Method for identifying aquilaria agallocha and aquilaria sinensis by using KASII gene

Abstract

The invention discloses a method for identifying aquilaria agallocha and aquilaria sinensis by using a KASII gene. The agilawood and the aquilaria sinensis are identified on the basis that the KASII genotype of the agilawood is TT and the KASII genotype of the aquilaria sinensis is AA. 20 # basic groups of KASII gene coding regions of aquilaria sinensis and aquilaria sinensis are taken as target sites, a PCR (Polymerase Chain Reaction) and Sanger sequencing method is adopted, a PCR amplification product of the KASII gene is subjected to Sanger sequencing, if the genotype of the KASII is TT, the product is the aquilaria sinensis, and if the genotype of the KASII is AA, the product is the aquilaria sinensis. According to the method for identifying the agilawood agilawood and the aquilaria sinensis through the KASII gene, high-throughput sequencing is carried out on the agilawood agilawood and the aquilaria sinensis, genotype detection analysis is carried out in a whole genome range, and it is found that the KASII gene has significant difference between the agilawood agilawood and the aquilaria sinensis, and the gene function is clear. The method is used for identifying the germplasm of the agilawood agilawood and the aquilaria sinensis by utilizing the genotype difference of the agilawood agilawood and the aquilaria sinensis and adopting PCR amplification and Sanger sequencing methods

Description

Technical Field

[0001] The invention relates to the field of gene detection, and in particular to a method for using a KASII gene to identify agarwood and white agarwood. Background Art

[0002] According to the component detection of agarwood from China, it was found that its main components are 2-[2-(4-methoxy)phenethyl]chromone and 2-(2-phenethyl)chromone. These two components are the main components of wild agarwood under the current standards, and they play an important role in the fine grading of agarwood quality. Ordinary white wood fragrance does not produce as much agarwood as this "agarwood" germplasm, nor does it produce agarwood as quickly as this "agarwood" germplasm, and it does not contain 2-[2-(4-methoxy)phenethyl]chromone and 2-(2-phenethyl)chromone or the content is very small. However, the content of 5,6,7,8-tetrahydro-2-(-phenethyl)chromone (agarwood tetraol) in the agarwood produced by ordinary white wood fragrance is higher than that produced by these agarwood-producing cultivations. According to the "Chinese Pharmacopoeia" promulgated in 2020, agarwood tetraol is the main effective component of agarwood used as medicine.

[0003] In terms of chemical composition, many studies have found that agarwood is rich in 2-[2-(4-methoxy)phenethyl]chromone and 2-(2-phenethyl)chromone. Based on this, the Hainan Provincial Local Standard in 2017 and the National Forestry and Grassland Administration Industry Standard in 2020 combined the ethanol extract content with the total content of 2-(2-phenethyl)chromone and 2-[2-(4-methoxy)phenethyl]chromone to classify agarwood into five grades: special grade, first grade, second grade, third grade, and fourth grade. At present, evaluating the grade of agarwood by these two characteristic components has gradually become a trend in agarwood quality research.

[0004] Studies have shown that the chemical components of agarwood mainly include sesquiterpenoids, 2-(2-phenylethyl) chromone derivatives and aromatic compounds. 2-(2-phenylethyl) chromone derivatives are one of the main components of agarwood, which can be divided into four types according to the skeleton type, namely 5,6,7,8-tetrahydro-2-(2-phenylethyl) chromone, 5,6,7,8-diepoxy-2-(2-phenylethyl) chromone, 2-(2-phenylethyl) chromone, and 5,6-epoxy-2-(2-phenylethyl) chromone. The chromone components in agarwood are not only indicators for evaluating the quality of agarwood, but also closely related to the medicinal value and aroma of agarwood.

[0005] Although there are literatures related to the genome of agarwood, there are no literatures or related technical patents on the differences between agarwood and common white wood at the genome level. It is not clear whether there are genetic differences between agarwood and white wood, and whether the differences in the genotypes of specific related functional genes lead to differences in the final agarwood components. Summary of the invention

[0006] The purpose of the present invention is to overcome the deficiencies of the above-mentioned prior art and provide a method for using the KASII gene to identify agarwood and white agarwood. Specific development process:

[0007] 1. Extraction of Agarwood Genomic DNA

[0008] Table 1 Agarwood whole genome sequencing materials

[0009]

[0010] The agarwood sample materials shown in Table 1 were selected for whole genome sequencing. The agarwood genome was extracted using the polysaccharide and polyphenol kit method of Tiangen Biotechnology Co., Ltd. The specific experimental process is as follows:

[0011] Step 1) Take 100 mg of fresh agarwood leaves and place them in a pre-sterilized and dried mortar, add an appropriate amount of liquid nitrogen and grind them into powder.

[0012] Step 2) Transfer the ground powder to a 1.5 mL sterile centrifuge tube, quickly add 400 μL of buffer GPS, then add 10 μL of RNase, vortex to mix, and then place the centrifuge tube in a constant temperature metal bath at 65° C. for 15 min. During the constant temperature heating process, invert the centrifuge tube every five minutes to allow the sample to fully dissolve.

[0013] Step 3) Add 100 μL of buffer GPA to the centrifuge tube, vortex for 1 minute, and then centrifuge at 12,000 rpm for 5 minutes. Place the filter column CS in the collection tube in advance, transfer the supernatant obtained by centrifugation to the filter column CS, and then centrifuge at 12,000 rpm for 1 minute, and transfer the filtrate in the collection tube to a new centrifuge tube. If the viscosity of the filtrate is high at this time, add an appropriate amount of buffer GPA, vortex to mix, place the centrifuge tube on ice for 5 minutes, and then centrifuge again.

[0014] Step 4) Add anhydrous ethanol in an equal volume to the filtrate and mix thoroughly.

[0015] Step 5) Place the adsorption column CR2 in the collection tube in advance, transfer the mixed solution and the generated flocs to the RNase-Free adsorption column CR2, centrifuge at 12,000 rpm for 1 min, pour off the filtrate, and put the RNase-Free adsorption column CR2 back into the collection tube.

[0016] Step 6) Add anhydrous ethanol to the protein solution RD according to the recommended amount on the packaging box, then aspirate 550 μL of the deproteinized solution RD and add it to the RNase-Free adsorption column CR2. Centrifuge at 12,000 rpm for 1 min, pour off the filtrate, and put the RNase-Free adsorption column CR2 back into the collection tube.

[0017] Step 7) Add anhydrous ethanol to the rinse solution PW according to the recommended amount on the packaging box, then pipette 700 μL of rinse solution PW into the RNase-Free adsorption column CR2, centrifuge at 12,000 rpm for 1 min, discard the filtrate, and return the RNase-Free adsorption column CR2 to the collection tube. Repeat this step twice.

[0018] Step 8) Centrifuge at 12,000 rpm for 2 min, discard the collection tube, and then transfer the RNase-Free adsorption column CR2 to a new centrifuge tube and dry it at room temperature for 5-10 min.

[0019] Step 9) Pipette 50-100 μL of elution buffer TB and add it to the RNase-Free adsorption column CR2, place it at room temperature for 5 minutes, and centrifuge it at 12,000 rpm for 2 minutes. The solution obtained in the centrifuge tube is the agarwood genomic DNA.

[0020] Step 10) Store the successfully extracted DNA in a -20°C refrigerator to prevent degradation.

[0021] 2. Quality determination of agarwood genomic DNA

[0022] The quality of the extracted agarwood genomic DNA was tested by 1% agarose gel electrophoresis, and the electrophoresis band images were collected by Bio RAD Gel DocXR gel image acquisition and analysis instrument. The concentration and purity of the extracted DNA were tested by Thermo SCIENTIFIC NanoDrop 1000 nucleic acid analyzer.

[0023] 3. DNA library construction and high-throughput sequencing

[0024] After the samples were tested, they were constructed into a double-end sequencing library with an insert size of 350 bp according to the standard Illumina DNA library construction process. After the library was constructed, the quality control was performed by qPCR method and Agilent 2100 Bioanalyzer. The DNA library that passed the quality inspection was sequenced using the Illumina Novaseq 6000 high-throughput sequencing platform, and the sequencing strategy was double-end 150 bp sequencing.

[0025] 4. Sequence alignment and SNP detection

[0026] Sequence alignment was performed using bwa software and a double-end alignment strategy. Sequencing data were aligned to the published Aquilaria genome (NCBI accession number: GCA_005392925.1). Deepvariant software was used for SNP detection.

[0027] 5. Hp and Fst analysis and selection of coding gene loci

[0028] Hp and Fst analysis, Hp represents pooled heterozygosity score:

[0029] (Carl-Johan Rubin et al. 2010), where MAJ Table

[0030] shows the sum of the maximum genotypes in the observation window, corresponding to MIN represents the sum of the minimum genotype. The range of Hp is 0 to 0.5. When Hp is equal to 0.5, it means MAJ and When MIN is equal, it means that the two genotypes in the population are equal, and when the Hp value is equal to 0, it means that there is only one genotype.

[0031] Fst (fixed coefficient) was calculated using the R language software package hierfstat (version: 0.5-11). The Fst value ranges from 0 to 1, where 0 means that the genotype is not fixed at all and the base ratios in different populations are the same (corresponding to Hp of each population being equal to 0.5). Fst value equal to 1 means that the genotypes of the two populations are completely different (corresponding to Hp of each population being equal to 0, and the genotypes of the two populations are different).

[0032] Therefore, the SNP sites with Hp value equal to 0 in the Aquilaria sinensis population and Hp value equal to 0 in the Aquilaria sinensis population and corresponding Fst value of 1 were selected as target sites, as shown in Table 2, and the gene function annotations of the SNP sites are shown in Table 3.

[0033] Table 2 Statistics of Hp and Fst values ​​of SNP sites

[0034]

[0035] Table 3 SNP site gene function annotation

[0036]

[0037] Comparison of KASII gene differences between Aquilaria sinensis and Kynam Figure 1 shown.

[0038] Based on the above development results, the present invention provides a method for using KASII gene to identify agarwood and white agarwood, specifically:

[0039] The identification of Aquilaria sinensis and Aquilaria sinensis was based on the KASII genotype of Aquilaria sinensis being TT and the KASII genotype of Aquilaria sinensis being AA.

[0040] Furthermore, the method is: taking the 20th base of the KASII gene coding region of agarwood and white agarwood as the target site, using PCR and Sanger sequencing methods, and performing Sanger sequencing on the KASII gene PCR amplification product. If the KASII genotype is TT, it is agarwood, and if the KASII genotype is AA, it is white agarwood.

[0041] Further, the primers used for PCR amplification of the KASII gene were identified as Pri-F and Pri-R, with primer lengths of 20 bp and 19 bp respectively, an amplification length of 490 bp, sequences of CCGCTCGTTTGGTGATTC and TGCTTTCGCAATAGTTAGTC, and an annealing temperature of 60°C.

[0042] Furthermore, the identification method is used for the germplasm identification of Aquilaria sinensis.

[0043] The invention has the beneficial effects that the KASII gene of the invention is used in the method for identifying agarwood and white agarwood. By high-throughput sequencing of agarwood and white agarwood, genotype detection and analysis are performed in the whole genome, and it is found that the KASII gene has significant differences between agarwood and white agarwood, and the gene function is relatively clear. The difference in genotype between the two is utilized, and the PCR amplification and Sanger sequencing method is adopted to identify the germplasm of agarwood and white agarwood. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Figure 1 This is a comparison diagram of the differences between Aquilaria sinensis and Kynam of the present invention's KASII gene;

[0045] Figure 2 is the electrophoresis diagram of the PCR product of the present invention;

[0046] Figure 3 It is a peak diagram result display diagram of the SNP site of the present invention. DETAILED DESCRIPTION

[0047] The present invention is further described in detail below in conjunction with the examples. A method for using KASII gene to identify agarwood and white agarwood is specifically implemented as follows:

[0048] 1) List of primers for PCR and sequencing experiments. The primers are shown in Table 4.

[0049] Table 4 Primer list

[0050]

[0051] 2) PCR amplification

[0052] Reagents and consumables: DNA polymerase: 2*Taq MasterMix (Dye) (purchased from Jiangsu Kangwei Century Technology Co., Ltd., catalog number: CW0682L); Primer; RNase free water.

[0053] 3) PCR reaction system, as shown in Table 5.

[0054] Table 5 PCR reaction system

[0055]

[0056] 4) PCR reaction conditions are shown in Table 6.

[0057]

[0058] 5) PCR product detection.

[0059] Glue concentration: 1.1% glue concentration, 160V voltage, 30min time.

[0060] Marker: M stands for DM2000, purchased from Jiangsu Kangwei Century Biotechnology Co., Ltd., catalog number CW0632M.

[0061] DM2000 DNA Marker consists of 6 DNA fragments, namely 2,000bp, 1,000bp, 750bp, 500bp, 250bp and 100bp. Take 3μL and perform direct electrophoresis. During electrophoresis, the amount of the 750bp DNA fragment is about 90ng, showing a bright band, and the amount of DNA in other bands is about 30ng. The electrophoresis diagram of PCR products is shown in Figure 1. Figure 2 shown.

[0062] 6) Sanger sequencing.

[0063] The KASII gene PCR amplification product was subjected to Sanger sequencing, and the KASII genotype of Aquilaria sinensis was TT, and the KASII genotype of Aquilaria sinensis was AA. The sequencing results are shown in Table 7.

[0064] Table 7 SNP site genotype statistics

[0065]

[0066] The peak plot results of the SNP site are shown as follows Figure 3 shown.

[0067] The above contents are only used to illustrate the technical solution of the present invention. Simple modifications or equivalent substitutions of the technical solution of the present invention made by ordinary technicians in this field do not deviate from the essence and scope of the technical solution of the present invention.

Claims

1. A method for using KASII gene to identify agarwood and white agarwood, characterized in that: The identification of Aquilaria sinensis and Aquilaria sinensis was based on the KASII genotype of Aquilaria sinensis being TT and the KASII genotype of Aquilaria sinensis being AA.

2. The identification method according to claim 1, characterized in that: The method comprises the following steps: taking base 20 of the KASII gene coding region of agarwood and white agarwood as the target site, adopting PCR and Sanger sequencing methods, and performing Sanger sequencing on the PCR amplification product of the KASII gene. If the KASII genotype is TT, it is agarwood, and if the KASII genotype is AA, it is white agarwood.

3. The identification method according to claim 2, characterized in that: The primers used for PCR amplification of the KASII gene were named Pri-F and Pri-R, with primer lengths of 20 bp and 19 bp respectively, an amplification length of 490 bp, sequences of CCGCTCGTTTGGTGATTC and TGCTTTCGCAATAGTTAGTC, and an annealing temperature of 60°C.

4. The identification method according to claim 1 is used for the identification of germplasm of Aquilaria sinensis.

Images