Cas enzyme probe sequence cleavage preference detection method and application

Abstract

The invention provides a Cas enzyme probe sequence cleavage preference detection method and application, and belongs to the technical field of gene detection. The invention provides a Cas enzyme probe sequence cleavage preference detection method, which comprises the following steps: designing a plurality of single-stranded DNA fluorescent probes with different sequences, carrying out sgRNA design on a tested Cas enzyme, carrying out RAA primer design on a target gene, carrying out RAA amplification on the RAA primer and the target gene, combining, and detecting. And judging the cleavage preference of the Cas enzyme probe sequence according to the fluorescence intensity, and screening to obtain the single-stranded DNA fluorescent probe having specific cleavage preference with each Cas enzyme. According to the invention, it is determined that different Cas enzymes of the single-stranded DNA fluorescent probe have different trans-cleavage sequence preferences, and two different Cas enzymes are combined, so that single-tube double-gene detection is successfully realized.

Description

Technical Field

[0001] The present invention belongs to the technical field of gene detection, and in particular relates to a method and application for detecting Cas enzyme probe sequence cutting preference. Background Art

[0002] The discovery of the trans-cleavage activity of the CRISPR / Cas system has made the system widely used in nucleic acid detection, with the advantages of high sensitivity and strong specificity. However, due to the lack of exploration of the specificity of the trans-cleavage activity of the system, its multiple detection capabilities are limited, and it is only widely used in single-gene detection. At present, there are few studies on multi-gene detection based on the CRISPR / Cas system, and most of them rely on the combination of Cas12 / Cas13 to achieve multi-gene detection. Since most Cas12 targets DNA and Cas13 targets RNA, many researchers take advantage of this feature to combine Cas12 with Cas13, use ssDNA and ssRNA two signal probes, and judge the presence of the two genes by the combination of 4 fluorescent signals of the results, thereby realizing single-tube dual-gene detection. However, the combined use of the two also makes the reaction system more complicated and increases the difficulty of detection. Initially, it was generally believed that the trans-cleavage of the CRISPR / Cas system was sequence-free, but studies have found that four Cas13 enzymes, including LwaCas13a, CcaCas13b, LbaCas13a and PsmCas13b, show different trans-cleavage sequence preferences. However, there is currently very little research on the trans-cleavage sequence preference of Cas enzymes. The discovery of trans-cleavage sequence preference will allow more Cas enzyme combinations to be selected when performing multi-gene testing. Therefore, it is urgent to explore the trans-cleavage sequence preference of more Cas enzymes to provide a reference for multi-gene testing. Summary of the invention

[0003] The present invention provides a method and application for detecting the cleavage preference of a Cas enzyme probe sequence, determining that the Cas enzyme has different trans-cleavage sequence preferences, and determining a Cas enzyme combination for simultaneous detection of multiple genes.

[0004] The present invention provides a method for detecting the cleavage preference of a Cas enzyme probe sequence, comprising the following steps: (1) designing several single-stranded DNA fluorescent probes comprising a fluorescent group and a quenching group, wherein the single-stranded DNA fluorescent probe comprises 1 to 4 base types;

[0005] (2) designing RAA amplification primers using genomic DNA or gene-edited DNA as a template, performing RAA amplification using the RAA amplification primers and the template, and obtaining a RAA purified product after purification;

[0006] (3) sequentially designing sgRNAs targeting the Cas enzymes, mixing the sgRNAs with the Cas enzymes, reaction buffer, a single-stranded DNA fluorescent probe designed in step (1), and the RAA purified product in step (2), configuring a cutting preference detection system, judging the cutting preference of the Cas enzyme probe sequence according to the fluorescence intensity, and screening out single-stranded DNA fluorescent probes having specific cutting preferences for each Cas enzyme.

[0007] In a preferred embodiment of the present invention, the combination of the fluorescent group and the quencher group of the single-stranded DNA fluorescent probe in step (1) is selected from any one of the following: when the fluorescent group is FAM, the quencher group is BHQ1; when the fluorescent group is ROX, the quencher group is BHQ2.

[0008] In a preferred embodiment of the present invention, the single-stranded DNA fluorescent probe in step (1) comprises a nucleotide sequence of 6 to 8 bp.

[0009] In a preferred embodiment of the present invention, the amplification product of the RAA amplification primer in step (2) includes the template and the PAM sequence of the Cas enzyme in step (3), and the length of the RAA amplification product is 100 to 500 bp.

[0010] In a preferred embodiment of the present invention, the sgRNA in step (3) comprises a scaffold sequence and a recognition sequence.

[0011] In a preferred embodiment of the present invention, when the Cas enzyme is Cas12, the sgRNA designed for Cas12a includes a 20 bp scaffold sequence and a 19 bp recognition sequence;

[0012] The sgRNA designed for Cas12b includes a 91bp scaffold sequence and a 19bp recognition sequence.

[0013] In a preferred embodiment of the present invention, the cleavage preference detection system in step (3) is 30 μL and includes: 3 μL of 10×Buffer, 1 μL of Cas enzyme with a concentration of 1 μM, 1 μL of sgRNA with a concentration of 10 μM, 1 μL of RAA purified product, 1 μL of single-stranded DNA fluorescent probe with a concentration of 10 μM, and the balance of ddH2O.

[0014] In a preferred embodiment of the present invention, the cleavage preference detection system is placed at 52° C. for reaction, the fluorescence intensity is read every 1 minute, and the fluorescence is observed after 30 minutes of reaction.

[0015] The present invention also provides the use of single-stranded DNA fluorescent probes having specific cleavage preferences for each Cas enzyme obtained by screening using the above-mentioned Cas enzyme probe sequence cleavage preference detection method in simultaneous detection of multiple genes.

[0016] The present invention also provides a multi-gene simultaneous detection kit, comprising a single-stranded DNA fluorescent probe having a specific cutting preference for each Cas enzyme obtained by screening using the above-mentioned Cas enzyme probe sequence cutting preference detection method.

[0017] Beneficial effect: The present invention provides a method for detecting the cutting preference of a Cas enzyme probe sequence, wherein a plurality of single-stranded DNA fluorescent probes having different sequences and containing a fluorescent group and a quenching group are designed, and sgRNA is designed for the tested Cas enzyme, and RAA primers are designed for the target gene, and then RAA primers are used to perform RAA amplification on the target gene, so that the designed single-stranded DNA fluorescent probe, sgRNA and RAA amplification product are combined for detection, and the cutting preference of the Cas enzyme probe sequence is judged according to the fluorescence intensity, so as to screen out single-stranded DNA fluorescent probes having specific cutting preference with each Cas enzyme.

[0018] In the embodiment of the present invention, a total of 15 single-stranded DNA fluorescent probes with different sequences were designed, and the trans-cleavage sequence preference tests were performed on 6 Cas12 enzymes. It was finally determined that Lb5Cas12a and AacCas12b had different trans-cleavage sequence preferences. Based on the above findings, Lb5Cas12a and AacCas12b were combined to successfully realize single-tube dual-gene detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 Figure 1 is a graph showing the detection results of Cas enzyme cleavage preference for single-stranded DNA fluorescent probes, in which A is the result of using a fluorescence detector to detect the cleavage preference of 6 enzymes for 15 sequences of single-stranded DNA fluorescent probes, B is the result of using a fluorescence detector to detect the cleavage preference of Lb5Cas12a and AacCas12b for Report29 and Report 9, respectively, and C is the fluorescence quantitative result of the cleavage preference of Lb5Cas12a and AacCas12b for Report 9 and Report29, respectively;

[0020] Figure 2 The results of a single-tube dual-enzyme assay of pig cells with a 196bp knockout fragment of the CD163 gene are shown in Figure A, where A is the result of taking a photo with a fluorescence detector, B is the result of fluorescence quantification, and C is the sequencing result of RAA products of wild-type, homozygous 196bp knockout, and heterozygous cells;

[0021] Figure 3This is a graph showing the results of a single-tube dual-enzyme assay of pig cells with a 132bp knockout fragment of the CD163 gene. In the figure, A is the result of taking a photo using a fluorescence detector, B is the fluorescence quantification result, and C is the sequencing result of the RAA products of wild-type, homozygous 132bp knockout, and heterozygous cells. DETAILED DESCRIPTION

[0022] The present invention provides a method for detecting the cleavage preference of a Cas enzyme probe sequence, comprising the following steps: (1) designing several single-stranded DNA fluorescent probes comprising a fluorescent group and a quenching group, wherein the single-stranded DNA fluorescent probe comprises 1 to 4 base types;

[0023] (2) designing RAA amplification primers using genomic DNA or gene-edited DNA as a template, performing RAA amplification using the RAA amplification primers and the template, and obtaining a RAA purified product after purification;

[0024] (3) sequentially designing sgRNAs targeting the Cas enzymes, mixing the sgRNAs with the Cas enzymes, reaction buffer, a single-stranded DNA fluorescent probe designed in step (1), and the RAA purified product in step (2), configuring a cutting preference detection system, judging the cutting preference of the Cas enzyme probe sequence according to the fluorescence intensity, and screening out single-stranded DNA fluorescent probes having specific cutting preferences for each Cas enzyme.

[0025] The present invention designs multiple single-stranded DNA fluorescent probes, requiring that one end of the single-stranded DNA fluorescent probe is modified with a fluorescent group, and the combination of the fluorescent group and the quenching group of the single-stranded DNA fluorescent probe is selected from any one of the following: when the fluorescent group is FAM, the quenching group is BHQ1; when the fluorescent group is ROX, the quenching group is BHQ2. The single-stranded DNA fluorescent probe designed by the present invention has a nucleotide sequence of 6 to 8 bp and may contain 1 to 4 base types. For example, in an embodiment of the present invention, in order to explore the cleavage preference of 6 Cas12 enzyme probe sequences, a total of 30 single-stranded DNA fluorescent probes were designed, as shown in Table 1, including 15 sequences and 2 fluorescent groups: Report 1 to Report 4 contains only 1 base, Report 5 to Report 8 contains only 3 bases, Report 9 to Report 14 contains only 2 bases, and Report 15 contains 4 bases. Report 16 to Report 30 are the same as above.

[0026] Table 1 30 single-stranded DNA fluorescent probes designed by the present invention

[0027] Probe 5'-Fluorophore-Sequence-Quencher-3' Probe 5'-Fluorophore-Sequence-Quencher-3' Report1 5'-FAM-AAAAAA-BHQ1-3' Report16 5'-ROX-AAAAAA-BHQ2-3' Report2 5'-FAM-TTTTTT-BHQ1-3' Report17 5'-ROX-TTTTTT-BHQ2-3' Report3 5'-FAM-CCCCCC-BHQ1-3' Report18 5'-ROX-CCCCCC-BHQ2-3' Report4 5'-FAM-GGGGGG-BHQ1-3' Report19 5'-ROX-GGGGGG-BHQ2-3' Report5 5'-FAM-TCGTCG-BHQ1-3' Report20 5'-ROX-TCGTCG-BHQ2-3' Report6 5'-FAM-ACGACG-BHQ1-3' Report21 5'-ROX-ACGACG-BHQ2-3' Report7 5'-FAM-ATGATG-BHQ1-3' Report22 5'-ROX-ATGATG-BHQ2-3' Report8 5'-FAM-ATCATC-BHQ1-3' Report23 5'-ROX-ATCATC-BHQ2-3' Report9 5'-FAM-AAATTT-BHQ1-3' Report24 5'-ROX-AAATTT-BHQ2-3' Report10 5'-FAM-AAACCC-BHQ1-3' Report25 5'-ROX-AAACCC-BHQ2-3' Report11 5'-FAM-AAAGGG-BHQ1-3' Report26 5'-ROX-AAAGGG-BHQ2-3' Report12 5'-FAM-TTTCCC-BHQ1-3' Report27 5'-ROX-TTTCCC-BHQ2-3' Report13 5'-FAM-TTTGGG-BHQ1-3' Report28 5'-ROX-TTTGGG-BHQ2-3' Report14 5'-FAM-CCCGGG-BHQ1-3' Report29 5'-ROX-CCCGGG-BHQ2-3' Report15 5'-FAM-ATCGATCG-BHQ1-3' Report30 5'-ROX-ATCGATCG-BHQ2-3'

[0028] The present invention designs sgRNA sequences based on each Cas enzyme. For example, in the embodiment, 4 Cas12a enzymes and 2 Cas12b enzymes are selected for probe sequence cleavage preference detection, and sgRNA is designed for Cas12a enzyme at the same time, requiring the sgRNA sequence to include a 20bp scaffold sequence and a 19bp recognition sequence; sgRNA designed for Cas12b enzyme requires the sgRNA to include a 91bp scaffold sequence and a 19bp recognition sequence. For example, in the embodiment of the present invention, Shanghai Sangon Biotechnology Co., Ltd. was commissioned to synthesize the sgRNA sequence for the Cas12a enzyme as shown in SEQ ID No. 1 (sgRNA-a): GAAUUUCUACUAUUGUAGAUGACACGUGGGGCACCGUCU; the sgRNA sequence of the synthesized Cas12b enzyme is shown in SEQ ID No. 2 (sgRNA-b): GUCUAGAGGACAGAAUUUUUUCAA CGGGUGUGCCAAUGGCCACUUUCCAGGUGGCAAAGCCCGUUGAGCUUC UCAAAUCUGAGAAGUGGCACGACACGUGGGGCACCGUCU.

[0029] The present invention designs RAA primers for the target gene, and the RAA primers need to meet the following conditions: (1) the amplified product contains the detection sequence; (2) the amplified product contains the PAM sequence of the Cas12 enzyme used, i.e., 5'-TTTN-3'; (3) to ensure the efficiency of RAA, the length of the amplified fragment is preferably kept between 100 and 500 bp, and the RAA product band is accurate and single. The RAA primer sequence is designed according to the gene to be detected, and the synthesis is commissioned to a biological company. As in the embodiment of the present invention, the RAA amplification primer sequence designed for amplifying wild-type pig cell DNA for use as a fluorescent detection template is as follows:

[0030] RAA-F (SEQ ID No. 3):CTGCTCTGGTCGTGTTGAAGTACAACATTTA GACA;

[0031] RAA-R(SEQ ID No.4):CTGTGACTACCTAACCCTACCTCTCTCATG;

[0032] For example, in another embodiment of the present invention, pig cells with gene-edited CD163 genes were selected as the dual enzyme detection target, and the CD163 gene of the edited homozygous cells lacked 196bp bases. RAA amplification primers were designed for the gene-edited cells, and the primer sequences were the same as those shown in SEQ ID No. 3 and SEQ ID No. 4. In another embodiment, pig cells with a 132bp fragment of CD163 gene knockout were used as the detection target, and the CD163 gene of the edited homozygous cells lacked 132bp bases.

[0033] RAA amplification primers were designed for the gene-edited cells. The primer sequences are as follows:

[0034] RAA-132-F (SEQ ID No. 5): CTGGAGCGGCCAGCGTGCTGTGCTTT GAACTACA;

[0035] RAA-132-R (SEQ ID No. 4): CTGTGACTACCTAACCCTACCCTCTTCAT G.

[0036] The present invention uses target gene cells as templates and uses RAA nucleic acid amplification reagent (Nanning Zhuangbo, ZBA11001) to perform RAA amplification. The RAA amplification reaction system and conditions refer to the reagent instructions. In order to eliminate the influence of complex components in the RAA amplification system on subsequent experiments, the RAA product is purified and recovered using the FastPure Gel DNA Extraction Mini Kit (Vazyme, DC301-01). The operation steps refer to the instructions of the kit.

[0037] The present invention is based on the RAA purified product, and is compounded with the designed sgRNA, single-stranded DNA fluorescent probe and Cas enzyme to obtain a single enzyme fluorescence detection system. The reaction system is measured in 30 μL, including: 10×Buffer 3 μL, 1 μL of Cas12 enzyme with a concentration of 1 μM, 1 μL of sgRNA with a concentration of 10 μM, 1 μL of purified RAA product, 1 μL of single-stranded DNA probe with a concentration of 10 μM, and ddH2O is supplemented to 30 μL. The present invention puts the above reaction system into a Bio-Rad fluorescent quantitative PCR instrument, the reaction temperature is 52 ° C, and the fluorescence intensity is read every 1 minute. After 30 minutes of reaction, a fluorescence detector (Shangrui Biology, SRB-ES-004) is placed to observe the fluorescence, and a smartphone is used to take pictures and record them. According to the color of the pictures recorded by the photos, the cutting preference corresponding to the Cas enzyme is determined based on the fluorescence intensity. In this embodiment of the present invention, two enzymes, AacCas12b and Lb5Cas12a, were screened for subsequent dual enzyme detection, and Report 9 was selected as the signal probe for the AacCas12b enzyme, and Report 29 was selected as the signal probe for the Lb5Cas12a enzyme.

[0038] The present invention also provides the use of single-stranded DNA fluorescent probes having specific cleavage preferences for each Cas enzyme obtained by screening using the above-mentioned Cas enzyme probe sequence cleavage preference detection method in simultaneous detection of multiple genes.

[0039] Based on the screening described in the present invention, AacCas12b and Lb5Cas12a can be used for dual enzyme detection in one tube at the same time, and Report 9 is used as the signal probe of AacCas12b enzyme and Report 29 is used as the signal probe of Lb5Cas12a enzyme, so that the detection of single-tube dual genes can be completed.

[0040] The present invention also provides a multi-gene simultaneous detection kit, comprising a single-stranded DNA fluorescent probe having a specific cutting preference for each Cas enzyme obtained by screening using the above-mentioned Cas enzyme probe sequence cutting preference detection method.

[0041] In order to further illustrate the present invention, a Cas enzyme probe sequence cleavage preference detection method and application provided by the present invention are described in detail below in combination with the embodiments, but they should not be understood as limiting the scope of protection of the present invention.

[0042] The sources of the knockout CD163 gene 196bp fragment and the knockout 132bp used in Examples 2 and 3 of the present invention are specifically as follows:

[0043] (1) sgRNA site design and synthesis:

[0044] Use the CRISPR guides on the Benchling website to design the CRISPR / Cas9 sgRNA editing site in the 7th exon region of the porcine CD163 gene, and select a suitable sgRNA sequence with a high score. Entrust a biological company to synthesize the sgRNA, the sequence is as follows:

[0045] sgRNA-G4 (SEQ ID No. 9): AGUACAACAUGGAGACACGUUUUAGA GCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAA AAGUGGCACCGAGUCCGGUGCUUUU;

[0046] sgRNA-G8 (SEQ ID No. 10): CCAGUAGCACCCCGCCCUGAGUUUUAG AGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAA AAAGUGGCACCGAGUCCGGUGCUUUU;

[0047] sgRNA-G10 (SEQ ID No. 11):CUGUGCAGGGAACUACAGUGGUUUUA GAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGA AAAAGUGGCACCGAGUCCGGUGCUUUU;

[0048] sgRNA-G11 (SEQ ID No. 12): UGUGGCUACAUGUCCCGUCAGUUUUA GAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCCGGUGCUUUU.

[0049] (2) Porcine fibroblast culture and transfection

[0050] Take a tube of pig ear fibroblasts frozen in liquid nitrogen for recovery, culture them in a T-25 cell culture flask, subculture them, and perform electroporation when the cells are in good growth condition.

[0051] After the cells grew to 80%, they were washed twice with PBS, the PBS was discarded, 1 mL of 0.06% trypsin was added, and after digestion for 3 min, 1 mL of culture medium (15% FBS + 2% double antibody + DMEM) was added to terminate the digestion. All the digested cells were transferred to a new 15 mL centrifuge tube and mixed by blowing gently.

[0052] Cell counts were performed under a microscope, and the cell suspension was dispensed into 1.5 mL centrifuge tubes according to experimental requirements. The number of transfected cells in each treatment group was 6 × 10 5 ~1×10 6 indivual.

[0053] Centrifuge at 1000 rpm for 3 min at room temperature, discard the supernatant, and add 1 mL of PBS to resuspend the cells.

[0054] Centrifuge at 1000 rpm for 3 min at room temperature and discard the supernatant.

[0055] Prepare the transfection system in advance, where the electroporation buffer consists of nuclear transfer buffer 1 and nuclear transfer buffer 2 (the ratio of nuclear transfer buffer 1 to nuclear transfer buffer 2 is 2μL:100μL). Knockout 196bp system: add 2.5μg sgRNA-G4, 2.5μg sgRNA-G8, and 6μg Cas9 protein (mixed and left at room temperature for 15min); Knockout 132bp system: add 2.5μg sgRNA-G10 and 2.5μg sgRNA-G11, and 6μg Cas9 protein (mixed and left at room temperature for 15min). Transfer all the configured electroporation systems to the cell pellet from the previous step.

[0056] The cell suspension was transferred to an electroporation cuvette with the electroporation parameters set to U-023.

[0057] After electroporation, the cells were allowed to stand for 5 min and the cell suspension was transferred to a T-25 cell culture flask containing 5 mL of complete culture medium for culture.

[0058] The cell culture flask was placed in a 37°C, 5% CO2 incubator. After 24 hours, the culture medium was replaced to observe the growth of the cells. After 48 hours, the cells were collected for detection.

[0059] 3. Cell lysis and PCR amplification to detect edited cells

[0060] The collected cell suspension was placed in a centrifuge and centrifuged at 1000 rpm for 3 min, and the supernatant was removed.

[0061] DNA extraction was performed according to the instructions of the Crude DNA Extraction Kit (for Blood) of Novezan.

[0062] The above cleavage product was used as a template for PCR amplification, and the system was as follows: 2× Rapid Taq Master Mix (Vazyme, P222) 25 μL, upstream primer (10 μM) 1 μL, downstream primer (10 μM) 1 μL, cleavage product 4 μL, supplemented to 50 μL with ddH2O. The PCR program was: 95°C 3 min, 95°C 15 s, 55°C 15 s, 72°C 5 s, 72°C 5 min; 35 cycles.

[0063] The primer sequences used are:

[0064] F-820 (SEQ ID No. 13): TATTCTCCCTCACCGAAATG;

[0065] R-820 (SEQ ID No. 14):TACACCCACTCTTAAGGCAC.

[0066] The PCR product was subjected to Sanger sequencing, and wild-type, homozygous and heterozygous cells were selected as substrates for fluorescence detection according to the sequencing results. The sequencing results of the selected cells are shown in Examples 2 and 3.

[0067] Example 1

[0068] 6 Cas12 enzyme probe sequence cleavage preference detection:

[0069] 1. Design of single-stranded DNA fluorescent probe

[0070] The present invention designs a total of 30 single-stranded DNA fluorescent probes, as shown in Table 1, including 15 sequences and 2 fluorescent groups. The sequence design follows the following rule: Report 1 to Report 4 contain only 1 base, Report 5 to Report 8 contain only 3 bases, Report 9 to Report 14 contain only 2 bases, and Report 15 contains 4 bases.

[0071] The present invention selects 4 Cas12a enzymes and 2 Cas12b enzymes for probe sequence cleavage preference detection. The 6 enzymes are all purchased from Tolo Biotechnology (TOLOBIO), specifically LbCas12a (TOLOBIO, 32108), AsCas12a (TOLOBIO, 32104), FnCas12a (TOLOBIO, 32106), Lb5Cas12a (TOLOBIO, 32110), AacCas12b (TOLOBIO, 32116), and AapCas12b (TOLOBIO, 32118).

[0072] 2. Design of RAA amplification primers

[0073] Amplify wild-type pig cell DNA to use as a template for fluorescence detection. The primer sequences are as follows:

[0074] RAA-F (SEQ ID No. 3) and RAA-R (SEQ ID No. 4).

[0075] Using lysed wild-type porcine cells as templates, RAA nucleic acid amplification reagent (Nanning Zhuangbo, ZBA11001) was used for RAA amplification. The RAA amplification reaction system and conditions refer to the reagent instructions.

[0076] In order to eliminate the influence of complex components in the RAA amplification system on subsequent experiments, the RAA product was purified and recovered using the FastPure Gel DNA Extraction Mini Kit (Vazyme, DC301-01). The operation steps were referred to the instructions of the kit.

[0077] 3. Design and synthesis of sgRNA

[0078] Sangon Biotech (Shanghai) Co., Ltd. was commissioned to synthesize the sgRNAs for Cas12a enzyme and Cas12b, with the sequences being sgRNA-a (SEQ ID No. 1) and sgRNA-b (SEQ ID No. 2), respectively.

[0079] The following system was used for single enzyme fluorescence detection: 3 μL of 10×Buffer, 1 μL of Cas12 enzyme at a concentration of 1 μM, 1 μL of sgRNA at a concentration of 10 μM, 1 μL of purified RAA product, 1 μL of single-stranded DNA probe at a concentration of 10 μM, and ddH2O was added to 30 μL. The above system was added to a 200 μL PCR tube and placed in a Bio-Rad fluorescence quantitative PCR instrument. The reaction temperature was 52 °C, and the fluorescence intensity was read every 1 minute. After 30 minutes of reaction, the fluorescence was observed in a fluorescence detector (Shangrui Bio, SRB-ES-004), and photos were taken using a smartphone.

[0080] The results of the single-stranded DNA fluorescent probe cleavage preference test of 6 enzymes on 15 sequences are as follows Figure 1As shown in A, for Report 9, AacCas12b has a stronger preference for cutting, while Lb5Cas12a has a weaker preference for cutting; for Report 14, AacCas12b has a weaker preference for cutting, while Lb5Cas12a has a stronger preference for cutting. Then, Report 14 was replaced with Report 29, which has the same base sequence but different fluorescent and quenching groups, to test the strength of the cutting preference of AacCas12b and Lb5Cas12a, and the cutting preference of AacCas12b and Lb5Cas12a for Report 9 was tested again. The results are shown in Figure 1 As shown in B and C, Lb5Cas12a has a significantly higher cleavage preference for Report 29 than AacCas12b, while AacCas12b has a significantly higher cleavage preference for Report 9 than Lb5Cas12a, and the difference between the two can be easily distinguished by the naked eye. Therefore, AacCas12b and Lb5Cas12a were selected for subsequent dual enzyme detection, and Report9 was selected as the signal probe for the AacCas12b enzyme, and Report 29 was selected as the signal probe for the Lb5Cas12a enzyme.

[0081] Example 2

[0082] Single tube dual enzyme detection of pig cells with 196bp fragment of CD163 gene knockout:

[0083] 1. Pig cells with gene-edited CD163 gene were selected as the target of dual enzyme detection. The CD163 gene of the edited homozygous cells lacked 196bp bases.

[0084] RAA amplification primers were designed for the gene-edited cells. The primer sequences are as follows:

[0085] RAA-196-F (SEQ ID No. 3) and RAA-196-R (SEQ ID No. 4).

[0086] The wild-type, homozygous and heterozygous cells after lysis were used as templates, and RAA nucleic acid amplification reagent (Nanning Zhuangbo, ZBA11001) was used for RAA amplification. The RAA amplification reaction system and conditions refer to the reagent manual.

[0087] In order to eliminate the influence of complex components in the RAA amplification system on subsequent experiments, the RAA product was purified and recovered using the FastPure Gel DNA Extraction Mini Kit (Vazyme, DC301-01). The operation steps were referred to the instructions of the kit.

[0088] 2. Entrust Shanghai Bioengineering Co., Ltd. to synthesize the sgRNA of Lb5Cas12a enzyme, the sequence is as follows: sgRNA-196-a (SEQ ID No. 1);

[0089] We commissioned Sangon Biotech (Shanghai) Co., Ltd. to synthesize the sgRNA of AacCas12b enzyme, the sequence is as follows:

[0090] sgRNA-196-b (SEQ ID No. 6):GUCUAGAGGACAGAAUUUUUCAACGGGUGUGCCAAUGGCCACUUUCCAGGUGGCAAAGCCCGUUGAGCUUCUCAAUUCUGAGAAGUGGCACGACAUGACGGGACAUGUAG.

[0091] 3. The fluorescence detection reaction system is: 10×Buffer 3μL, AacCas12b enzyme 1μL at a concentration of 1μM, Lb5Cas12a enzyme 1μL at a concentration of 1μM, sgRNA-196-b 1μL at a concentration of 10μM, sgRNA-196-a 1μL at a concentration of 10μM, purified RAA product 1μL, single-stranded DNA probe Report 91μL at a concentration of 10μM, single-stranded DNA probe Report 293μL at a concentration of 10μM, supplemented with ddH2O to 30μL. Add the above system to a 200μL PCR tube and place it in a Bio-Rad fluorescence quantitative PCR instrument. The reaction temperature is 52°C, and the fluorescence intensity is read every 1 minute. After 30 minutes of reaction, place it in a fluorescence detector (Shangrui Bio, SRB-ES-004) to observe the fluorescence and use a smartphone to take pictures and record.

[0092] The results are as follows Figure 2 shown. Figure 2 A in the middle is the result of taking a photo using a fluorescence detector. The wild-type cell detection result shows red fluorescence; the homozygous knockout cell detection result shows yellow fluorescence; and the heterozygous cell detection result shows orange fluorescence. Figure 2 Figure B is the fluorescence quantification result. In the detection results of wild-type cells, the ROX fluorescence signal intensity was significantly higher than the FAM fluorescence signal intensity; in the detection results of homozygous knockout cells, the FAM fluorescence signal intensity was significantly higher than the ROX fluorescence signal intensity; in the detection results of heterozygous cells, both the FAM fluorescence signal and the ROX fluorescence signal were strong, with no significant difference. Figure 2 Center C shows the sequencing results of RAA products of wild-type, homozygous knockout 196bp and heterozygous cells.

[0093] Example 3

[0094] Single tube dual enzyme detection of pig cells with 132bp fragment of CD163 gene knockout:

[0095] 1. In order to demonstrate the universality of the invention, another pig cell with gene-edited CD163 gene was selected as the detection target. The CD163 gene of the edited homozygous cells lacked 132bp bases.

[0096] RAA amplification primers were designed for the gene-edited cells. The primer sequences are as follows:

[0097] RAA-132-F (SEQ ID No. 5) and RAA-132-R (SEQ ID No. 4).

[0098] Two copies of the lysed wild-type, homozygous and heterozygous cells were used as templates to perform RAA amplification using RAA nucleic acid amplification reagent (Nanning Zhuangbo, ZBA11001). The RAA amplification reaction system and conditions refer to the reagent manual.

[0099] In order to eliminate the influence of complex components in the RAA amplification system on subsequent experiments, the RAA product was purified and recovered using the FastPure Gel DNA Extraction Mini Kit (Vazyme, DC301-01). The operation steps were referred to the instructions of the kit.

[0100] 2. Entrust Sangon Biotech (Shanghai) Co., Ltd. to synthesize the sgRNA of Lb5Cas12a enzyme, the sequence is as follows:

[0101] sgRNA-132-a (SEQ ID No. 7):GAAUUUCUACUAUUGUAGAUAACUA CAGUGCGGCACUGU;

[0102] The sgRNA of AacCas12b enzyme was synthesized by Shanghai Sangon Biotechnology Co., Ltd., and the sequence was as follows: sgRNA-132-b (SEQ ID No. 8): GUCUAGAGGACAGAAUUUUUCAA CGGGUGUGCCAAUGGCCACUUUCCAGGUGGCAAAGCCCGUUGAGCUUC UCAAAUCUGAGAAGUGGCACAACUACACGGGACAUGUAG.

[0103] 3. Fluorescence detection:

[0104] The reaction system is: 10×Buffer 3μL, AacCas12b enzyme 1μL at a concentration of 1μM, Lb5Cas12a enzyme 1μL at a concentration of 1μM, sgRNA-132-b 1μL at a concentration of 10μM, sgRNA-132-a 1μL at a concentration of 10μM, purified RAA product 1μL, ssDNA probe Report 91μL at a concentration of 10μM, ssDNA probe Report 293μL at a concentration of 10μM, supplemented with ddH2O to 30μL. The above system was added to a 200μL PCR tube and placed in a Bio-Rad fluorescent quantitative PCR instrument. The reaction temperature was 52°C, and the fluorescence intensity was read every 1 minute. After 30 minutes of reaction, the fluorescence was observed in a fluorescence detector (Shangrui Bio, SRB-ES-004), and photos were taken using a smartphone.

[0105] The results are as follows Figure 3 shown. Figure 3 A in the middle is the result of taking a photo using a fluorescence detector. The wild-type cell detection result shows red fluorescence; the homozygous knockout cell detection result shows yellow fluorescence; and the heterozygous cell detection result shows orange fluorescence. Figure 3 Figure B is the fluorescence quantification result. In the detection results of wild-type cells, the ROX fluorescence signal intensity was significantly higher than the FAM fluorescence signal intensity; in the detection results of homozygous knockout cells, the FAM fluorescence signal intensity was significantly higher than the ROX fluorescence signal intensity; in the detection results of heterozygous cells, both the FAM fluorescence signal and the ROX fluorescence signal were strong, with no significant difference. Figure 3 Middle C shows the sequencing results of RAA products of wild-type, homozygous knockout 132bp type and heterozygous cells.

[0106] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A method for detecting cleavage preference of a Cas enzyme probe sequence, characterized in that: The following steps are involved: (1) designing several single-stranded DNA fluorescent probes comprising a fluorescent group and a quenching group, wherein the single-stranded DNA fluorescent probe comprises 1 to 4 base types; (2) designing RAA amplification primers using genomic DNA or gene-edited DNA as a template, performing RAA amplification using the RAA amplification primers and the template, and obtaining a RAA purified product after purification; (3) sequentially designing sgRNAs targeting the Cas enzymes, mixing the sgRNAs with the Cas enzymes, reaction buffer, a single-stranded DNA fluorescent probe designed in step (1), and the RAA purified product in step (2), configuring a cutting preference detection system, judging the cutting preference of the Cas enzyme probe sequence according to the fluorescence intensity, and screening out single-stranded DNA fluorescent probes having specific cutting preferences for each Cas enzyme.

2. The method for detecting Cas enzyme probe sequence cleavage preference according to claim 1, characterized in that: The combination of the fluorescent group and the quenching group of the single-stranded DNA fluorescent probe in step (1) is selected from any one of the following: when the fluorescent group is FAM, the quenching group is BHQ1; when the fluorescent group is ROX, the quenching group is BHQ2.

3. The method for detecting Cas enzyme probe sequence cleavage preference according to claim 1 or 2, characterized in that: The single-stranded DNA fluorescent probe in step (1) comprises a nucleotide sequence of 6 to 8 bp.

4. The method for detecting Cas enzyme probe sequence cleavage preference according to claim 1, characterized in that: The amplification product of the RAA amplification primer in step (2) includes the template and the PAM sequence of the Cas enzyme in step (3), and the length of the RAA amplification product is 100 to 500 bp.

5. The method for detecting Cas enzyme probe sequence cleavage preference according to claim 1, characterized in that: The sgRNA in step (3) contains a scaffold sequence and a recognition sequence.

6. The method for detecting Cas enzyme probe sequence cleavage preference according to claim 5, characterized in that: When the Cas enzyme is Cas12, the sgRNA designed for Cas12a includes a 20 bp scaffold sequence and a 19 bp recognition sequence; The sgRNA designed for Cas12b includes a 91bp scaffold sequence and a 19bp recognition sequence.

7. The method for detecting Cas enzyme probe sequence cleavage preference according to claim 1, characterized in that: The cutting preference detection system in step (3) is based on 30 μL, including: 3 μL of 10×Buffer, 1 μL of Cas enzyme with a concentration of 1 μM, 1 μL of sgRNA with a concentration of 10 μM, 1 μL of RAA purified product, 1 μL of single-stranded DNA fluorescent probe with a concentration of 10 μM, and the balance of ddH2O.

8. The method for detecting Cas enzyme probe sequence cleavage preference according to claim 7, characterized in that: The method comprises placing the cleavage preference detection system at 52° C. for reaction, reading the fluorescence intensity every 1 minute, and observing the fluorescence after the reaction for 30 minutes.

9. Use of a single-stranded DNA fluorescent probe having specific cleavage preference for each Cas enzyme obtained by screening using the Cas enzyme probe sequence cleavage preference detection method according to any one of claims 1 to 8 in simultaneous detection of multiple genes.

10. A multi-gene simultaneous detection kit, characterized in that: It comprises a single-stranded DNA fluorescent probe having specific cleavage preference for each Cas enzyme obtained by screening using the Cas enzyme probe sequence cleavage preference detection method according to any one of claims 1 to 8.

Images