Lily stable genetic transformation method
By directly using the scales of lily species spheres as transformation receptors, Agrobacterium infection and screening and culture were carried out, the difficulties in building a genetic transformation system for monocot plants were solved, and the effects of shortening cycles, reducing pollution rates and improving conversion efficiency were achieved.
Patent Information
- Application Number
- CN202510085812.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-20
- Publication Date
- 2025-03-07
AI Technical Summary
The prior art encounters difficulties in building a stable genetic transformation system for monocotyledons such as lilies, especially since monocotyledons are not natural receptors of Agrobacterium, resulting in the long-term culture time of transformation receptor materials and prone to contamination.
By directly using the scales of lily species spheres as transformation receptors, Agrobacterium infection and screening culture are carried out, the sterile seedling culture and detoxification treatment process is avoided, the entire genetic transformation cycle is shortened, and the contamination rate is reduced.
The cycle of stable genetic transformation of lily is shortened and the pollution rate is reduced, the conversion efficiency is improved, and the identification process of positive plants is simplified.
Smart Images
Figure CN119570849A_ABST
Abstract
Description
Technical Field
[0001] The invention relates to the technical field of plant tissue culture and genetic transformation, and in particular to a method for stable genetic transformation of lily. Background Art
[0002] Lily (Lilium spp.) is a general term for all species, subspecies, variants, changes and varieties of the genus Lilium in the family Liliaceae. It is a perennial bulbous flower. At least 120 species have been discovered worldwide, 55 of which are native to China. It has extremely high ornamental, edible and medicinal value. Its fresh flower is one of the top ten cut flowers in the world and contains aromatic oil, which can be used as a spice. The bulb is rich in starch and is a precious food. It is also used as medicine, with the effects of moistening the lungs and relieving cough, clearing away heat, calming the nerves and having diuretic effects.
[0003] Lanzhou lily (Lilium davidii var.unicolor) is a variant of Sichuan lily, native to China, and belongs to monocotyledonous plants. The fleshy roots grow from the bottom of the bulb disk, which are fat and thick, and of similar thickness. The fibrous roots grow in the upper part of the underground bulb, and the above-ground stems are mainly distributed in the surface soil away from the ground. The leaves are linear, densely alternate, and the leaf color is dark green. The inflorescence is racemose. The flower color is orange-red and drooping. The perianth segments are broadly lanceolate and staggered. The flowers curl outward after opening. Flowers bloom from June to early July, peak flowering period in July, and late flowering period in late July.
[0004] Stable genetic technology system is an important technical means for gene function research, variety improvement, etc. At present, it is mainly based on Agrobacterium-mediated method, but monocotyledonous plants are not natural receptors of Agrobacterium. For monocotyledonous plants such as lily, it is difficult to construct a lily genetic transformation system based on Agrobacterium-mediated. At present, there are also successfully established stable genetic transformation systems for various lilies based on Agrobacterium-mediated, but most of them use sterile seedling scales and somatic embryos as transformation receptors. It takes a long time to culture the transformation receptor materials such as sterile seedling scales and somatic embryos. For example, if sterile seedling bulbs are used as transformation receptors, it takes at least 6 months to cultivate sterile seedlings that can be used to peel scales. If somatic embryos are used as transformation receptors, at least 7.5 months are required. This undoubtedly prolongs the entire genetic transformation cycle. At present, there are also a few non-sterile materials, such as flower organs, stem tips, etc., but after infection, they also need to be cultured in a culture medium containing various nutrients, which is very easy to cause pollution problems.
[0005] Therefore, there is an urgent need to provide a method for stable genetic transformation of lily with a short cycle and low contamination rate. Summary of the invention
[0006] In order to develop a stable genetic transformation method for lily, the present invention provides a stable genetic transformation method for lily. The present invention directly uses the scales of lily bulbs as transformation receptors, obtains resistant plants of stable genetic transformation of lily by infection and screening and cultivation, does not perform sterile seedling cultivation, shortens the entire genetic transformation cycle, and has a low contamination rate.
[0007] The invention provides a method for stable genetic transformation of lily. The scales of lily bulbs are used as transformation receptors for infection, and the infected scales are cut with the concave surface facing upward on a co-culture medium for co-culture, and the co-cultured scales are cut on a detoxified medium containing 460mg / L-500mg / L cephalosporin for detoxification culture, and then inoculated into a first screening medium containing 40mg / L-50mg / L kanamycin and 200mg / L-250mg / L cephalosporin for first screening culture to obtain resistant seedlings, and then inoculated into a second screening medium containing 90mg / L-100mg / L kanamycin for second screening culture, and resistant seedlings with good root system and bulb growth and strong leaf growth are selected and planted in a culture matrix for culture to obtain resistant plants.
[0008] The present invention uses the scales of lily bulbs as transformation receptor materials for Agrobacterium infection and culture, thereby eliminating the process of forming transformation receptors by detoxification of explants in traditional genetic transformation, as well as additional sterile culture and other processes. In the present invention, germinated small bulbs can be directly obtained after scale cutting, which is convenient for identifying positive plants and shortens the entire genetic transformation cycle. The self-reproduction ability of the scales is utilized, and no nutrients need to be added during the detoxification culture and the process of obtaining resistant seedlings, thereby reducing the probability of contamination caused by the additional addition of nutrients. The method provided by the present invention shortens the genetic transformation cycle, reduces the contamination rate, and improves the genetic transformation efficiency.
[0009] The present invention separates the detoxification and screening processes, firstly uses a detoxification medium containing 460 mg / L to 500 mg / L cephalosporin for detoxification, then uses a first screening medium containing 40 mg / L to 50 mg / L kanamycin and 200 mg / L to 250 mg / L cephalosporin for first screening culture, and then increases the kanamycin concentration and reduces the cephalosporin concentration, i.e., inoculates in a second screening medium containing 90 mg / L to 100 mg / L kanamycin for second screening culture, thereby significantly increasing the survival rate of resistant plants, reducing the false positive plant efficiency, and simplifying the positive plant identification process.
[0010] Furthermore, the formula of 1L of detoxified culture medium is: 460mg~500mg of cephalosporin, 6g~8g of agar powder, and the balance is distilled water; the formula of 1L of the first screening culture medium is: 40mg~50mg of kanamycin, 200mg~250mg of cephalosporin, 6g~8g of agar powder, and the balance is distilled water; the formula of 1L of the second screening culture medium is: 90mg~100mg of kanamycin, 6g~8g of agar powder, and the balance is distilled water.
[0011] Furthermore, the co-cultivation conditions are: after sealing, culturing at 27°C to 28°C in the dark for 3 to 4 days. The purpose of sealing is mainly to prevent the culture medium from drying out too quickly and to maintain moisture during the scale cutting process, otherwise the scale is easy to wilt; at the same time, it can also prevent contamination by miscellaneous bacteria.
[0012] Furthermore, the detoxification culture conditions are: 25℃~26℃, light intensity 1600Lux~2000Lux, 16h light / 8h dark culture for 13d~15d; the first screening culture conditions are: 25℃~26℃, light intensity 1600Lux~2000Lux, 16h light / 8h dark culture for 28d~30d; the second screening culture conditions are: 25℃~26℃, light intensity 1600Lux~2000Lux, 16h light / 8h dark culture for 28d~30d.
[0013] Furthermore, the lily is Lanzhou lily (Lilium davidii var. unicolor).
[0014] Furthermore, the treatment process of the scales of lily bulbs as conversion receptors is as follows: take lily bulbs with full bulbs and no diseases or insect pests, peel off the scales, wash them with clean water, soak them in a washing powder solution with a concentration of 2g / L to 2.5g / L for 30min to 40min, rinse the remaining washing powder with clean water, take out the scales and wait for them to dry, cut off 3mm to 5mm around the scales to form wounds around the scales, and obtain scale conversion receptors.
[0015] Furthermore, the transformation donor infection is: infection with Agrobacterium containing the vector.
[0016] Furthermore, the Agrobacterium infection process is as follows: placing the transformed receptor in an Agrobacterium infection solution and infecting it for 1 hour to 1.5 hours to obtain infected scales; the preparation of the Agrobacterium infection solution includes: taking 1 mL to 1.4 mL of the Agrobacterium bacterial solution containing the vector and adding it to 200 mL to 240 mL of a YEB liquid culture medium containing kanamycin and rifampicin, mixing, and culturing until OD 600 =0.6~0.7, collect the Agrobacterium cell precipitate after centrifugation, add the resuspension solution, culture at 27℃~28℃, 180rpm~200rpm for 3h~3.5h, add acetosyringone and mix well to obtain the Agrobacterium infection solution.
[0017] Furthermore, the Agrobacterium infection process is carried out at a temperature of 26° C. to 28° C. and a rotation speed of 100 rpm to 120 rpm.
[0018] Furthermore, the volume ratio of the transformation receptor to the Agrobacterium infection solution is 200 ml: 200 ml to 250 ml.
[0019] Furthermore, the culture medium is any one of coconut husk, peat, vermiculite, garden soil and humus soil, or a combination of several of them.
[0020] Compared with the prior art, the present invention has the following beneficial effects:
[0021] The present invention uses the scales of the Lanzhou lily bulbs as explants, and can be used as transformation receptor materials without detoxification and additional aseptic culture; dormant bulbs, dormant bulbs, and growing bulbs can all be used as explants for material collection, so the receptor materials are sufficient, simple and easy to obtain, ensuring the needs of multiple transformations, and shortening the entire genetic transformation cycle. The present invention makes full use of the self-reproduction ability of the scales, does not require the addition of any nutrients, does not require a strict aseptic environment, and the Agrobacterium infection process does not need to be operated in an ultra-clean workbench aseptic environment, is easy to operate, and is pollution-free throughout the process, avoiding the large-scale growth of Agrobacterium and other bacteria contamination during transformation based on tissue culture. The transformation cycle is short, and the germinated small bulbs can be directly obtained after the scales are cut, which is convenient for the identification of positive plants.
[0022] The entire transformation and identification process of the present invention can be completed in only 3 months, and the resistant plants can grow directly in the matrix without hardening and pollution, and the diameter of the small bulb can reach 0.5 cm. When the sterile seedling bulb is used as the receptor material for transformation, at least 4 months are required (transformation for 2 months, and cultivation for another 2 months to allow the plant to fully develop for identification), and when the somatic embryo is used as the receptor material for transformation, at least 6 months are required (transformation for 2 months, somatic embryo germination for 2 months, and cultivation for another 2 months to allow the plant to fully develop for identification).
[0023] The invention optimizes the transformation process: detoxification and screening are performed separately, firstly detoxification is performed using a detoxification medium containing 460 mg / L to 500 mg / L cephalosporin, then a first screening culture is performed using a first screening culture medium containing 40 mg / L to 50 mg / L kanamycin and 200 mg / L to 250 mg / L cephalosporin, and then a second screening culture is performed by increasing the kanamycin concentration and reducing the cephalosporin concentration, i.e., inoculating in a second screening culture medium containing 90 mg / L to 100 mg / L kanamycin, thereby significantly increasing the survival rate of resistant plants, reducing the efficiency of false positive plants, and simplifying the positive plant identification process. No nutrients are added to the detoxified medium, the first screening medium and the second screening medium. The nutrients required for the regeneration and growth of the bulblets come from the mother scales. Early addition of the resistance screening antibiotic kanamycin may inhibit the regeneration and growth of the bulblets, thereby reducing the germination of potential positive plants, thereby improving the transformation efficiency of the positive plants. Combined with the phenotypic changes of the resistant plants, false positive plants are further screened, simplifying the transgenic identification process. BRIEF DESCRIPTION OF THE DRAWINGS
[0024] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.
[0025] Figure 1 This is the state of co-cultivation of scales after infection in Example 1 of the present invention.
[0026] Figure 2 This is the state of virus-free culture of the scales after co-culture in Example 1 of the present invention, which is cut into virus-free culture medium.
[0027] Figure 3 This is the state in which the resistant seedlings are formed by the first screening culture medium in Example 1 of the present invention.
[0028] Figure 4 This is the state of the resistant seedlings after being transferred to the second screening medium in Example 1 of the present invention.
[0029] Figure 5 This is the cultivation condition of the resistant seedlings planted in coconut bran in Example 1 of the present invention.
[0030] Figure 6The identification results of the resistance gene NPT II clones in the resistant plants screened in Example 1 of the present invention are shown in the figure. In the figure, M: 2000bp maker; CK: cloning result using pure water as a template (blank control); P: cloning result using vector plasmid pRI101-ON as a template (positive control); WT: cloning result using leaf DNA of wild-type plants as a template (negative control); 1 to 18 are cloning results using leaf DNA of different resistant plants numbered 1, 2, 3...17, 18 obtained in Example 1 as templates.
[0031] Figure 7 This is the result of detoxification screening in which the co-cultured scales in Comparative Example 1 of the present invention were inoculated into a detoxification screening medium.
[0032] Figure 8 for Figure 7 The growth status of the plants obtained after virus-free screening and planted in coconut bran with scales.
[0033] Fig. 9 The results of identification of the resistance gene NPT II clone in the resistant plants in Comparative Example 1 are shown in the figure. M: 2000bpmaker; CK: cloning result using pure water as a template (blank control); P: cloning result using vector plasmid pRI101-ON as a template (positive control); WT: cloning result using leaf DNA of wild-type plants as a template (negative control); Lanes 1 to 6 respectively represent the 6 plant samples obtained in Comparative Example 1. DETAILED DESCRIPTION
[0034] The specific embodiments of the present invention are described in detail below, but it should be understood that the protection scope of the present invention is not limited by the specific embodiments. Based on the embodiments in the present invention, all other embodiments obtained by ordinary technicians in this field without creative work belong to the scope of protection of the present invention. The experimental methods described in the embodiments of the present invention are conventional methods unless otherwise specified, and the materials, reagents, etc. used in the following embodiments can be obtained from commercial channels unless otherwise specified.
[0035] The invention cuts off 3mm to 5mm of the scales of the lily bulbs around to use them as transformation receptors; places the transformation receptors in an Agrobacterium infection solution and infects them for 1h to 1.5h to obtain infected scales; inserts the infected scales with the concave surface facing upward into a co-culture medium for co-culture, wherein the culture conditions are as follows: after sealing, culture them in the dark at 27°C to 28°C for 3d to 4d to obtain the co-cultured scales; inserts the co-cultured scales into a virus-free culture medium, seals and detoxifies them for 13d to 15d, and then inoculates them into a first screening culture medium for culture for 28d to 30d to form resistant seedlings; the obtained resistant seedlings are taken from the scales and inoculated into a second screening culture medium for screening and culture; after screening and culture for 30d to 32d, the resistant seedlings with good root system and bulb growth and leaves grown and robust leaf growth are transplanted and then continue to be cultured to obtain resistant plants. The culture conditions for the virus-free culture, the first screening culture and the second screening culture are all: 25°C ~ 26°C, 15h ~ 16h light / 8h ~ 9h dark, and a light intensity of 1600Lux ~ 2000Lux.
[0036] The present invention directly uses the scales of lily bulbs as explants, and does not need to be processed into transformation receptor materials and additional aseptic culture, so the explants can be directly used as transformation receptor materials, thereby shortening the entire genetic transformation cycle. The self-reproduction ability of the scales is utilized, and no nutrients need to be added, thereby reducing the probability of pollution caused by additional nutrients. The method provided by the present invention shortens the genetic transformation cycle, reduces the pollution rate, and improves the genetic transformation efficiency. A new stable genetic transformation method for lilies is provided.
[0037] The culture medium and formula used in the present invention are as follows:
[0038] ①1L YEB liquid culture medium: 5.0g beef extract, 5.0g tryptone, 1.0g yeast extract, 5.0g sucrose, 0.5g MgSO4·7H2O, the remainder is distilled water, pH 7.0.
[0039] ②1L YEB solid culture medium: 5.0g beef extract, 5.0g tryptone, 1.0g yeast extract, 5.0g sucrose, 0.5g MgSO4·7H2O, 15g agar powder, the balance is distilled water, pH 7.0.
[0040] ③1L resuspension: 2.76g MS medium base salt without ammonium nitrate, 60g sucrose, and the rest is distilled water, pH 7.0.
[0041] ④1L co-cultivation medium: 2.76g MS medium base salt without ammonium nitrate, 60g sucrose + 6g agar powder, 200mg acetosyringone (AS), and the rest is distilled water, pH 5.8.
[0042] ⑤1L detoxified culture medium: 500mg cephalosporin, 6g agar powder, the remainder is distilled water, pH 5.8.
[0043] ⑥1L first screening culture medium: 50mg kanamycin, 250mg cephalosporin, 6g agar powder, the remainder is distilled water, pH 5.8.
[0044] ⑦1L second screening medium: 100mg kanamycin, 6g agar powder, the rest is distilled water, pH 5.8.
[0045] ⑧1L detoxification screening medium: 50mg kanamycin, 500mg cephalosporin, 6g agar powder, the rest is distilled water, pH 5.8.
[0046] The ammonium nitrate-free MS culture medium base salt was purchased from Beijing Coolbo Technology Co., Ltd., product number: PM1091, product name: MS culture medium base salt (without NH4NO3, containing vitamins).
[0047] Example 1: A method for stable genetic transformation of Lilium lanzhouense.
[0048] 1. Experimental steps of the stable genetic transformation method of Lanzhou lily:
[0049] 1. Bacteria activation
[0050] The vector used in the present invention is pRI101-ON (Code No. 3263, Takara, Beijing). 1 μl of pRI101-ON vector was mixed with 50 μl of Escherichia coli DH5α, ice-bathed for 30 minutes, heat-shocked at 42°C for 90 seconds, and quickly ice-bathed for 3 minutes. Subsequently, 500 μl of LB liquid culture medium without antibiotics was added, and the culture was cultured in a shaking incubator at 37°C and 200 rpm for 40 minutes to obtain an Escherichia coli bacterial liquid. Pipette 100μl of E. coli culture, add 16μl of 20mg / mL X-gal and 8μl of 50mg / L IPTG, gently whip to mix, then spread on LB plate containing 50mg / L ampicillin, culture at 37℃ overnight, pick out white single clones and add them to LB liquid culture medium containing 50mg / L ampicillin resistance, culture at 37℃150rpm overnight, then perform PCR verification of the culture solution, verify the correct culture solution and use TaKaRa MiniBEST Plasmid Purification Kit Ver.4.0 to extract plasmids, refer to the instruction manual for the operation method. Take 2 μl of plasmid and add 50 μl of Agrobacterium competent EHA105, ice bath for 30 minutes, quick freeze with liquid nitrogen for 5 minutes, and bathe in 37°C water for 5 minutes. After ice bath for 5 minutes, add 500 μl of YEB medium without antibiotics, shake the bacteria at 28°C for 3 hours to obtain the bacterial solution, take 100 μl of the bacterial solution and evenly spread it on YEB solid culture medium containing 50 mg / L kanamycin and 50 mg / L rifampicin, and culture it in an incubator at 28°C for about 48 hours. Pick a single colony and perform bacterial solution PCR verification, and use the verified Agrobacterium bacterial solution for subsequent infection solution preparation.
[0051] 2. Preparation of infection solution
[0052] Take 1 ml of the above Agrobacterium solution and add it to a 500 ml flask, add 200 ml of YEB liquid medium containing 50 mg / L kanamycin and 50 mg / L rifampicin, increase the number of bottles required according to the amount of subsequent infection solution, and culture at 28°C and 200 rpm until OD 600 =0.6; OD 600 = 0.6 bacterial solution into 50 ml centrifuge tubes at a rate of 50 ml per tube, centrifuge at 5000 rpm for 10 min, pour off the supernatant, centrifuge for a moment, remove excess bacterial solution as much as possible with a pipette, add 25 ml of resuspension solution, culture at 28 ° C, 200 rpm for 3 h, add 50 μl of 100 mg / ml acetosyringone, mix well, and then ice-bathe for 1 h as the infection solution for subsequent infection.
[0053] 3. Transformation Receptor Preparation
[0054] Take Lanzhou lily bulbs with full bulbs and no diseases or insect pests, peel off the scales, wash them with clean water, infect them with a solution containing 2g / L laundry detergent (Tide) for 30 minutes, rinse off the remaining laundry detergent with clean water, remove the scales and put them on clean newspapers, remove excess water with toilet paper, use a new blade to cut off 4mm around the scales, so that wounds are formed around the scales for subsequent infection, and obtain scale conversion receptors.
[0055] 4. Agrobacterium infection
[0056] Take the processed scale-transformed receptor and put it in a 500ml beaker, add scales to a volume of about 200ml, add the prepared infection solution to 350ml, seal the beaker with cellophane, and place it on a shaker at 28℃ and 100rpm for infection for 1h. Too many scales will result in poor infection, too little infection solution will result in insufficient infection, and too much infection solution will easily cause the liquid to splash during infection.
[0057] 5. Co-cultivation
[0058] Prepare an appropriate amount of co-cultivation medium (prepared immediately before use) before transformation, sterilize at 121℃ for 20min, add acetosyringone when cooled to about 50℃, mix well and immediately pour into a 20cm×30cm plastic dish, seal with plastic wrap for later use. Take out the infected scales, remove excess bacterial liquid with filter paper, insert the scales concave side up into the co-cultivation medium, seal with plastic wrap and culture at 28℃ in the dark for 3d (if Figure 1 ).
[0059] 6. Detoxification and screening
[0060] The co-cultivated scales were inserted into the virus-free culture medium, sealed with plastic wrap, and placed in a light incubator for virus-free culture for 15 days. The culture conditions were 25°C, 16 h light / 8 h dark, and a light intensity of 2000 Lux (e.g. Figure 2 After 15 days of culture, the scales were inoculated into the first screening medium at 25°C, 16h light / 8h dark, and 2000Lux. After 30 days of culture in the first screening medium, resistant seedlings were formed (such as Figure 3 ).
[0061] 7. Obtaining resistant plants
[0062] The resistant seedlings obtained above were removed from the scales. If the bulbs of the resistant seedlings were too small, they were inoculated with the scales into the second screening medium for cultivation at 25°C, 16h light / 8h dark, and a light intensity of 2000Lux. After 30 days of cultivation, resistant seedlings with larger bulbs (such as Figure 4The resistant seedlings with good root and bulb growth and strong leaf growth were planted in coconut bran and cultured in an incubator. Watering was carried out once a week at 25°C, 16h light / 8h dark, and light intensity of 2000Lux. After 15 days of culture, resistant plants were obtained (such as Figure 5 ).
[0063] 2. Identification of Transgenic
[0064] The leaf genomic DNA was extracted using the DNAsecure new plant genomic DNA extraction kit (TIANGEN, Beijing, China) as a template. The upstream primer NTP II-F shown in SEQ ID NO.1 and the downstream primer NTP II-R shown in SEQ ID NO.2 were designed according to the resistance gene NPT II on the vector pRI101-ON. The NPT II gene fragment was cloned using Taq DNA Polymerase (CWBIO, Jiangsu, China). The PCR reaction program was: 94℃2min, (94℃30s, 60℃30, 72℃30s)×30 cycles, 72℃3min, 4℃∞. After the PCR was completed, the results were detected by 1.2% agarose gel electrophoresis, with the wild-type plant as the blank control and the vector plasmid pRI101-ON as the positive control.
[0065] NTP II-F: ATGATTGAACAAGATGGATTGCACG (SEQ ID NO. 1).
[0066] NTP II-R: TCAGAAGAACTCGTCAAGAAGGCG (SEQ ID NO. 2).
[0067] The results showed that 18 resistant plants were obtained through preliminary antibiotic screening and phenotypic screening, numbered 1, 2, 3...17, 18, and 12 positive plants were obtained through cloning and identification of the resistance gene NTP II sequence in transgenic plants, with a transformation efficiency of 66.7% ( Figure 6 ).
[0068] Comparative Example 1:
[0069] Infection was carried out according to the infection and co-cultivation steps in Example 1, except that:
[0070] During the detoxification and screening process, the co-cultured scales were directly inoculated into the detoxification screening medium, and after culturing for 30 days, they were inoculated into the detoxification screening medium again and cultured for 30 days.
[0071] 1L virus-free screening medium: 50mg kanamycin, 500mg cephalosporin, 6g agar powder, the balance is distilled water, pH 5.8.
[0072] The results are as follows Figure 7 As shown, it was found that large areas of browning occurred around the scales, and the number of bulblets that could not regenerate was about 56%.
[0073] Selection Figure 7 The plants obtained by detoxification and screening culture were planted in coconut bran with scales, and it was found that some plants' leaves wilted and died quickly (such as Figure 8 ), the remaining plants were extracted from the leaves for PCR identification, a total of 6 plants, respectively recorded as 1, 2, 3, 4, 5 and 6, 6 plants failed to amplify the NTP II band, indicating that the control ratio failed to obtain transgenic plants (such as Fig. 9 ).
[0074] It can be seen that the present invention separates the detoxification and screening processes, first detoxifies with a detoxification medium containing 500 mg / L cephalosporin, then screens with a first screening medium containing 50 mg / L kanamycin and 250 mg / L cephalosporin, and then inoculates in a second screening medium containing 100 mg / L kanamycin for screening (increased kanamycin concentration, reduced cephalosporin concentration), which significantly increases the survival rate of resistant plants, and further screens in combination with phenotypic indicators of resistant plants, reduces the efficiency of false positive plants, and simplifies the positive plant identification process.
[0075] It should be noted that the "cutting" process described in the present invention is: placing the scales with the concave surface facing upward on the culture medium, and gently pressing to make the scales fully contact with the culture medium.
[0076] Although preferred embodiments of the present invention have been described, additional changes and modifications may occur to these embodiments once those skilled in the art are aware of the basic inventive concepts.
[0077] Obviously, those skilled in the art may make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.
Claims
1. A method for stable genetic transformation of lily, characterized in that: The scales of lily bulbs are used as transformation receptors for transformation donor infection, and the infected scales are cut with the concave surface facing upward on a co-culture medium for co-culture, and the co-cultured scales are cut on a detoxified medium containing 460 mg / L-500 mg / L cephalosporin for detoxification culture, and then inoculated into a first screening medium containing 40 mg / L-50 mg / L kanamycin and 200 mg / L-250 mg / L cephalosporin for first screening culture to obtain resistant seedlings, and then inoculated into a second screening medium containing 90 mg / L-100 mg / L kanamycin for second screening culture, and resistant seedlings with good root system and bulb growth and strong leaf growth are selected and planted in a culture matrix to obtain resistant plants.
2. The method for stable genetic transformation of lily according to claim 1, characterized in that: The formula of 1L detoxified culture medium is: 460mg~500mg cephalosporin, 6g~8g agar powder, and the balance is distilled water; the formula of 1L first screening culture medium is: 40mg~50mg kanamycin, 200mg~250mg cephalosporin, 6g~8g agar powder, and the balance is distilled water; the formula of 1L second screening culture medium is: 90mg~100mg kanamycin, 6g~8g agar powder, and the balance is distilled water.
3. The method for stable genetic transformation of lily according to claim 1, characterized in that: The co-cultivation conditions are: 27℃~28℃ in the dark for 3d~4d.
4. The method for stable genetic transformation of lily according to claim 1, characterized in that: The virus-free culture conditions are: 25°C ~ 26°C, light intensity 1600Lux ~ 2000Lux, 16h light / 8h dark culture for 13d ~ 15d; the first screening culture conditions are: 25°C ~ 26°C, light intensity 1600Lux ~ 2000Lux, 16h light / 8h dark culture for 28d ~ 30d; the second screening culture conditions are: 25°C ~ 26°C, light intensity 1600Lux ~ 2000Lux, 16h light / 8h dark culture for 28d ~ 30d.
5. The method for stable genetic transformation of lily according to claim 1, characterized in that: The lily is the Lanzhou lily Lilium davidii var.unicolor.
6. The method for stable genetic transformation of lily according to claim 1, characterized in that: The processing process of lily bulb scales as conversion receptors is as follows: take lily bulbs with full bulbs and no diseases or insect pests, peel off the scales, wash them with clean water, soak them in a 2g / L to 2.5g / L laundry detergent solution for 30min to 40min, rinse the remaining laundry detergent with clean water, remove the scales and wait for them to dry, cut off 3mm to 5mm around the scales to form wounds around the scales, and obtain scale conversion receptors.
7. The method for stable genetic transformation of lily according to claim 1, characterized in that: The transformation donor infection is: infection with Agrobacterium containing the vector.
8. The method for stable genetic transformation of lily according to claim 7, characterized in that: The Agrobacterium infection process is as follows: placing the transformed receptor in an Agrobacterium infection solution and infecting it for 1 hour to 1.5 hours to obtain infected scales; the preparation of the Agrobacterium infection solution includes: taking 1 mL to 1.4 mL of the Agrobacterium bacterial solution containing the vector and adding it to 200 mL to 240 mL of a YEB liquid culture medium containing kanamycin and rifampicin, mixing, and culturing until OD 600 =0.6~0.7, collect the Agrobacterium cell precipitate after centrifugation, add the resuspension solution, culture at 27℃~28℃, 180rpm~200rpm for 3h~3.5h, add acetosyringone and mix well to obtain the Agrobacterium infection solution.
9. The method for stable genetic transformation of lily according to claim 7, characterized in that: The Agrobacterium infection process is carried out at a temperature of 26°C to 28°C and a rotation speed of 100rpm to 120rpm.
10. The method for stable genetic transformation of lily according to claim 1, characterized in that: The culture medium is any one of coconut bran, peat, vermiculite, garden soil and humus soil or a combination of several of them.