Aptamer sensor for detecting related markers of Alzheimer disease, preparation method of aptamer sensor and kit

Abstract

The invention relates to the field of biological detection, and discloses an aptamer sensor for detecting related markers of Alzheimer's disease, a preparation method of the aptamer sensor and a kit. Comprising a magnetic microsphere, a closed annular single-stranded DNA probe and a nucleic acid aptamer for specifically recognizing a corresponding A beta marker, the nucleic acid aptamer is connected to the magnetic microsphere, and the closed annular single-stranded DNA probe is connected to the nucleic acid aptamer; the nucleic acid aptamer is one of an A [beta] 42 aptamer and an A [beta] 40 aptamer. By adopting the kit in combination with the detection method, the specially designed nucleic acid aptamer can significantly reduce background signals, and meanwhile, the detection sensitivity is effectively improved, and the linear range is effectively widened. Compared with the conventional ELISA detection method, the detection method provided by the invention has the advantages of shorter detection time, lower detection limit and wider detection linear range.

Description

Technical Field

[0001] The present application relates to the field of biological detection, and mainly to an aptamer sensor for detecting Alzheimer's disease-related markers, and a preparation method and a kit thereof. Background Art

[0002] Alzheimer's disease (AD) is a chronic neurodegenerative disease, usually accompanied by progressive neuropathological changes, brain atrophy, and ultimately cognitive decline. Although the pathogenesis is still unclear, amyloid-β (Aβ) is considered to be a key biomarker for AD diagnosis and an important target for treatment, especially Aβ40 and Aβ42. MRI (magnetic resonance imaging) and PET (positron emission tomography) are currently commonly used methods for clinical diagnosis of AD. MRI is used to detect brain volume and evaluate neuronal connections, and PET is used to detect Aβ and Tau protein deposition in the brain. However, due to the poor sensitivity of these two methods, they lack the ability to diagnose AD early. At the same time, the high cost and popularity of the instruments also limit their popular application in AD diagnosis. Compared with MRI and PET detection, the detection of Aβ markers in body fluids has the advantages of high sensitivity, non-invasiveness, low cost, and rapidity.

[0003] Currently, there are many methods for detecting Alzheimer's disease markers, such as enzyme-linked immunosorbent assay (ELISA), electrochemiluminescence, immunochromatography, colorimetry, etc. However, these detection methods are often limited by cumbersome detection procedures, complex operations, high costs or high detection limits. Therefore, it is of great significance to establish a fast, simple and sensitive detection method.

[0004] Therefore, the prior art still needs to be improved and developed. Summary of the invention

[0005] In view of the above-mentioned deficiencies in the prior art, the purpose of the present application is to provide an aptamer sensor for detecting Alzheimer's disease-related markers, a preparation method and a kit thereof, aiming to provide a new method for detecting Alzheimer's disease-related markers.

[0006] The technical solution of this application is as follows: An aptamer sensor for detecting Alzheimer's disease-related markers, comprising magnetic microspheres, closed circular single-stranded DNA probes, and nucleic acid aptamers for specifically recognizing corresponding Aβ markers; The nucleic acid aptamer is connected to the magnetic microsphere, and the closed circular single-stranded DNA probe is connected to the nucleic acid aptamer; The nucleic acid aptamer is one of an Aβ42 aptamer and an Aβ40 aptamer; When the nucleic acid aptamer is the Aβ42 aptamer, the sequence of the Aβ42 aptamer is shown in SEQ ID NO.3, and the sequence of the closed circular single-stranded DNA probe is shown in SEQ ID NO.4; When the nucleic acid aptamer is the Aβ40 aptamer, the sequence of the Aβ40 aptamer is shown as SEQ ID NO.7, and the sequence of the closed circular single-stranded DNA probe is shown as SEQ ID NO.8.

[0007] The aptamer sensor of the present application, with specially designed nucleic acid aptamers, can significantly reduce the background signal, while effectively improving the sensitivity and linear range of detection. Compared with the conventional ELISA detection method, the detection method of the present application has a shorter detection time, a lower detection limit and a wider detection linear range.

[0008] The aptamer sensor for detecting Alzheimer's disease-related markers, wherein the surface of the magnetic microsphere is labeled with avidin, the 5' end of the nucleic acid aptamer is labeled with biotin, the biotin of the nucleic acid aptamer reacts with the avidin on the surface of the magnetic microsphere, so that the nucleic acid aptamer is connected to the surface of the magnetic microsphere.

[0009] A method for preparing an aptamer sensor for detecting Alzheimer's disease-related markers as described above, comprising the following steps: (1) Separating the magnetic microspheres labeled with avidin from the storage solution by magnetic separation, rinsing them several times with PBS-T solution, and resuspending them in PBS-T solution to obtain a magnetic microsphere suspension; Wherein, the PBS-T solution is a PBS solution containing Triton x-100, and the volume concentration of Triton x-100 in the PBS solution is 0.02%; (2) adding the aptamer solution dropwise to the magnetic microsphere suspension, and incubating with shaking at 16-37° C. for 15-60 min to obtain a magnetic microsphere-aptamer complex solution; Wherein, the 5' end of the nucleic acid aptamer is labeled with biotin; (3) removing the supernatant from the magnetic microsphere-nucleic acid aptamer complex solution by magnetic separation, and rinsing with the PBS-T solution for several times to obtain a magnetic microsphere-nucleic acid aptamer complex; (4) Prepare 1x ligase buffer containing 50 mM Tris-HCl, 10 mM MgCl2, 1 mM ATP, and 10 mM DTT; Adding a non-closed circular single-stranded DNA probe to the 1x ligase buffer to obtain a 1x ligase buffer containing the non-closed circular single-stranded DNA probe; The magnetic microsphere-nucleic acid aptamer complex obtained in step (3) is resuspended with the prepared 1x ligase buffer containing the non-closed circular single-stranded DNA probe to obtain a resuspension, and the resuspension is placed at room temperature for reaction for 30 minutes; (5) adding T4 ligase to the resuspension, vortexing to mix, and then continuing to incubate at room temperature for 15-20 minutes to perform a ligation reaction, so that the non-closed circular single-stranded DNA probe is connected end to end to form the closed circular single-stranded DNA probe; (6) removing the supernatant from the resuspension treated in step (5) by magnetic separation, and rinsing with DPBS-T solution several times to remove the T4 ligase in the resuspension and the PLP that is not bound to the nucleic acid aptamer on the surface of the magnetic microsphere, terminating the ligation reaction, and obtaining the aptamer sensor; The DPBS-T solution is prepared by adding MgSO4 to the PBS-T solution, and the concentration of MgSO4 is 2 mM.

[0010] The method for preparing the aptamer sensor for detecting Alzheimer's disease-related markers, wherein, in step (1), the concentration of the magnetic microspheres in the magnetic microsphere suspension is 1 mg / mL; In step (2), the final concentration of the nucleic acid aptamer in the system is in the range of 50-500 nM; In step (4), the final concentration of the non-closed circular single-stranded DNA probe in the system is in the range of 50-500 nM; and the concentration of the magnetic microsphere-nucleic acid aptamer complex in the resuspension is 1 mg / mL.

[0011] The method for preparing the aptamer sensor for detecting Alzheimer's disease-related markers, wherein, in step (5), the final concentration of the T4 ligase in the system is 20 U / μL.

[0012] The method for preparing the aptamer sensor for detecting Alzheimer's disease-related markers further comprises the following steps: (7) Resuspend the aptamer sensor in the DPBS-T solution to prepare a 2 mg / ml aptamer sensor suspension, and store it at 4°C.

[0013] A kit for detecting Alzheimer's disease-related markers, wherein the kit comprises highly branched rolling circle amplification primers and the aptamer sensor for detecting Alzheimer's disease-related markers as described above; the highly branched rolling circle amplification primers are divided into P1 primers and P2 primers; When the nucleic acid aptamer of the aptamer sensor is the Aβ42 aptamer, the sequence of the P1 primer is shown in SEQ ID NO. 5, and the sequence of the P2 primer is shown in SEQ ID NO. 6; When the nucleic acid aptamer of the aptamer sensor is the Aβ40 aptamer, the sequence of the P1 primer is shown as SEQ ID NO.9, and the sequence of the P2 primer is shown as SEQ ID NO.10.

[0014] The kit for detecting Alzheimer's disease-related markers, wherein the kit comprises two aptamer sensors; The nucleic acid aptamer of the first aptamer sensor is the Aβ42 aptamer, the sequence of the Aβ42 aptamer is shown in SEQ ID NO.3, and the sequence of the closed circular single-stranded DNA probe is shown in SEQ ID NO.4; The nucleic acid aptamer of the second aptamer sensor is the Aβ40 aptamer, the sequence of the Aβ40 aptamer is shown in SEQ ID NO.7, and the sequence of the closed circular single-stranded DNA probe is shown in SEQ ID NO.8.

[0015] The kit for detecting Alzheimer's disease-related markers, wherein the kit comprises two highly branched rolling circle amplification primers; In the first type of highly branched rolling circle amplification primers, the sequence of the P1 primer is shown in SEQ ID NO.5, and the sequence of the P2 primer is shown in SEQ ID NO.6; In the second type of highly branched rolling circle amplification primers, the sequence of the P1 primer is shown as SEQ ID NO.9, and the sequence of the P2 primer is shown as SEQ ID NO.10.

[0016] In the kit for detecting Alzheimer's disease-related markers, the aptamer sensor is configured as an aptamer sensor suspension with a concentration of 2 mg / ml.

[0017] Beneficial effects: The specially designed nucleic acid aptamer can significantly reduce the background signal and effectively improve the sensitivity and linear range of detection by using the aptamer sensor for detecting Alzheimer's disease-related markers of the present application. The detection method of the aptamer sensor for detecting Alzheimer's disease-related markers based on the present application has a shorter detection time, a lower detection limit and a wider detection linear range compared to the conventional ELISA detection method. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 This is a schematic diagram of the process principle of using the aptamer sensor for detecting Alzheimer's disease-related markers of the present application for detection.

[0019] Figure 2 These are the standard curves of the two aptamer sensors used for Aβ40 / Aβ42 detection in Example 1 of the present application.

[0020] Figure 3 These are the corresponding fluorescence change curves of the two aptamer sensors used for Aβ40 / Aβ42 detection in Example 1 of the present application.

[0021] Figure 4 This is a comparison diagram of the corresponding fluorescence change inflection points when the two aptamer sensors are mixed to identify Aβ40, Aβ42 and a mixture of the two in Example 1 of the present application.

[0022] Figure 5 Comparison graph of fluorescence inflection point changes when the aptamer sensors prepared for the three different Aβ42 aptamers in Example 3 of the present application are used to detect negative samples and positive samples respectively.

[0023] Figure 6 Comparison of fluorescence change curves when the aptamer sensors prepared for the three different Aβ42 aptamers in Example 3 of the present application are used to detect negative samples and positive samples respectively. DETAILED DESCRIPTION

[0024] The present application provides an aptamer sensor for detecting Alzheimer's disease-related markers, a preparation method thereof, and a kit. To make the purpose, technical solution, and effect of the present application clearer and more specific, the present application is further described in detail below. It should be understood that the specific embodiments described herein are only used to explain the present application and are not used to limit the present application.

[0025] Compared with antibodies, aptamers have high specificity comparable to antibodies, and are cheaper, easier to obtain, and easier to modify and regulate. Therefore, aptamer sensors have the advantages of high sensitivity, high specificity, fast detection speed, and low preparation cost, and have important application value in clinical testing, environmental testing, food safety control, and biological analysis.

[0026] In the present application, an aptamer sensor for detecting Alzheimer's disease-related markers is provided, which can achieve ultra-sensitive detection of Aβ markers in combination with highly branched rolling circle amplification technology.

[0027] Specifically, the aptamer sensor for detecting Alzheimer's disease-related markers of the present application includes magnetic microspheres, closed circular single-stranded DNA probes, and nucleic acid aptamers for specifically recognizing corresponding Aβ markers; The nucleic acid aptamer is connected to the magnetic microsphere, and the closed circular single-stranded DNA probe is connected to the nucleic acid aptamer.

[0028] Specifically, a nucleic acid aptamer that can specifically recognize the corresponding Aβ marker is first compositely labeled on the surface of the magnetic microsphere, and then the closed circular single-stranded DNA probe is composited with the nucleic acid aptamer using the principle of base complementary pairing to form an aptamer sensor for detecting Alzheimer's disease-related markers. When the Aβ marker to be tested is present in the test sample, the nucleic acid aptamer will recognize the Aβ marker and undergo a conformational change. This process will release the closed circular single-stranded DNA probe on the nucleic acid aptamer into the solution, and the presence of the closed circular single-stranded DNA probe can trigger specific highly branched rolling circle amplification. Therefore, by detecting and quantifying the free closed circular single-stranded DNA probe in the solution, the concentration of the corresponding Aβ marker can be calculated.

[0029] In the present application, corresponding nucleic acid aptamers, closed circular single-stranded DNA probes, and highly branched rolling circle amplification primers are designed for two Aβ markers, Aβ40 and Aβ42, respectively, which can achieve simultaneous quantitative detection of Aβ40 and Aβ42. In the present application, the primer sequences of nucleic acid aptamers, closed circular single-stranded DNA probes, and highly branched rolling circle amplification primers are shown in Table 1. In Table 1, the sequences of nucleic acid aptamers and closed circular single-stranded DNA probes that are both horizontal lines can be complementary to each other, and the sequences that are both wavy lines can be complementary to each other.

[0030] Table 1 name Sequence (5'-3') Serial Number Apt42 <![CDATA[Biotin-TEG-CCGGTGGGGGACCAGTA CAAAAGTGGGTAGGGCGGGTTGG AAAA]]> SEQ ID NO.1 Apt42-1 <![CDATA[Biotin-TEG-CCGGTGGGGGACCAGTA CAAAAGTGGGTAGGGCGGGTTGG AAAATTTTTT]]> SEQ ID NO.2 Apt42-2 <![CDATA[Biotin-TEG-CCGGTGGGGGACCAGTA CAAAAGTGGGTAGGGCGGGTTGG AAAATTTTTTTTTTT]]> SEQ ID NO.3 PLP42 <![CDATA[P'- CTACCCACTTTTG TTCTAGTATACAGACTTCACTCCATCCCTCGCATGCCGTTCTTCTGATC CCAACCCGCC ]]> SEQ ID NO.4 PLP42-P1 AGTGGGTAGGGCGGGTT SEQ ID NO.5 PLP42-P2 TCGCATGCCGTTCTTCTGA SEQ ID NO.6 Apt40 <![CDATA[Biotin-TEG- GCCTGTGGTGTTGGGGCGGGTGCG TTTTTTTTTTTTTTT]]> SEQ ID NO.7 PLP40 <![CDATA[P'- CCAACACCACAGGC TTCTCTATACTACACTCAGATGTCACTCTAGCTAAGTCGTCTATCAAT CGCACCCGCC ]]> SEQ ID NO.8 PLP40-P1 GGGCGGGTGCGATTGATA SEQ ID NO.9 PLP40-P2 CAGATGTCACTCTAGCTAAGTCGTCT SEQ ID NO.10 Furthermore, the nucleic acid aptamer may be one of an Aβ42 aptamer and an Aβ40 aptamer.

[0031] When the nucleic acid aptamer is an Aβ42 aptamer, the sequence of the Aβ42 aptamer is shown in SEQ ID NO.3, and the sequence of the closed circular single-stranded DNA probe is shown in SEQ ID NO.4; When the nucleic acid aptamer is an Aβ40 aptamer, the sequence of the Aβ40 aptamer is shown as SEQ ID NO.7, and the sequence of the closed circular single-stranded DNA probe is shown as SEQ ID NO.8.

[0032] The present application also provides a method for preparing the above-mentioned aptamer sensor for detecting Alzheimer's disease-related markers, comprising the following steps: (1) The avidin-labeled magnetic microspheres (MBs) were separated from the storage solution by magnetic separation, rinsed three times with PBS solution containing 0.02% (v / v) Triton x-100 (hereinafter referred to as PBS-T solution), and resuspended in PBS-T solution to obtain a 1 mg / mL magnetic microsphere suspension.

[0033] (2) Add the nucleic acid aptamer solution dropwise to the above magnetic microsphere suspension, the 5' end of the nucleic acid aptamer is labeled with biotin, and the final concentration of the nucleic acid aptamer in the system ranges from 50 to 500 nM. Incubate with shaking at 16 to 37°C for 15 to 60 min to obtain a magnetic microsphere-nucleic acid aptamer complex (MBs-Apt) solution.

[0034] The benefits of using the above concentrations of magnetic microspheres and nucleic acid aptamers are: on the one hand, the ability of the magnetic microsphere surface to bind nucleic acid aptamers is limited, and excessive aptamers will cause waste of raw materials; on the other hand, after the nucleic acid aptamers are bound to the surface of the magnetic microspheres, the surface negative charge will be enhanced. The more bound, the stronger the negative charge. The electrostatic repulsion will affect the subsequent binding and stability of PLP.

[0035] In step (2), the incubation may be carried out under shaking at 16-37°C for 15-60 minutes. Preferably, the incubation may be carried out under shaking at room temperature for 30 minutes to ensure that the reaction between the magnetic microspheres and the biotinylated nucleic acid aptamer reaches equilibrium. During this incubation process, the incubation time may vary appropriately with the change of the ambient temperature, but the reaction temperature should not be too high or too low. For example, the time may be extended when the temperature is low (16°C, 60 minutes), and the time may be shortened when the temperature is high (37°C, 15 minutes). In the present application, room temperature refers to 25°C.

[0036] In the present application, the 5' end of the aptamer is labeled with biotin, and the biotin of the aptamer can react with the avidin on the surface of the magnetic microspheres to connect the aptamer to the surface of the magnetic microspheres to obtain a magnetic microsphere-aptamer complex (MBs-Apt).

[0037] When the nucleic acid aptamer is an Aβ42 aptamer, the sequence of the Aβ42 aptamer is as shown in SEQ ID NO. 3, and the obtained magnetic microsphere-nucleic acid aptamer complex is a magnetic microsphere-Aβ42 aptamer complex (MBs-Apt42); When the nucleic acid aptamer is Aβ40 aptamer, the sequence of Aβ40 aptamer is shown in SEQ ID NO.7, and the obtained magnetic microsphere-nucleic acid aptamer complex is a magnetic microsphere-Aβ40 aptamer complex (MBs-Apt40).

[0038] (3) The supernatant of the magnetic microsphere-nucleic acid aptamer complex (MBs-Apt) solution was removed by magnetic separation, and the solution was rinsed three times with PBS-T solution to obtain the magnetic microsphere-nucleic acid aptamer complex (MBs-Apt).

[0039] (4) Prepare 1x ligase buffer, which contains 50 mM Tris-HCl (tris(hydroxymethyl)aminomethane-hydrochloric acid), 10 mM MgCl2 (magnesium chloride), 1 mM ATP (adenosine triphosphate), and 10 mM DTT (dithiothreitol); A non-closed circular single-stranded DNA probe (PLP) is added to a 1x ligase buffer, and the final concentration range of PLP in the system is: 50-500 nM, to obtain a 1x ligase buffer containing a non-closed circular single-stranded DNA probe; The magnetic microsphere-nucleic acid aptamer complex (MBs-Apt) obtained in step (3) was resuspended in a prepared 1x ligase buffer containing a non-closed circular single-stranded DNA probe to obtain a resuspension, wherein the concentration of MBs-Apt in the resuspension was 1 mg / mL, and the resuspension was placed at room temperature for reaction for 30 min.

[0040] Among them, in the resuspension solution, each 1 mg of magnetic microspheres is incubated with 50-500 pmol of non-closed circular single-stranded DNA probe. The surface of each 1 mg of magnetic microspheres can bind to about 400 pmol of biotinylated nucleic acid aptamers at the highest energy. According to the 1:1 binding ratio of nucleic acid aptamers and non-closed probes, the upper limit of the amount of non-closed circular single-stranded DNA probe is set to a slightly higher 500 pmol. Since the nucleic acid aptamers that bind to the surface of the magnetic microspheres in advance will form a negative charge layer on the surface, it will affect the binding and stability of the non-closed circular single-stranded DNA probe. Therefore, the amount of non-closed circular single-stranded DNA probe can be adjusted according to demand.

[0041] In step (4), the reaction is carried out at room temperature for 30 minutes, and the reaction basically reaches equilibrium. Therefore, the reaction time can be appropriately extended based on 30 minutes, but shortening the time is not recommended.

[0042] When the nucleic acid aptamer is an Aβ42 aptamer, the sequence of the non-closed circular single-stranded DNA probe is shown in SEQ ID NO. 4; When the nucleic acid aptamer is an Aβ40 aptamer, the sequence of the non-closed circular single-stranded DNA probe is shown in SEQ ID NO. 8.

[0043] The sequences of the non-closed circular single-stranded DNA probe and the closed circular single-stranded DNA probe formed from the non-closed circular single-stranded DNA probe are the same, but the morphology is different.

[0044] (5) Add T4 ligase to the resuspension, vortex to mix, and continue incubating at room temperature for 15-20 minutes to carry out the ligation reaction so that the PLP can be connected from end to end to form a closed circular single-stranded DNA probe (cPLP).

[0045] In step (5), the final concentration of T4 ligase in the system is 20 U / μL. If the amount of T4 ligase is excessive, it is easy to cause non-specific ligation reaction. If the amount of T4 ligase is too low, it is easy to reduce the reaction efficiency.

[0046] In step (5), the incubation time at room temperature is 15-20 minutes, preferably 15 minutes. If the time is too short, the reaction will be incomplete, and if the time is too long, non-specific products will increase significantly.

[0047] (6) The supernatant is removed from the resuspension treated in step (5) by magnetic separation, and the resuspension is rinsed 5 times with DPBS-T solution (PBS-T solution containing 2 mM MgSO4) to remove T4 ligase and PLP that is not bound to the nucleic acid aptamer on the surface of the magnetic microspheres, thereby terminating the ligation reaction and finally obtaining a magnetic microsphere-nucleic acid aptamer-closed circular single-stranded DNA probe complex (MBs-Apt-cPLP, MAP), thereby obtaining an aptamer sensor for detecting Alzheimer's disease-related markers.

[0048] In step (6), the DPBS-T solution is obtained by adding MgSO4 to the PBS-T solution in step (1).

[0049] When the nucleic acid aptamer is an Aβ42 aptamer, the obtained magnetic microsphere-nucleic acid aptamer-closed circular single-stranded DNA probe complex is a magnetic microsphere- Aβ42-closed circular single-stranded DNA probe complex (MBs-Apt42-cPLP42, MAP42); When the nucleic acid aptamer is Aβ40 aptamer, the obtained magnetic microsphere-nucleic acid aptamer-closed circular single-stranded DNA probe complex is a magnetic microsphere-Aβ40-closed circular single-stranded DNA probe complex (MBs-Apt40-cPLP40, MAP40).

[0050] (7) Resuspend the above MAP in DPBS-T solution to prepare a 2 mg / ml MAP suspension and store it at 4°C.

[0051] In the present application scheme, an application of the above-mentioned aptamer sensor is also provided, and the aptamer sensor is used to detect Alzheimer's disease related markers, and the Alzheimer's disease related markers are Aβ42 or Aβ40.

[0052] The present application also provides a kit for detecting Alzheimer's disease-related markers, the kit comprising the aptamer sensor for detecting Alzheimer's disease-related markers as described above, and highly branched rolling circle amplification primers; the highly branched rolling circle amplification primers are divided into P1 primers and P2 primers; When the nucleic acid aptamer of the aptamer sensor is an Aβ42 aptamer, the sequence of the P1 primer in the highly branched rolling circle amplification primer is shown in SEQ ID NO. 5, and the sequence of the P2 primer in the highly branched rolling circle amplification primer is shown in SEQ ID NO. 6; When the nucleic acid aptamer of the aptamer sensor is an Aβ40 aptamer, the sequence of the P1 primer in the highly branched rolling circle amplification primer is shown in SEQ ID NO.9, and the sequence of the P2 primer in the highly branched rolling circle amplification primer is shown in SEQ ID NO.10.

[0053] Furthermore, the aptamer sensor of the present application can realize the simultaneous recognition of two Aβ markers. Therefore, the kit of the present application comprises the above two aptamer sensors - MAP40 and MAP42, and the above two highly branched rolling circle amplification primers.

[0054] The aptamer sensor and kit for detecting Alzheimer's disease-related markers provided in this application have the following advantages: The aptamer sensor of the present application can realize the simultaneous recognition of two Aβ markers, and can realize the rapid and ultrasensitive quantitative detection of the two markers in combination with the highly branched rolling circle amplification reaction; Compared with the commonly used ELISA detection kit, the kit of the present application has a shorter detection time, a lower detection limit and a wider linear detection range; The nucleic acid aptamer sequence used in the aptamer sensor of the present application has been specially optimized and used in conjunction with a corresponding specially designed closed circular single-stranded DNA probe, which can significantly reduce the detection background and improve the sensitivity and accuracy of the detection.

[0055] In the present application, a detection method for using the above aptamer sensor to detect Alzheimer's disease-related markers is also provided, such as Figure 1 As shown, the following steps are included: (1) Place the MAP suspension in a recognition reaction tube, vortex to mix, add 10 μL of the sample to be tested, and incubate at room temperature for 15 min to perform the recognition reaction.

[0056] The sample to be tested may be a body fluid sample, an Aβ40 standard sample, or an Aβ42 standard sample.

[0057] The MAP suspension can be one or both of MAP40 suspension and MAP42 suspension. The amount of each MAP suspension added is 5 μL.

[0058] (2) Separate the magnetic microspheres by magnetic separation and retain the supernatant in the identification reaction tube for subsequent highly branched rolling circle amplification reactions.

[0059] When Aβ markers are present in the sample to be tested, a corresponding amount of cPLP will be released into the supernatant, which can trigger a subsequent highly branched rolling circle amplification reaction.

[0060] (3) Prepare a highly branched rolling circle amplification reaction system in a fluorescent quantitative PCR tube: 1 μL of 10x reaction buffer, 1 μL of 10 mM dNTPs, 0.4 μL of 8000 U / μL Bst polymerase, 0.2 μL of 10x LAMP fluorescent dye, 1 μL of 30 mM MgSO4 solution, 0.4 μL of enzyme-free water, and 2 μL of highly branched rolling circle amplification reaction primer combination.

[0061] Among them, 10x reaction buffer contains 20 mM Tris-HCl, 10 mM (NH4)2SO4, 10 mM KCl, 5 mMMgSO4, and 0.1% Triton® X-100.

[0062] The highly branched rolling circle amplification reaction primer combination 2 μL is divided into 1 μL of P1 primer with a concentration of 4 μM and 1 μL of P2 primer with a concentration of 3 μM.

[0063] When the MAP suspension added in step (1) is a MAP42 suspension, the P1 primer in the highly branched rolling circle amplification primer is PLP42-P1, and the sequence is shown in SEQ ID NO. 5, and the P2 primer in the highly branched rolling circle amplification primer is PLP42-P2, and the sequence is shown in SEQ ID NO. 6. The highly branched rolling circle amplification reaction primer combination uses a combination of PLP42-P1 + PLP42-P2 to amplify the closed circular single-stranded DNA probe cPLP42 corresponding to the Aβ42 aptamer, that is, a quantitative reaction of the Aβ42 marker.

[0064] When the added MAP suspension in step (1) can be a MAP40 suspension, the P1 primer in the highly branched rolling circle amplification primer is PLP40-P1, and the sequence is shown in SEQ ID NO. 9, and the P2 primer in the highly branched rolling circle amplification primer is PLP40-P2, and the sequence is shown in SEQ ID NO. 10. The highly branched rolling circle amplification reaction primer combination uses a combination of PLP40-P1 + PLP40-P2 to amplify the closed circular single-stranded DNA probe cPLP40 corresponding to the Aβ40 aptamer, that is, a quantitative reaction of the Aβ40 marker.

[0065] When the MAP suspension added in step (1) can be a MAP40 suspension and a MAP42 suspension, two fluorescent quantitative PCR tubes are set in step (3), and the highly branched rolling circle amplification reaction primer combination of one fluorescent quantitative PCR tube adopts the combination of PLP42-P1 + PLP42-P2, and the highly branched rolling circle amplification reaction primer combination of the other fluorescent quantitative PCR tube adopts the combination of PLP40-P1 + PLP40-P2. The highly branched rolling circle amplification reaction is divided into two different reaction tubes according to different primer combinations, and quantitative reactions are performed on the two targets respectively.

[0066] (4) Add 4 μL of the supernatant obtained in step (2) to the fluorescence quantitative PCR tube in step (3), mix well, transfer the fluorescence quantitative PCR tube to the fluorescence quantitative PCR machine, and react at 61°C for 30 min. During the reaction, record the fluorescence intensity of the FITC channel every 1 min to finally obtain a fluorescence change curve. The fluorescence change inflection point (TIP) is obtained based on the fluorescence change curve analysis.

[0067] (5) Substitute the TIP value of the sample to be tested into the standard curve and calculate the concentration of Aβ marker in the sample to be tested.

[0068] The process of drawing the standard curve includes the following steps: The gradient concentration standard samples were tested according to (1)-(4) in the above detection method, and the TIP values ​​corresponding to each concentration were analyzed and obtained. A standard curve was drawn according to the TIP values ​​corresponding to each concentration.

[0069] When the standard substance is Aβ42, a standard curve of Aβ42 is drawn; when the standard substance is Aβ40, a standard curve of Aβ40 is drawn.

[0070] After the aptamer sensor of the present application is successfully prepared, it is resuspended in DPBS-T buffer for storage. When the test is performed, the required aptamer sensor is added to the identification reaction tube. At this time, the Apt-cPLP complex on the surface of the magnetic microsphere is in a relatively stable equilibrium state, and only a small amount of cPLP is released into the solution. Add the sample to be tested to the identification reaction tube. When the Aβ marker is present, the conformation of the nucleic acid aptamer changes due to the higher affinity between the nucleic acid aptamer and the Aβ marker, thereby releasing the corresponding cPLP into the solution. The supernatant is collected by magnetic separation, and the cPLP is used as a template for the subsequent highly branched rolling circle amplification reaction. As the number of templates (i.e., cPLP) in the highly branched rolling circle amplification reaction gradually increases, the peak time of the fluorescence amplification curve in the fluorescence quantitative PCR tube will gradually shorten, that is, the smaller the TIP value. Furthermore, since the amount of cPLP is directly related to the content of Aβ marker in the original sample to be tested, the relationship between the TIP value and the concentration of Aβ marker in the sample can be established, thereby drawing a relevant standard curve for accurate quantification of Aβ marker.

[0071] In the present application, the nucleic acid aptamers, closed circular single-stranded DNA probes, and highly branched rolling circle amplification primers involved in the kit are all specially designed for the above-mentioned detection method, and are indispensable key components for achieving highly sensitive Aβ marker detection. Using the kit of the present application in combination with the detection method, the specially designed nucleic acid aptamers can significantly reduce the background signal, while effectively improving the sensitivity and linear range of the detection. Compared with the conventional ELISA detection method, the detection method of the present application has a shorter detection time, a lower detection limit, and a wider detection linear range.

[0072] Moreover, the two aptamer sensors in the present application can be used for simultaneous identification and detection of Aβ40 / Aβ42 without obvious cross-interference, which can simplify the experimental operation.

[0073] The present application is further described below through specific embodiments.

[0074] Example 1 The aptamer sensor is prepared according to the above preparation and assembly steps, and the standard curve is drawn and the sample detection is quantified according to the above detection steps.

[0075] 1. Preparation of aptamer sensor MAP42 (1) First, the avidin-labeled magnetic microspheres (MBs) were separated from the preservation solution by magnetic separation, rinsed three times with PBS-T solution, and finally resuspended in PBS-T solution to obtain a magnetic microsphere suspension. The concentration of the magnetic microspheres in the magnetic microsphere suspension was 1 mg / mL.

[0076] (2) Add the aptamer solution dropwise to the magnetic microsphere suspension until the aptamer concentration in the reaction tube is 500 nM, the ratio between the magnetic microspheres and the aptamer is 500 pmol of aptamer per 1 mg of magnetic microspheres, and incubate at room temperature for 30 min to obtain a magnetic microsphere-Aβ42 aptamer complex (MBs-Apt42) solution. The aptamer is Apt42-2, and the sequence is shown in SEQ ID NO.3.

[0077] (3) The supernatant was then removed by magnetic separation and rinsed three times with PBS-T solution to obtain the magnetic microsphere-nucleic acid aptamer complex (MBs-Apt42).

[0078] (4) Prepare 1x ligase buffer (50 mM Tris-HCl, 10 mM MgCl2, 1 mM ATP, 10 mM DTT) and add 5 μM of the non-closed circular single-stranded DNA probe (PLP42) to make the final concentration of PLP in the reaction tube 500 nM. The sequence of the non-closed circular single-stranded DNA probe PLP42 is shown in SEQ ID NO. 4.

[0079] The magnetic microsphere-nucleic acid aptamer complex (MBs-Apt) obtained in step (3) was resuspended in the prepared 1x ligase buffer to obtain a resuspension, the concentration of MBs-Apt in the resuspension was 1 mg / mL, and the resuspension was placed at room temperature for reaction for 30 min.

[0080] (5) T4 ligase was then added to the resuspension. The final concentration of T4 ligase in the reaction tube was 20 U / μL. After vortexing to mix, the mixture was incubated at room temperature for 15 min to carry out the ligation reaction, so that the PLP was connected from head to tail to form a closed circular single-stranded DNA probe (cPLP42).

[0081] (6) The supernatant of the resuspended liquid treated in step (5) is removed by magnetic separation, and the liquid is rinsed five times with DPBS-T solution (PBS-T solution containing 2 mM MgSO4) to remove PLP42 and T4 ligase that are not bound to the nucleic acid aptamer on the surface of the magnetic microspheres, thereby terminating the ligation reaction and finally obtaining a magnetic microsphere-nucleic acid aptamer-closed circular single-stranded DNA probe complex (MBs-Apt42-cPLP42, MAP42), which is an aptamer sensor for Aβ42 detection.

[0082] (7) Resuspend the above MAP42 in DPBS-T solution to make a 2 mg / ml MAP42 suspension and store it at 4°C.

[0083] 2. Preparation of Aptamer Sensor MAP40 The preparation method of the aptamer sensor MAP40 is the same as that in step one, except that the nucleic acid aptamer used in step two is Aβ40 aptamer, the sequence of Aβ40 aptamer is shown in SEQ ID NO.7, and the sequence of the closed circular single-stranded DNA probe used is shown in SEQ ID NO.8. Finally, a 2 mg / ml MAP40 suspension is prepared.

[0084] 3. Detect the gradient concentration of Aβ42 standard samples and draw the standard curve of Aβ42 (1) Add 5 μL of the MAP40 suspension prepared in step 2 and 5 μL of the MAP42 suspension prepared in step 1 to each identification reaction tube. Vortex to mix, then add 10 μL of the sample to be tested to each identification reaction tube and incubate at room temperature for 15 min to perform the identification reaction.

[0085] Among them, the sample to be tested is an Aβ42 standard sample. The concentration of the sample to be tested added to each identification reaction tube is different, and the concentration gradient of the sample to be tested is 0 pg / mL, 4 pg / mL, 10 pg / mL, 40 pg / mL, 100 pg / mL, 400 pg / mL, 1000 pg / mL, and 4000 pg / mL.

[0086] (2) Separate the magnetic microspheres by magnetic separation and retain the supernatant in the identification reaction tube for subsequent highly branched rolling circle amplification reactions.

[0087] (3) Prepare a highly branched rolling circle amplification reaction system in a fluorescent quantitative PCR tube: 1 μL of 10x reaction buffer, 1 μL of 10 mM dNTPs, 0.4 μL of 8000 U / μL Bst polymerase, 0.2 μL of 10x LAMP fluorescent dye, 1 μL of 30 mM MgSO4 solution, 0.4 μL of enzyme-free water, and 2 μL of highly branched rolling circle amplification reaction primer combination.

[0088] Among them, 10x reaction buffer contains 20 mM Tris-HCl, 10 mM (NH4)2SO4, 10 mM KCl, 5mM MgSO4, and 0.1% Triton® X-100.

[0089] Among them, 2 μL of the highly branched rolling circle amplification reaction primer combination is divided into 1 μL of a P1 primer with a concentration of 4 μM and 1 μL of a P2 primer with a concentration of 3 μM. The P1 primer is PLP42-P1, and the sequence is shown in SEQ ID NO.5. The P2 primer is PLP42-P2, and the sequence is shown in SEQ ID NO. 6.

[0090] (4) Add 4 μL of the supernatant obtained in step (2) to the fluorescence quantitative PCR tube in step (3), mix well, transfer the fluorescence quantitative PCR tube to the fluorescence quantitative PCR machine, and react at 61°C for 30 min. During the reaction, record the fluorescence intensity of the FITC channel every 1 min to finally obtain a fluorescence change curve. The fluorescence change inflection point (TIP) is obtained based on the fluorescence change curve analysis.

[0091] Finally, the TIP values ​​corresponding to each concentration were recorded, and a standard curve was drawn based on the TIP values ​​corresponding to each concentration. The standard curve of Aβ42 is shown in Figure 2 The corresponding fluorescence change curve is shown in Figure 3 As shown, it is labeled as AβO42.

[0092] 4. Detect the gradient concentration of Aβ40 standard samples and draw the standard curve of Aβ40 The detection method used to draw the standard curve of Aβ40 is the same as that in step three, with the only difference being that the sample to be tested in step three is the Aβ40 standard sample, the P1 primer in the highly branched rolling circle amplification reaction primer combination is PLP40-P1, the sequence is shown in SEQ ID NO.9, and the P2 primer is PLP40-P2, the sequence is shown in SEQ ID NO. 10.

[0093] The standard curve of Aβ40 is as follows Figure 2 The corresponding fluorescence change curve is shown in Figure 3 As shown, it is labeled as AβO40.

[0094] The results are as follows Figure 2-3 As shown in the figure, the aptamer sensor MAP40 for Aβ40 detection and the aptamer sensor MAP42 for Aβ42 detection both showed good linearity. Among them, ΔRn is the intensity change relative to the background fluorescence signal. As the concentration of Aβ40 or Aβ42 in the sample to be tested increases, the fluorescence inflection point of the fluorescence change curve of the highly branched rolling circle amplification gradually advances.

[0095] 5. Cross-interference test The detection method used in the cross-interference test is the same as that in step three, except that the samples to be tested are different and that, in step (3), two fluorescent quantitative PCR tubes are set up, one fluorescent quantitative PCR tube uses a combination of PLP42-P1 + PLP42-P2 as the primer combination for the highly branched rolling circle amplification reaction, and the other fluorescent quantitative PCR tube uses a combination of PLP40-P1 + PLP40-P2 as the primer combination for the highly branched rolling circle amplification reaction.

[0096] In this section, the samples to be tested are divided into four groups: (1) Control group (labeled as Blank): the sample to be tested is 10 μL of water; (2) Experimental group Aβ40 (labeled as Aβ40): the sample to be tested was 10 μL of Aβ40 standard sample with a concentration of 10 ng / mL; (3) Experimental group Aβ42 (labeled as Aβ42): the sample to be tested was 10 μL of Aβ42 standard sample with a concentration of 10 ng / mL; (4) Experimental group Mix (labeled as Mix): The sample to be tested is 5 μL of Aβ40 standard sample with a concentration of 20 ng / mL + 5 μL of Aβ42 standard sample with a concentration of 20 ng / mL.

[0097] The results are as follows Figure 4 As shown, HRCA-Aβ40 is the result of quantitative reaction using the combination of PLP40-P1 + PLP40-P2, and HRCA-Aβ42 is the result of quantitative reaction using the combination of PLP42-P1 + PLP42-P2.

[0098] Figure 4 The fluorescence inflection point changes caused by the use of the corresponding supernatants in highly branched rolling circle amplification reactions were demonstrated when two aptamer sensors, MAP40 and MAP42, were mixed and used to detect Aβ40, Aβ42 and a mixture of the two, respectively. Figure 4 In the data, Relative TIP refers to the relative fluorescence inflection point, that is, the fluorescence inflection point detected by BLank is used as the standard for uniform normalization. Relative TIP = fluorescence inflection point of each sample ÷ average fluorescence inflection point detected by BLank. From the results, it can be seen that only when the corresponding marker exists, the corresponding highly branched rolling circle amplification system will show a significant advance of the fluorescence inflection point. This confirms that the two aptamer sensors can be used for the simultaneous identification and detection of Aβ40 / Aβ42 without obvious cross-interference.

[0099] 5. Sample Quantitative Determination In this part, the samples to be tested were divided into 6 groups, and cerebrospinal fluid samples with different concentrations of Aβ40 or Aβ42 were added, as shown in Table 2.

[0100] When the sample to be tested is a cerebrospinal fluid sample to which Aβ42 is added, the detection method is the same as step three, the only difference being that the sample to be tested is different.

[0101] When the sample to be tested is a cerebrospinal fluid sample to which Aβ40 is added, the detection method is the same as step 4, the only difference being that the sample to be tested is different.

[0102] The concentration of each indicator in the corresponding sample can be calculated according to the standard curve, and the recovery rate can be further calculated. The results are shown in Table 2. The recovery rates of samples of various concentrations are between 84% and 104%, showing good recovery performance.

[0103] Table 2 Recovery test of Aβ40 / Aβ42 in cerebrospinal fluid Sample No. Aβ40 Added (pg / mL) Aβ40 Found (pg / mL) Recovery (%) Sample No. Aβ42 Added (pg / mL) Aβ42 Found (pg / mL) Recovery (%) 1 0 Not Found - 4 0 Not Found - 2 4 3.36±0.83 84.05 5 4 3.82±0.23 95.53 3 40 38.92±5.52 97.30 6 100 104.06±15.10 104.06 Example

[0104] According to the standard curve drawn in Example 1 (formula: background signal value + 3 times standard deviation), the detection limits of the aptamer sensor prepared in Example 1 of the present application for Aβ40 and Aβ42 reached 2.48 pg / mL and 0.27 pg / mL, respectively, which are lower than the commonly used ELISA detection kits.

[0105] The aptamer sensor prepared in Example 1 of the present application was compared with the detection performance of other patents or products, and the results are shown in Table 3.

[0106] Table 3 Patent / Product Detection indicators Linear range Detection limit Detection time Human Amyloid beta40 ELISA Kit(Thermo) Aβ40 7.8-500 pg / mL <6 pg / mL 2.5 h Human Amyloid beta42 ELISA Kit(Thermo) Aβ42 15.6-1000 pg / mL <10 pg / mL 2.5 h Abeta 42 SingleMolecule Counting Kit (Merck) Aβ42 0.24-250 pg / mL 0.98 pg / mL 2 h CN113311153A Aβ42 0.0977-100 ng / mL 97.7 pg / mL 1 h CN117434269B Aβ1-40Aβ1-42 9.77-1250 pg / mL4.88-625 pg / mL 0.60 pg / mL0.64 pg / mL 18.5 h This application Aβ40Aβ42 4-4000pg / mL 2.48 pg / mL0.27 pg / mL 45 min It can be seen from Table 3 that the aptamer sensor of the present application has a shorter detection time, a lower detection limit and a wider detection linear range compared to the conventional ELISA detection method.

[0107] Example 3 In this embodiment, according to the preparation method of step 1 of embodiment 1, aptamer sensors MA0P42, MA1P42 and MA2P42 are prepared. The difference is that the sequences of the nucleic acid aptamers used are different. MA0P42, MA1P42 and MA2P42 are three magnetic microspheres labeled with different nucleic acid aptamers.

[0108] The nucleic acid aptamer used in the aptamer sensor MA0P42 is Apt42, the sequence of Apt42 is shown in SEQ ID NO.1, and the sequence of the closed circular single-stranded DNA probe used is shown in SEQ ID NO.4.

[0109] The nucleic acid aptamer used in the aptamer sensor MA1P42 is Apt42-1, the sequence of Apt42-1 is shown in SEQ ID NO.2, and the sequence of the closed circular single-stranded DNA probe used is shown in SEQ ID NO.4.

[0110] The nucleic acid aptamer used in the aptamer sensor MA2P42 is Apt42-2, the sequence of Apt42-2 is shown in SEQ ID NO.3, and the sequence of the closed circular single-stranded DNA probe used is shown in SEQ ID NO.4.

[0111] The above three nucleic acid aptamers are characterized by: ① The 5' end has a biotin label, which can be used to react with avidin on the surface of magnetic microspheres; ② The 3' end has oligothymidine deoxynucleotides of different lengths; ③ The middle section is an aptamer sequence with specific recognition function.

[0112] The performance of MA0P42, MA1P42 and MA2P42 was verified. One experimental group (Positive) and one control group (Negative) were set for each aptamer sensor. The detection method used was the same as step 3 of Example 1, except that: (1) The samples to be tested were different. The sample to be tested in the experimental group (Positive) was a positive sample, 10 μL of cerebrospinal fluid containing 10 ng / mL Aβ42, and the sample to be tested in the control group (Negative) was a negative sample, 10 μL of blank cerebrospinal fluid; (2) In step (1), only one aptamer sensor was used, that is, only 5 μL of the prepared MA0P42 suspension, MA1P42 suspension, or MA2P42 suspension was added.

[0113] The results are as follows Figure 5 and Figure 6 As shown in the results, it can be seen that when MA2P42 is used for detection, the fluorescence inflection point time of the negative sample (Negative) is later, and it has no significant effect on the inflection point time of the positive sample (Positive). Figure 5 In the data, Relative TIP refers to the relative fluorescence inflection point, that is, the fluorescence inflection point of MA2P42 when detecting negative samples is used as the standard for uniform normalization. Relative TIP = fluorescence inflection point of each sample ÷ average fluorescence inflection point of MA2P42 when detecting negative samples. Figure 6 It can be seen that the interval (ΔT) between the fluorescence inflection point times of negative and positive samples of MA2P42 is larger, thus achieving higher detection sensitivity and a wider linear detection range. This is because the complex formed between Apt42-2 and cPLP42 is more stable, so less cPLP42 is spontaneously released into the solution when detecting negative samples. According to calculations, the spontaneously released cPLP42 is reduced by 88%, delaying the inflection point time of negative sample detection.

[0114] Therefore, the aptamer used in the aptamer sensor MA2P42 can significantly reduce the background signal, while effectively improving the sensitivity and linear range of detection.

[0115] It should be understood that the application of the present application is not limited to the above examples. For ordinary technicians in this field, improvements or changes can be made according to the above description, and all these improvements and changes should fall within the scope of protection of the present application.

Claims

1. An aptamer sensor for detecting Alzheimer's disease-related markers, characterized in that: It includes magnetic microspheres, closed circular single-stranded DNA probes, and nucleic acid aptamers for specific recognition of corresponding Aβ markers; The nucleic acid aptamer is connected to the magnetic microsphere, and the closed circular single-stranded DNA probe is connected to the nucleic acid aptamer; The nucleic acid aptamer is one of an Aβ42 aptamer and an Aβ40 aptamer; When the nucleic acid aptamer is the Aβ42 aptamer, the sequence of the Aβ42 aptamer is shown in SEQ ID NO.3, and the sequence of the closed circular single-stranded DNA probe is shown in SEQ ID NO.4; When the nucleic acid aptamer is the Aβ40 aptamer, the sequence of the Aβ40 aptamer is shown as SEQ ID NO.7, and the sequence of the closed circular single-stranded DNA probe is shown as SEQ ID NO.

8.

2. The aptamer sensor for detecting Alzheimer's disease-related markers according to claim 1, characterized in that: The surface of the magnetic microsphere is labeled with avidin, and the 5' end of the nucleic acid aptamer is labeled with biotin. The biotin of the nucleic acid aptamer reacts with the avidin on the surface of the magnetic microsphere, so that the nucleic acid aptamer is connected to the surface of the magnetic microsphere.

3. A method for preparing an aptamer sensor for detecting Alzheimer's disease-related markers according to any one of claims 1 to 2, characterized in that: The following steps are involved: (1) Separating the magnetic microspheres labeled with avidin from the storage solution by magnetic separation, rinsing them several times with PBS-T solution, and resuspending them in PBS-T solution to obtain a magnetic microsphere suspension; Wherein, the PBS-T solution is a PBS solution containing Triton x-100, and the volume concentration of Triton x-100 in the PBS solution is 0.02%; (2) adding the aptamer solution dropwise to the magnetic microsphere suspension, and incubating with shaking at 16-37° C. for 15-60 min to obtain a magnetic microsphere-aptamer complex solution; Wherein, the 5' end of the nucleic acid aptamer is labeled with biotin; (3) removing the supernatant from the magnetic microsphere-nucleic acid aptamer complex solution by magnetic separation, and rinsing with the PBS-T solution for several times to obtain a magnetic microsphere-nucleic acid aptamer complex; (4) Prepare 1x ligase buffer containing 50 mM Tris-HCl, 10 mM MgCl2, 1 mM ATP, and 10 mM DTT; Adding a non-closed circular single-stranded DNA probe to the 1x ligase buffer to obtain a 1x ligase buffer containing the non-closed circular single-stranded DNA probe; The magnetic microsphere-nucleic acid aptamer complex obtained in step (3) is resuspended with the prepared 1x ligase buffer containing the non-closed circular single-stranded DNA probe to obtain a resuspension, and the resuspension is placed at room temperature for reaction for 30 minutes; (5) adding T4 ligase to the resuspension, vortexing to mix, and then continuing to incubate at room temperature for 15-20 minutes to perform a ligation reaction, so that the non-closed circular single-stranded DNA probe is connected end to end to form the closed circular single-stranded DNA probe; (6) removing the supernatant from the resuspension treated in step (5) by magnetic separation, and rinsing with DPBS-T solution several times to remove the T4 ligase and the non-closed circular single-stranded DNA probe that is not bound to the nucleic acid aptamer on the surface of the magnetic microsphere in the resuspension, terminating the ligation reaction, and obtaining the aptamer sensor; The DPBS-T solution is prepared by adding MgSO4 to the PBS-T solution, and the concentration of MgSO4 is 2 mM.

4. The method for preparing an aptamer sensor for detecting Alzheimer's disease-related markers according to claim 3, characterized in that: In step (1), the concentration of the magnetic microspheres in the magnetic microsphere suspension is 1 mg / mL; In step (2), the final concentration of the nucleic acid aptamer in the system is in the range of 50-500 nM; In step (4), the final concentration of the non-closed circular single-stranded DNA probe in the system is in the range of 50-500 nM; and the concentration of the magnetic microsphere-nucleic acid aptamer complex in the resuspension is 1 mg / mL.

5. The method for preparing an aptamer sensor for detecting Alzheimer's disease-related markers according to claim 3, characterized in that: In step (5), the final concentration of the T4 ligase in the system is 20 U / μL.

6. The method for preparing an aptamer sensor for detecting Alzheimer's disease-related markers according to claim 3, characterized in that: The following steps are also included: (7) Resuspend the aptamer sensor in the DPBS-T solution to prepare a 2 mg / ml aptamer sensor suspension, and store it at 4°C.

7. A kit for detecting Alzheimer's disease-related markers, characterized in that: The kit includes highly branched rolling circle amplification primers and the aptamer sensor for detecting Alzheimer's disease-related markers according to any one of claims 1 to 2; the highly branched rolling circle amplification primers are divided into P1 primers and P2 primers; When the nucleic acid aptamer of the aptamer sensor is the Aβ42 aptamer, the sequence of the P1 primer is shown in SEQ ID NO. 5, and the sequence of the P2 primer is shown in SEQ ID NO. 6; When the nucleic acid aptamer of the aptamer sensor is the Aβ40 aptamer, the sequence of the P1 primer is shown as SEQ ID NO.9, and the sequence of the P2 primer is shown as SEQ ID NO.

10.

8. The kit for detecting Alzheimer's disease-related markers according to claim 7, characterized in that: The kit comprises two aptamer sensors; The nucleic acid aptamer of the first aptamer sensor is the Aβ42 aptamer, the sequence of the Aβ42 aptamer is shown in SEQ ID NO.3, and the sequence of the closed circular single-stranded DNA probe is shown in SEQ ID NO.4; The nucleic acid aptamer of the second aptamer sensor is the Aβ40 aptamer, the sequence of the Aβ40 aptamer is shown in SEQ ID NO.7, and the sequence of the closed circular single-stranded DNA probe is shown in SEQ ID NO.

8.

9. The kit for detecting Alzheimer's disease-related markers according to claim 8, characterized in that: The kit contains two highly branched rolling circle amplification primers; In the first type of highly branched rolling circle amplification primers, the sequence of the P1 primer is shown in SEQ ID NO.5, and the sequence of the P2 primer is shown in SEQ ID NO.6; In the second type of highly branched rolling circle amplification primers, the sequence of the P1 primer is shown as SEQ ID NO.9, and the sequence of the P2 primer is shown as SEQ ID NO.

10.

10. The kit for detecting Alzheimer's disease-related markers according to claim 7, characterized in that: The aptamer sensor is configured as an aptamer sensor suspension with a concentration of 2 mg / ml.

Images