutes. Invert and mix twice during the water bath to accelerate gelation.

[0092] c. Briefly centrifuge to collect the droplets on the tube wall, put the adsorption column into the collection tube, transfer the sol solution to the adsorption column, centrifuge at 12000rpm for 1min, discard the filtrate and reuse the collection tube.

[0093] d. Repeat step c until all the sol solution is transferred to the adsorption column.

[0094] e. Add 700 μL Buffer GW to the adsorption column. Centrifuge at 12000 rpm for 1 min, discard the filtrate and reuse the collection tube.

[0095] f. Repeat step e.

[0096] g. Centrifuge at 12000 rpm for 2 min to dry the adsorption column.

[0097] h. Discard the collection tube, place the adsorption column on a clean bench and blow for 2 minutes, then put the adsorption column into a new 1.5mL centrifuge tube.

[0098] i. Preheat 30 μL ddHO 2 0, accurately add it to the center of the adsorption column membrane, leave it at room temperature for 2 minutes, centrifuge it at 12000rpm for 1 minute, and elute the DNA.

[0099] j. Measure the concentration of recovered glue using an ultra-micro spectrophotometer and store it at -20°C.

[0100] The Spark Zero Background Ptopo-Blunt Simple cloning Kit was connected, and the construction system was shown in Table 5. The reaction procedure included: using a PCR instrument to control the temperature, reacting at 37°C for 5 minutes, and then transforming Escherichia coli.

[0101] Table 5

[0102]

[0103]

[0104] 1.6 Transformation of E. coli

[0105] The specific operation steps for transforming the above ligation product (full-length fragment of PvALS gene) into Escherichia coli are as follows:

[0106] 1) Take out a tube of DH5α competent cells from the -80℃ freezer and immediately thaw it on ice.

[0107] 2) After slight dissolution, add the above ligation product to E. coli, gently pipette and mix well, and place in an ice box for 30 minutes.

[0108] 3) Place in a 42°C water bath for 1 min 30 s, return to the ice box, and place in an ice bath for 2 min.

[0109] 4) Add 400-600 μL of empty LB culture medium to the tube in a clean bench, and then place it in a 37°C shaker at 200 r / min for 40-60 min.

[0110] 5) Take out the bacterial solution, centrifuge at 12000rpm for 1min when the bacteria are obviously turbid, pour out the excess supernatant in the clean bench, retain 100μL of supernatant and precipitate and mix thoroughly, then spread on LB plate containing carbenicillin, invert the plate, and culture it at 37℃ overnight for about 12-16h. When a single clone grows on the plate, take it out of the incubator and send it for sequencing.

[0111] The sequenced PvALS sequence was compared and confirmed with the PvALS sequence in the switchgrass genome (NC_053136), and single-base editing target site selection and vector construction were performed based on the confirmed PvALS sequence.

[0112] 2 Construction of single-base editing vector in switchgrass

[0113] In this example, a switchgrass single-base editing vector was constructed with reference to the literature Efficient C-to-T base editing in plants using afusion of nCas9 and humanAPOBEC3A.

[0114] 2.1 The PH-A3A-PBE vector was selected as the backbone and the PH-A3A-PBE vector was digested with Hind III restriction endonuclease, named PH-A3A-PBE / hindIII.

[0115] The enzyme digestion system is shown in Table 6 below.

[0116] Table 6

[0117]

[0118]

[0119] After 1 hour at 37°C, the PCR product was detected by electrophoresis on 1% agarose gel at 130V for 20 minutes. After the electrophoresis, the product was recovered by gel extraction. The specific operation is as follows: the bright, single target band was quickly cut out from the agarose gel under UV light, and the amplified product was recovered using the Novozyme Gel DNA Extraction Mini Kit, following the same steps as 1.5.

[0120] 2.2 Using PH-A3A-PBE as a template, the product was amplified with primers OsU3-HindIII-F and OsU3-target-R. The reaction system was as shown in Table 7, and the reaction procedure was as shown in Table 8 to obtain amplified product 1.

[0121] OsU3-HindIII-F:acgacggccagtgccaagcttagtaattcatccaggtctc

[0122] OsU3-target-R:ATCATGCGGCGGGGCACCTGtgccacggatcatctgcacaa

[0123] Table 7 Amplification product 1 PCR reaction system

[0124]

[0125] Table 8 Amplification product 1 PCR reaction program

[0126]

[0127] 2.3 Using PH-A3A-PBE as a template, the product was amplified using primers Target-sgRNA-F and Target-sgRNA-R. The reaction system was as shown in Table 9, and the reaction procedure was as shown in Table 10 to obtain amplified product 2.

[0128] Target-sgRNA-F: ACAGGTGCCCCGCCGCATGATGTTTTAGAGCTAGAAATAGCAA(SEQIDNo.7)

[0129] Target-sgRNA-R: gcactgcaggcatgcaagcttagcagcaagcagtatcga (SEQ ID No. 8) Table 9 Amplification product 2 PCR reaction system

[0130]

[0131] Table 10 Amplification product 2 PCR reaction program

[0132]

[0133] 2.4 Using amplification product 1 and amplification product 2 diluted 10 times as templates, overlap extension PCR reaction was performed, and OsU3-HindIII-F and Target-sgRNA-R were used as primers to amplify the fragment to obtain amplification product 3. The reaction system of amplification product 3 is shown in Table 11, and the reaction procedure is shown in Table 12.

[0134] Table 11 Amplification product 3 PCR reaction system

[0135]

[0136] Table 12 Amplification product 3 PCR reaction program

[0137]

[0138] The amplified product 3 was recovered by gel electrophoresis. The PCR product was detected by 1% agarose gel electrophoresis at 130V for 20min. After the electrophoresis, it was recovered by gel electrophoresis. The specific operation is as follows: the bright, single band was cut from the agarose gel under ultraviolet light, and the amplified product was recovered by using the Novozyme Gel DNA Extraction Mini Kit, and the steps were the same as 1.5.

[0139] 2.5 The linearized vector PH-A3A-PE-Hind III obtained in 2.1 and the gel-recovered fragment (i.e., amplified product 3) obtained in 2.4 were infused and connected. The infusion reaction system is shown in Table 13. The infusion reaction procedure was as follows: react at 37°C for 1 hour, and the steps for transforming Escherichia coli were the same as in 1.6. When a single clone grew on the plate, it was taken out from the incubator and sent for sequencing. The sequencing results were compared to obtain the PvALS-A3A positive Escherichia coli culture with the correct target site constructed on the single-base editing vector.

[0140] Table 13

[0141]

[0142] The above-mentioned PvALS-A3A positive Escherichia coli was used as a sample for plasmid extraction, and the steps were as follows:

[0143] Take 100 μL of the positive E. coli culture solution from the sequencing sample and add it to 10 mL of liquid LB containing kan antibiotics and shake overnight. When the culture solution becomes thick, extract the plasmid. The specific operation is as follows:

[0144] 1) Pour the shaken bacterial solution into a centrifuge tube and centrifuge at 1000 rpm for 1 min. Discard the supernatant and place the centrifuge tube upside down on filter paper to absorb excess liquid.

[0145] 2) Add 250 μL of Buffer Pl to the centrifuge tube, use a pipette to continuously pipette to resuspend the cells, and transfer to a 1.5 mL centrifuge tube.

[0146] 3) Add 250 μL Buffer P2 to a 1.5 mL centrifuge tube and mix by inverting.

[0147] 4) Add 350 μL Buffer P3, quickly invert to mix, and centrifuge at 12000 rpm for 10 min.

[0148] 5) Place the adsorption column in the kit into the collection tube, transfer the supernatant obtained by centrifugation to the adsorption column, and do not absorb the precipitate. Centrifuge at 12000rpm for 1min, discard the filtrate and reuse the collection tube.

[0149] 6) Add 600 μL Buffer PW2 (dilute with anhydrous ethanol before use) to the adsorption column and centrifuge at 12000 rpm for 1 min. Discard the filtrate and reuse the collection tube.

[0150] 7) Repeat step 5).

[0151] 8) Centrifuge at 12000 rpm for 2 min to dry the adsorption column.

[0152] 9) Discard the collection tube, place the adsorption column on a clean bench and blow for 5 minutes, then put the adsorption column into a new 1.5 mL centrifuge tube.

[0153] 10) Add 65 μL of preheated ddHO 2 Add O accurately to the center of the adsorption column membrane, leave it at room temperature for 2 minutes, centrifuge at 12000rpm for 1 minute, and elute the DNA.

[0154] 11) Measure the concentration of the recovered plasmid using an ultra-micro spectrophotometer and store it at -20°C.

[0155] In summary, the switchgrass single base editing vector was obtained, such as Figure 3 shown.

[0156] 3 Agrobacterium transformation

[0157] Freeze-thaw method for transformation of Agrobacterium competent cells: thaw Agrobacterium tumefaciens EHA105 competent cells on ice, add 3 μL of PvALS-A3A plasmid DNA after thawing on ice, let stand on ice for 30 minutes, freeze in liquid nitrogen for 1 minute; then add 600 μL of LB medium without antibiotics in a 37°C water bath for 3 minutes, shake and culture at 28°C, 200 rpm for 3 hours; centrifuge and concentrate the bacterial solution, use 100 μL LB medium to lyse the bacteria, and then apply the lysed bacteria to 50 mg·L -1 Kanamycin plus 25 mg L -1The culture medium was inverted at 28°C and a single clone was grown. The single clone was selected for PCR identification and the positive bacteria were selected. -1 Kan+25mg·L -1 Rif, 28°C, 200 rpm, when the OD of Agrobacterium 600 When the concentration reaches 0.6-0.8, 1 mL of bacterial solution is added with 1 mL of 50% sterile glycerol, and the mixture is quickly frozen in liquid nitrogen and stored in a -80°C refrigerator for later use in switchgrass transformation.

[0158] Genetic transformation of switchgrass mainly uses PvALS-A3A-positive EHA105 Agrobacterium to infect switchgrass embryonic callus. The specific process is as follows:

[0159] (1) Callus induction and propagation of switchgrass

[0160] Wild-type switchgrass spikelets were used to induce callus. The spikelets were cut and disinfected. The surface of the spikelets was wiped with a paper towel soaked in 75% ethanol to remove bacteria. The spikelets were then soaked in 75% ethanol for 30 minutes in a clean bench, shaken 5-10 times every 10 minutes, and then placed on sterile filter paper to dry. The spikelets were then cut with a sterilized blade and placed on (MS+30 g·L -1 Sucrose + 5 mg·L -1 2,4-D+0.15mg·L -1 6-BA+Agar 7.6-7.8g L -1 Callus induction and subculture were carried out on medium with a pH of 5.8-6.0, and the obtained callus line was named K1.

[0161] (2) Agrobacterium infection of switchgrass embryonic callus

[0162] 1) Take 100 μL of the vector bacterial solution carrying PvALS-A3A stored in a -80°C refrigerator and add 50 mg·L -1 Kanamycin plus 25 mg L -1 The rifampicin was cultured in LB liquid medium at 28°C, 200 rpm, with shaking overnight;

[0163] 2) When OD 600 When it is 0.4-0.6, AS is added to a final concentration of 100 μM;

[0164] 3) Continue shaking and culturing at 28°C, 200 rpm until OD 600 When the concentration is 0.6-0.8, it is used to prepare callus infection solution (MS+30g·L -1 Sucrose + 3mg·L -1 2,4-D+0.15mg·L -16-BA, pH 5.8-6.0);

[0165] 4) Transfer the bacterial solution to a 50 mL sterile centrifuge tube and centrifuge at 20°C, 3500 rpm for 15 min;

[0166] 5) Discard the supernatant, resuspend the pellet with 40 mL of infection solution, transfer the resuspended solution to a 200 mL tissue culture bottle, and then dilute with infection solution to make the final concentration of the bacterial solution OD 600 is 0.3-0.4, and finally AS is added to a final concentration of 100 μM;

[0167] 6) Take 50-80 calli into the diluted Agrobacterium resuspension and shake gently to mix evenly;

[0168] 7) Vacuum for 10 min, ultrasonic at 28°C for 5 min, and vacuum for 10 min;

[0169] 8) Pour out the bacterial solution and place the callus on sterile filter paper and let it stand for 30 minutes;

[0170] 9) After the callus is dried, transfer it to a new sterile filter paper culture dish;

[0171] 10) Cultivate in the dark for 3 days at 23°C-25°C;

[0172] 11) Transfer the callus to the screening medium (MS+30 g·L -1 Sucrose + 3mg·L -1 2,4-D+0.15mg·L -1 6-BA+300mg L -1 Tim+30mg·L -1 Hyg+7.6-7.8g L -1 Agar, pH 5.8-6.0), culture for 3-4 weeks;

[0173] 12) Transfer the resistant callus to differentiation medium (MS+30 g·L -1 Sucrose + 0.5 mg·L -1

[0174] 6-BA+2mg·L -1 KT+300mg·L -1 Tim+30mg·L -1 Hyg+Agar 7.6-7.8g, pH 5.8-6.0), replace new differentiation medium every three weeks until seedlings emerge;

[0175] 13) Transfer the seedlings to rooting medium MS + 400mg / LTim + 15g·L -1 Sucrose +7g·L -1Agar, pH 5.95, until roots emerge, about four weeks.

[0176] 4PCR identification of transgenic positive seedlings

[0177] 1) DNA of transgenic switchgrass regenerated plants was extracted using the 2×CTAB method;

[0178] 2) Take fresh leaves of transgenic regenerated switchgrass plants, cut them into pieces and place them in a 2 mL centrifuge tube, add 1 mL of 2×CTAB extract, add 3-4 steel balls, use a grinder to crush them and mix them thoroughly, place them in a 65°C water bath for 15 min, during which time the centrifuge tube is inverted 2-3 times, and cool to room temperature after the water bath ends.

[0179] 3) Add 200 μL of chloroform, shake vigorously, invert 7-8 times to mix evenly, and centrifuge at 12000 rpm for 10 min.

[0180] 4) Gently aspirate the supernatant into a new 1.5 mL centrifuge tube, being careful not to aspirate the precipitate. Add isopropanol in an equal volume to the supernatant, invert 5-8 times to mix, and precipitate at -20°C for 20 min, then centrifuge at 12,000 rpm for 10 min.

[0181] 5) Discard the supernatant, add 1 mL of 70% ethanol to wash the precipitate, and centrifuge at 12000 rpm for 5 min.

[0182] 6) Repeat the above step 5) and use a pipette to absorb the supernatant solution.

[0183] 7) Turn on the circulating air in the clean bench to dry the DNA precipitate. When the precipitate changes from white to transparent and there is no liquid on the tube wall, you can proceed to the next step.

[0184] 8) Add 30-50 μL of deionized water to dissolve the DNA, measure the DNA concentration using an ultra-micrometer and mark the concentration and time on the tube wall.

[0185] PCR reaction: Qingdao Qingke Zixi Biotechnology Co., Ltd. synthesized the PCR primers of HYG gene, HYG-F: 5'-AAGGAATCGGTCAATACACTACATGG-3', HYG-R: 5'-AAGACCAATGCGGAGCATATACG-3'. PCR amplified the HYG gene, the reaction system is shown in Table 14, and the reaction procedure is shown in Table 15.

[0186] Table 14 PCR reaction system

[0187]

[0188] Table 15 PCR reaction program

[0189]

[0190] 7 μL of the PCR amplification product of the HYG gene was taken for agarose gel electrophoresis (1.0%) and photographed. When spotting, 4 μL of 2000 bp LadderMaker was used as a molecular weight standard.

[0191] The gel images of the regenerated plants showed that the PCR products of HYG and Cas9 genes were both about 500 bp in size. Figure 4 ) was in line with expectations. A total of 94 plants were tested, of which 82 were hygromycin-positive and 64 were Cas9-positive.

[0192] The positive DNA was amplified by PCR, and the editing detection primers were synthesized by Qingdao Qingke Zixi Biotechnology Co., Ltd., among which ALS163-F: CGCGACGTCTTCGCCTACCC, ALS163-R: CGGCCATCTGCTGCTGGATG.

[0193] The reaction system is shown in Table 16, and the reaction procedure is shown in Table 17.

[0194] Table 16 PCR reaction system

[0195]

[0196] Table 17 PCR reaction program

[0197]

[0198] The amplified PCR products were sent for sequencing, and the types and methods of editing were statistically analyzed as follows: Figure 5 The positive rate of transformation reached 88.8%. Among the positive switchgrass, 55.6% of them were replaced, but there were also insertion and deletion byproducts. The specific single-base editing methods are as follows Figure 6 As shown in the results, the single clones with double peaks near the target site (P163C, P163F, P163L, and P163S mutations of the PvALS sequence were obtained in this editing) were resampled and connected to the T vector.

[0199] The returned sample after sequencing was connected to SparkZero Background Ptopo-Blunt Simple cloning Kit. The reaction system is shown in Table 18.

[0200] Table 18 PCR reaction system

[0201]

[0202] Reaction procedure: Use a PCR instrument to control the temperature, react at 37°C for 5 minutes, and then transform into E. coli. The transformation steps are the same as 1.6. Based on the known PvALS sequence, through sequence alignment, a total of P163C, P163F, P163L, and P163S single-base editing effective plants were obtained.

[0203] 5 Herbicide resistance experiment

[0204] The obtained switchgrass plant mutants with effective editing of the PvALS163 position were subjected to a bensulfuron-methyl herbicide application experiment. The specific test method is as follows:

[0205] Bensulfuron-methyl at concentrations of 0, 500, 1000, and 2000 mg / L was applied to the middle part of the leaves of switchgrass mutants with consistent growth and development, and switchgrass plants that had not undergone gene editing (i.e., wild-type switchgrass) were used as controls.

[0206] The optimal concentration of bensulfuron-methyl treatment was screened out to be 1000 mg / L. At this concentration, the switchgrass plants that had not been gene-edited with bensulfuron-methyl withered and died after being treated with bensulfuron-methyl, while the P163L and P163S single-base editing effective plants could still grow normally after being treated with bensulfuron-methyl. Figure 6 The final results showed that at a treatment concentration of 1000 mg / L bensulfuron-methyl, the resistance of switchgrass plants P163L and P163S effectively edited by PvALS163 to the bensulfuron-methyl herbicide was significantly higher than that of the wild type.

[0207] The above is only an embodiment of the present application and is not intended to limit the present application. For those skilled in the art, the present application may have various changes and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application should be included in the scope of the claims of the present application.

Claims

1. Application of a PvALS mutant in improving the herbicide resistance of switchgrass, characterized in that: The PvALS mutant is obtained by mutation of the 163rd proline residue of wild-type PvALS, and the amino acid sequence of wild-type PvALS includes an amino acid sequence as shown in SEQ ID No.1 or having at least 98% identity with the sequence of SEQ ID No.

1.

2. The use according to claim 1, characterized in that: The mutation is from a proline residue to a leucine residue or a serine residue.

3. The use according to claim 2, characterized in that: The amino acid sequence of the PvALS mutant includes an amino acid sequence as shown in SEQ ID No.3 or an amino acid sequence that has at least 98% identity with the SEQ ID No.3 sequence; preferably, the nucleotide sequence encoding the PvALS mutant includes a nucleotide sequence as shown in SEQ ID No.4 or a nucleotide sequence that has at least 98% identity with the SEQ ID No.4 sequence.

4. The use according to claim 2, characterized in that: The amino acid sequence of the PvALS mutant includes an amino acid sequence as shown in SEQ ID No.5 or an amino acid sequence that has at least 98% identity with the SEQ ID No.5 sequence; preferably, the nucleotide sequence encoding the PvALS mutant includes a nucleotide sequence as shown in SEQ ID No.6 or a nucleotide sequence that has at least 98% identity with the SEQ ID No.6 sequence.

5. The use according to claim 1, characterized in that: The herbicide is an acetolactate synthase inhibitory herbicide.

6. The use according to claim 5, characterized in that: The acetolactate synthase inhibitory herbicide includes one or more of sulfonylurea herbicides, imidazolinone herbicides, triazole pyrimidine herbicides, pyrimidineoxy (sulfur) benzoic acid herbicides, and sulfonamide hydroxytriazolinone herbicides.

7. The use according to claim 6, characterized in that: The herbicide is bensulfuron-methyl herbicide; preferably, the concentration of the bensulfuron-methyl herbicide is 1-2000 mg / L; more preferably, 1000 mg / L.

8. A nucleic acid molecule for improving the herbicide resistance of switchgrass, characterized in that: The nucleic acid molecule comprises a nucleotide sequence as shown in SEQ ID No.4 or having at least 98% identity with the sequence of SEQ ID No.4, or a nucleotide sequence as shown in SEQ ID No.6 or having at least 98% identity with the sequence of SEQ ID No.

6.

9. A single base editing method for switchgrass, characterized in that: The method comprises the following steps: Step 1: Obtain gene editing vector; Step 2: Transfer the gene editing vector into Agrobacterium to obtain Agrobacterium carrying the target gene; Step 3: Use Agrobacterium carrying the target gene to infect switchgrass callus tissue.

10. The single base editing method according to claim 9, characterized in that The gene editing vector includes sgRNA, and the sgRNA includes the sequence shown in SEQ ID No.7 and / or SEQ ID No.8.

Images