Construction method and application of monoamine oxidase A gene site-directed mutagenesis mouse model
By performing site-directed mutations at specific sites of the mouse MAOA gene, homozygous mutant mice of the MAOA gene were constructed, the gap in the development of the mouse model of site-directed mutation in the MAOA gene was solved, the study of the biological function of the polymorphism of the MAOA gene and the significant changes in nicotine intake behavior were realized, and the association of neuropsychiatric pathways such as substance addiction was demonstrated.
Patent Information
- Application Number
- CN202311465277.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2023-11-06
- Publication Date
- 2025-03-07
AI Technical Summary
At present, there are still a lot of gaps in the development of mouse models for site-directed mutations of MAOA genes in this field, and it is difficult to deeply explore the polymorphisms affecting activity and their biological functions in the MAOA gene.
By performing site-directed mutations at specific sites of the mouse MAOA gene, homozygous mutant mice of the MAOA gene were constructed, and mutations were achieved using CRISPR/Cas gene editing technology, providing a new systemic site-directed mutation mouse strain.
The study on the changes in biological functions caused by single nucleotide polymorphisms of the MAOA gene was realized, showing a unique physiological pathological phenotype, including significant changes in nicotine intake behavior, and the association of neuropsychiatric pathways such as substance addiction was shown through differential gene enrichment analysis.
Smart Images
Figure BDA0004533389680000061 
Figure BDA0004533389680000071 
Figure BDA0004533389680000072
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of genetic engineering and relates to the construction and application of a monoamine oxidase A (MAOA) gene site-directed mutation mouse model. Background Art
[0002] Monoamine oxidase A (MAOA) is one of the enzymes that mainly catalyzes the oxidative deamination reaction of monoamine substances. It is mainly distributed on the outer membrane of mitochondria and is the most important functional protease in neurotransmitter metabolism. It catalyzes the oxidative deamination of monoamine neurotransmitters such as serotonin, dopamine, and norepinephrine, and plays a key role in maintaining the homeostasis of monoamine neurotransmitter transmission in the central nervous system. Monoamine oxidase A has a wide range of regulatory functions on the nervous system, involving physiological functions related to material and energy metabolism and cell metabolic functions; involving physiological functions related to the nervous system such as nerve cell development and function, nervous system regulatory function, and nerve signal transmission, as well as pathological processes such as nerve cell differentiation disorders, metabolic encephalopathy, substance addiction disorders, and mood disorders.
[0003] It is known that the activity level of monoamine oxidase A is affected by single nucleotide polymorphism (SNP) in its gene. Polymorphism at a specific site will lead to changes in the activity of the enzyme, and abnormal enzyme activity (too high or too low) will disrupt the dynamic balance of monoamine substances in the central nervous system, thereby causing a variety of nervous system diseases. Therefore, it is crucial to deeply explore the polymorphisms that affect the activity of the MAOA gene and study its biological functions.
[0004] In the field of human disease research, rat or mouse models are important tools for simulating human diseases because of their similarity to human physiological mechanisms and their ease of operation. Among them, site-directed mutant mouse models have stronger application advantages: site-directed mutant mice can directly regulate the function of target proteins without losing protein components; they can show the protein functions brought about by subtle changes in protein structural sites, and even the trends of cell physiological and pathological structural changes; they can accurately simulate the association between human gene polymorphisms and disease phenotypes; and so on.
[0005] As far as the MAOA gene is concerned, there are still many gaps in the development of MAOA gene site-directed mutation mouse models in the field. Summary of the invention
[0006] One object of the present invention is to provide a method for constructing a MAOA gene site-directed mutation mouse model, wherein the construction method provides a MAOA gene homozygous mutant mouse by performing site-directed mutation at a specific site of the mouse MAOA gene, thereby providing a new systemic site-directed mutation mouse strain for studying the biological function changes caused by single nucleotide polymorphisms of the MAOA gene.
[0007] Another object of the present invention is to provide a kit that can be used to implement the construction method, wherein the kit includes various reagents used in the construction process.
[0008] Another object of the present invention is to provide applications of the constructed mouse model.
[0009] The technical solution of the present invention is as follows.
[0010] On the one hand, the present invention provides a method for constructing a monoamine oxidase A (MAOA) gene site-directed mutation mouse model, the construction method comprising mutating the 1410th base T of the mouse monoamine oxidase A gene to base C.
[0011] Mouse monoamine oxidase A gene can be found in Mouse Genome Informatics (MGI) IDs: MGI:96915; and can also be found in the Ensembl website link:
[0012] http: / / asia.ensembl.org / Mus_musculus / Gene / Summary?g=ENSMUSG00000025037;r=X:16 619698-16687818;t=ENSMUST00000026013
[0014] Transcript targeted by the protocol (Ensembl number): Maoa-201 (ENSMUST00000026013.5)
[0015] The mutation of base T at position 1410 to base C is a synonymous mutation, and the encoded amino acid remains unchanged (G A T→G A C).
[0016] Preferably, in the construction method provided by the present invention, the mutation is performed by CRISPR / Cas gene editing technology.
[0017] Further preferably, the construction method further comprises mutating the 1401st base C of the mouse monoamine oxidase A gene to base A, and mutating the 1413th base A of the mouse monoamine oxidase A gene to base C.
[0018] According to a specific embodiment of the present invention, the construction method comprises the following steps:
[0019] 1) Design of CRISPR / Cas9 gRNA for MAOA gene:
[0020] According to the mouse monoamine oxidase A gene sequence and the 1410th mutation to be introduced, the following sgRNA was designed and synthesized:
[0021] gRNA1: AGTTGCCAAGAAGGATATAT (SEQ ID NO.1);
[0022] gRNA2: TTGAACCCATATATCCTTCT (SEQ ID NO.2);
[0023] 2) Construction of Donor vector:
[0024] According to the mouse monoamine oxidase A gene sequence and the mutations at positions 1401 and 1413 to be introduced, the Donor sequence is designed, and short DNA fragments of the target sequence carrying different sticky ends are synthesized according to the Donor sequence, and connected to the CRISPR / Cas9 vector to construct the Donor vector:
[0025] Donor sequence:
[0026] tgtttaatatgattttgaatctgttaacagtatataatgtcacagtataatgctgtaatcactttctttcaggtcttgaa tgctctaggaaaagttgcaaagaaggacatctgggttcaagagcctgagtccaaggtaagtttgattactcctatctac agaccaactacagcacataaaattgcactgtccttcatttagcctctgcttttact(SEQID NO.3)
[0027] 3) Microinjection:
[0028] The male and female mice are mated to obtain fertilized eggs, the sgRNA obtained in step 1), the Donor vector obtained in step 2), and the Cas9 enzyme are microinjected into the fertilized eggs, and the injected fertilized eggs are transferred and implanted into the oviducts of female mice with tubal ligation and pseudopregnancy at the same time;
[0029] 4) Mouse identification:
[0030] The mother mouse in step 3) gives birth to F0 generation mice, and after the genotype is identified, the mice are mated with wild-type mice to obtain F1 generation mice, and the genotype is identified again to obtain positive F1 generation heterozygous mice that can be stably inherited, which are hybridized and the resulting offspring are bred to obtain a homozygous mutant mouse model of the monoamine oxidase A (MAOA) gene site-directed mutation.
[0031] According to a specific embodiment of the present invention, step 2) in the construction method further comprises the following steps:
[0032] (1) Oligonucleotide synthesis: Based on the Donor sequence, short DNA fragments of the target sequence with different sticky ends are designed and synthesized, cut with endonucleases, and recovered;
[0033] (2) Vector digestion: Use endonucleases to cut the CRISPR / Cas9 vector and recover the linearized vector.
[0034] The digestion product can be detected with 1% agarose gel, and the linearized short fragments and vector can be recovered according to the instructions of the agarose gel recovery kit.
[0035] (3) Ligation reaction: Use T4 ligase to ligate the linearized vector and the target sequence DNA short fragment at 16°C for 12 to 16 hours;
[0036] (4) Transformation of host bacterial cells with the ligation product: This is carried out according to conventional methods, for example, transformation of Escherichia coli.
[0037] (5) Sequencing and identification: Randomly select single clone colonies for expansion culture, extract plasmids, and sequence to ensure that the DNA sequence inserted into the expression vector is consistent with the design.
[0038] According to a specific embodiment of the present invention, in step 3) of the construction method, the mating mice are 6 to 8 weeks old; and the pseudo-pregnant mice are obtained by oviduct ligation.
[0039] According to a specific embodiment of the present invention, the mouse is a C57BL / 6J mouse.
[0040] On the other hand, the present invention provides a kit for implementing the method for constructing the above-mentioned monoamine oxidase A (MAOA) gene site-directed mutation mouse model, the kit comprising: the sgRNA and a CRISPR / Cas9 targeting vector containing the Donor sequence.
[0041] Preferably, the kit further comprises Cas9 enzyme; and optionally other reagents for CRISPR / Cas9 technology.
[0042] In another aspect, the present invention provides a monoamine oxidase A (MAOA) gene site-directed mutant mouse model or the kit for use in screening nicotine addiction treatment drugs, or in screening nicotine intake behavior change-related reagents. Wherein, the nicotine intake behavior change includes increased nicotine intake, for example, compared with wild-type mice, the nicotine intake dose or nicotine intake frequency of the site-directed mutant mouse model is increased.
[0043] The site-directed mutation mouse model is prepared by the construction method provided by the present invention, so that the 1410th base T of the monoamine oxidase A (MAOA) gene mutates to base C. Preferably, in the mouse model, the 1401st base C of the monoamine oxidase A gene mutates to base A, and the 1413th base A of the monoamine oxidase A gene mutates to base C.
[0044] Compared with the prior art, the present invention provides a method for constructing a mouse model of a site-directed mutation of the MAOA gene. By using the construction method, a new systemic site-directed mutation mouse strain can be obtained, which has a synonymous mutation of base T→base C at least at position 1410 of the monoamine oxidase A gene. Experiments have shown that the site-directed mutation mouse exhibits a unique physiological and pathological phenotype, including a significant change in nicotine intake behavior: under different nicotine concentrations, the site-directed mutation mouse exhibits significantly higher nicotine administration (self-administration) times and nicotine intake than wild-type mice.
[0045] The ventral tegmental area of the midbrain is a key brain area for nicotine addiction. The ventral tegmental area tissue of the midbrain of the site-directed mutant mice was sampled and bulk RNA-seq experiments were performed, which found that the transcriptome of the mice had undergone significant changes. KEGG and GO enrichment analysis showed that the differentially expressed genes were enriched in neuropsychiatric disease pathways such as substance addiction. BRIEF DESCRIPTION OF THE DRAWINGS
[0046] The embodiments of the present invention are described in detail below with reference to the accompanying drawings, wherein:
[0047] Figure 1 :Flowchart for the construction of MAOA gene site-directed mutation mice.
[0048] Figure 2 : sgRNA sequence information.
[0049] Figure 3 : Primer sequences and electrophoresis schematic diagram for PCR identification of mice.
[0050] Figure 4 : Schematic diagram of mouse characterization using sequencing.
[0051] Figure 5: The number of nicotine self-administration by mice at different nicotine concentrations; vertical axis: number of self-administration; horizontal axis: self-administration test time.
[0052] Figure 6 : Nicotine intake dose of mice under different nicotine concentrations; vertical axis: nicotine intake dose; horizontal axis: nicotine concentration of each infusion.
[0053] Figure 7 :Statistics of the number of differentially expressed genes in the VTA region between mice with MAOA gene site-directed mutations and wild-type mice.
[0054] Figure 8 : KEGG enrichment analysis of differentially expressed genes in the VTA region of mice with site-directed mutation of the MAOA gene.
[0055] Fig. 9 :GO enrichment analysis of differentially expressed genes in the VTA region of mice with site-directed mutation of the MAOA gene. DETAILED DESCRIPTION
[0056] The present invention is described below with reference to specific examples. It will be appreciated by those skilled in the art that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention in any way.
[0057] The experimental methods in the following examples are conventional methods unless otherwise specified. The raw materials, reagents, etc. used in the following examples are commercially available products unless otherwise specified.
[0058] Example 1 Construction of MAOA gene site-directed mutation mouse model.
[0059] Construction principle Figure 1 Specifically, the method comprises the following steps:
[0060] 1. Design of CRISPR / Cas9 gRNA for MAOA gene:
[0061] According to the MAOA gene sequence and the mutation of T to C (GAT→GAC) at position 1410 to be introduced, the gRNA sequence was designed ( Figure 2 ):
[0062] gRNA1: AGTTGCCAAGAAGGATATAT (SEQ ID NO.1);
[0063] gRNA2: TTGAACCCATATATCCTTCT (SEQ ID NO. 2).
[0064] 2. Construction of Donor vector:
[0065] Since the purpose of the mutation is to introduce a synonymous mutation, and the point mutation site is far from the PAM site, in order to prevent Cas9-sgRNA from cutting the Donor vector for the second time, the bases A and C were introduced at the 1401 and 1413 sites of the MAOA gene, respectively, thereby introducing two additional synonymous mutations to prevent the occurrence of secondary cutting, thereby designing the Donor sequence. According to the sequence, short DNA fragments of the target sequence carrying different sticky ends were artificially synthesized by the single-stranded Oligo chemical synthesis method, and inserted into the vector to construct a Donor vector (CRISPR / Cas9 targeting vector) targeting the MAOA gene 1410th base T mutation to C sequence, named Donor-T1410C. The Donor sequence is shown below (the underlined nucleotides are the 1410th site T mutation to C):
[0066] Tgtttaatatgattttgaatctgttaacagtatataatgtcacagtataatgctgtaatcactttctttcaggtcttgaatgctctaggaaaagttgcaaagaagga c atctgggttcaagagcctgagtccaaggtaagtttgattactccatatctacagaccaactacagcacataaaattgcactgtccttcatttagcctctgcttttact (SEQ ID NO. 3).
[0067] The specific steps are:
[0068] (1) Oligonucleotide synthesis:
[0069] According to the Donor sequence, a short DNA fragment of the target sequence with different sticky ends was designed and synthesized by Oligo chemical synthesis, named Maoa-T1410C, and cut with endonuclease.
[0070] (2) Vector digestion:
[0071] Use endonucleases to cut the CRISPR / Cas9 vector.
[0072] The digested product was detected by 1% agarose gel, and the linearized short fragment and vector were recovered according to the instructions of the agarose gel recovery kit.
[0073] (3) Ligation reaction:
[0074] The linearized vector and the synthesized Maoa-T1410C short fragment were ligated using T4 ligase at 16°C for 12 to 16 hours.
[0075] (4) Conversion of ligation products:
[0076] The method was carried out according to conventional methods, specifically, transformation of Escherichia coli.
[0077] (5) Sequencing identification:
[0078] Randomly select 2-3 monoclonal colonies for expansion culture, extract plasmids, and sequence and identify them using U6 primers to ensure that the DNA sequence inserted into the expression vector is consistent with the design.
[0079] 3. Microinjection:
[0080] After mating between 6- to 8-week-old C57BL / 6J male and female mice, fertilized eggs were obtained and microinjected into the fertilized eggs together with sgRNA, Donor vector and Cas9 enzyme. Five tubally ligated pseudo-pregnant female mice of the same period were taken as recipients, and the injected fertilized eggs were transferred and implanted into the oviducts of pseudo-pregnant female mice.
[0081] 4. Mouse identification:
[0082] After microinjection and embryo transfer, F0 mice were born. The genotype was confirmed to be correct through electrophoresis and sequencing of PCR products. Finally, the F0 mice that were correctly identified by PCR and sequencing were mated with wild-type C57BL / 6J background mice to obtain F1 mice, and the above identification method was used to identify the genotype of the F1 mice. The PCR primer sequences are shown in Table 1:
[0083] Table 1. PCR amplification primers
[0084]
[0085]
[0086] For example, the electrophoresis identification result is as follows Figure 3 The sequencing results are shown in Figure 4 shown.
[0087] Confirmed by PCR and sequencing, Figure 3 The 69#, 72#, 76#, 77#, 79#, and 80# mice were positive F1 mice, among which: 72#, 79#, and 80#: KI / wt (heterozygotes), point mutation positive, T / C; 69#, 76#, and 77#: KI / Y (homozygotes), point mutation positive, C / C; WT wild type is T / T. The results show that the CRISPR / Cas9 technology can cause base mutations in the target site of mice.
[0088] The positive F1 generation heterozygous mice obtained can be stably inherited, and then the F1 generation heterozygous mice are hybridized and the offspring obtained can obtain homozygous mutant and wild-type individuals.
[0089] Example 2 Nicotine self-administration behavior experiment and differential gene enrichment analysis in the MAOA gene site-directed mutation mouse model
[0090] The homozygous site-directed mutant mice (KI / Y) obtained by the construction method described in Example 1 and wild-type mice were subjected to the following nicotine self-administration behavioral experiment.
[0091] Eight-week-old mice were taken and, according to the literature (Christie D. Fowler and Paul J. Kenny, "Intravenous nicotine self-administration and cue-induced reinstatement in mice: Effects of nicotine dose, rate of drug infusion and prior instrumental training", Neuropharmacology, 61 (2011), pp. 687-698), intravenous catheter implantation was performed on the mice to establish self-administration behavior. After one week of postoperative recovery, the mice were placed in a self-administration box to test the self-administration behavior of the mice at different concentrations. Each concentration was tested for 7 days, and the infusion concentration gradient was 0.03, 0.1, 0.25, 0.4, 0.6, and 1.0 mg / kg, respectively.
[0092] The results showed that the MAOA gene site-directed mutant mice showed significantly higher nicotine intake times than wild-type mice at different nicotine concentrations ( Figure 5 ) and nicotine intake ( Figure 6 ).
[0093] Since the ventral tegmental area of the midbrain is a key brain area for nicotine addiction, bulk RNA-seq experiments were performed by sampling the ventral tegmental area (VTA) tissue of homozygous site-directed mutant mice and wild-type mice, and it was found that the transcriptome of KI mice changed significantly. The results are shown in Tables 2 and Figure 7 .
[0094] Table 2. Genes with significant changes in the transcriptome of KI mice
[0095]
[0096]
[0097]
[0098]
[0099]
[0100]
[0101]
[0102]
[0103]
[0104]
[0105] In Table 2, KI / WT represents the ratio of gene expression levels between mutant mice and wild-type mice. When log2(KI / WT) is a negative number, it means that the expression level in mutant mice is downregulated relative to that in wild-type mice; when log2(KI / WT) is a positive number, it means that the expression level in mutant mice is downregulated relative to that in wild-type mice.
[0106] KEGG and GO enrichment analysis was performed on the above differentially expressed genes, and the results showed that the differentially expressed genes were enriched in neuropsychiatric disease pathways such as substance addiction. Figure 8 and Fig. 9 .
[0107] The above description of the specific embodiments of the present invention does not limit the present invention. Those skilled in the art may make various changes or modifications based on the present invention. As long as they do not depart from the spirit of the present invention, they should all fall within the scope of the claims attached to the present invention.
Claims
1. A method for constructing a monoamine oxidase A (MAOA) gene site-directed mutation mouse model, characterized in that: The construction method comprises mutating the 1410th base T of the mouse monoamine oxidase A gene to a base C.
2. The construction method according to claim 1, characterized in that: In the construction method, the mutation is performed by CRISPR / Cas gene editing technology.
3. The construction method according to claim 1 or 2, characterized in that: The construction method also includes mutating the 1401st base C of the mouse monoamine oxidase A gene to base A, and mutating the 1413th base A of the mouse monoamine oxidase A gene to base C.
4. The construction method according to any one of claims 1 to 3, characterized in that: The construction method comprises the following steps: 1) Based on the mouse monoamine oxidase A gene sequence and the 1410th mutation to be introduced, the following sgRNA was designed and synthesized: gRNA1: AGTTGCCAAGAAGGATATAT (SEQ ID NO.1); gRNA2: TTGAACCCATATATCCTTCT (SEQ ID NO.2); 2) According to the mouse monoamine oxidase A gene sequence and the mutations at positions 1401 and 1413 to be introduced, a Donor sequence is designed, and short DNA fragments of the target sequence carrying different sticky ends are synthesized according to the Donor sequence, and connected to the linearized CRISPR / Cas9 vector to construct a Donor vector: Donor sequence: tgtttaatatgattttgaatctgttaacagtatataatgtcacagtataatgctgtaatcactttctttcaggtcttgaa tgctctaggaaaagttgcaaagaaggacatctgggttcaagagcctgagtccaaggtaagtttgattactcctatctac agaccaactacagcacataaaattgcactgtccttcatttagcctctgcttttact(SEQ IDNO.3) 3) mating male and female mice to obtain fertilized eggs, microinjecting the sgRNA obtained in step 1), the Donor vector obtained in step 2), and the Cas9 enzyme into the fertilized eggs, and transferring the injected fertilized eggs into the oviducts of female mice with tubal ligation and pseudopregnancy at the same time; 4) The mother mouse in step 3) gives birth to F0 generation mice, and after the genotype is identified, the mice are mated with wild-type mice to obtain F1 generation mice, and the genotype is identified again to obtain positive F1 generation heterozygous mice that can be stably inherited, which are hybridized and the resulting offspring are bred to obtain a homozygous mutant mouse model of the monoamine oxidase A (MAOA) gene site-directed mutation.
5. The construction method according to any one of claims 1 to 4, characterized in that: The step 2) comprises the following steps: (1) Oligonucleotide synthesis: Based on the Donor sequence, short DNA fragments of the target sequence with different sticky ends are designed and synthesized, cut with endonucleases, and recovered; (2) Vector digestion: Use endonucleases to cut the CRISPR / Cas9 vector and recover the linearized vector; (3) Ligation reaction: Use T4 ligase to ligate the linearized vector and the target sequence DNA short fragment at 16°C for 12 to 16 hours; (4) transforming host bacterial cells with the ligation product; (5) Sequencing and identification: Randomly select single clone colonies for expansion culture, extract plasmids, and sequence to ensure that the DNA sequence inserted into the expression vector is consistent with the design.
6. The construction method according to any one of claims 1 to 5, characterized in that: In the step 4), the mating mice are 6 to 8 weeks old; the pseudo-pregnant mice are obtained by oviduct ligation.
7. The construction method according to any one of claims 1 to 6, characterized in that: The mice are C57BL / 6J mice.
8. A kit for implementing the construction method according to any one of claims 1 to 7, characterized in that: The kit includes: the sgRNA and a CRISPR / Cas9 targeting vector containing the Donor sequence.
9. The kit according to claim 8, characterized in that The kit also includes a Cas9 enzyme; and optionally other reagents for CRISPR / Cas9 technology.
10. Use of the monoamine oxidase A gene site-directed mutation mouse model constructed by the construction method of any one of claims 1 to 7 or the kit of claim 8 or 9 in screening for drugs for treating nicotine addiction, or in screening for reagents related to changes in nicotine intake behavior.