Molecular marker linked with female fertility of cucumber and application of molecular marker

Abstract

The invention provides a molecular marker linked with female fertility of cucumber and application of the molecular marker. The molecular marker is T-to-C mutation occurring at the 23568336bp position on a chromosome 6 of a cucumber genome. The molecular marker disclosed by the invention can be directly used for identifying the female fertility and the corresponding genotype of the cucumber, so that auxiliary breeding is carried out by depending on the molecular marker, a target plant can be quickly screened by utilizing the molecular marker in an early stage, the planting scale is effectively reduced, the workload of later identification is reduced, and the selection efficiency is improved.

Description

Technical Field

[0001] The invention belongs to the field of cucumber breeding molecular biology, and in particular relates to a molecular marker linked to cucumber female fertility and its application. Background Art

[0002] Sexual reproduction is the main mode of reproduction of higher plants and an important topic in botanical research. Usually, reproductive cells are produced by the parents, and through the combination of male and female reproductive cells, they become fertilized eggs, which develop into seeds and then develop into new individuals. In nature, it is often found that due to abnormal development of female organs of plants (such as ovules, embryo sacs, and egg cells), plants cannot be pollinated and fruited normally. This phenomenon is called female sterility. Female sterility-related materials have been found in plants such as Arabidopsis (Balasubramanian and Schneitz, 2002; Pagnussat, et al., 2005), rice (Ling Dinghou et al., 1991), wheat (Xu Haifeng, 2009), and rapeseed (Chen Xinjun et al., 2003). Cucumber is an important vegetable, and researchers have found multiple materials with abnormal female fertility. Zhang et al. (1980) reported a cucumber material ap with abnormal flower development. The corolla of this material had no stamens and pistils, and the anthers were sepal flowers. This was an early report on the study of cucumber fertility. In addition, researchers have found reports of female sterility or low fertility during tissue culture and chromosome doubling. The female sterility was caused by abnormal chromosome ploidy or abnormal chromosome number (Zhang Xiaoqing, 2007; Diao Weiping, 2008; Guan Wei, 2014). Chen Jianjun (2004) studied the white cucumber with seed abortion and showed that abnormal pollen and embryo sac development was the cause of seed abortion in white cucumber. Recently, researchers discovered a "mangofruit" cucumber mutant with reduced fertility as a test material. The flower organs of this material had abnormal numbers of seeds that were small and not full. Positional cloning and gene function studies showed that the CsWOX1 gene could affect the expression of the CsSPL gene, thereby reducing the fertility of the cucumber. Further studies on the function of the CsSPL gene showed that it plays an important role in maintaining the fertility and seed quality of cucumbers (Liu et al, 2018; Niu et al, 2018).

[0003] The present invention uses the discovered female sterile mutant material as the test material, and through population construction, gene positioning and other studies, finely locates the female sterile candidate gene, and develops molecular markers closely linked to female fertility, laying an important foundation for the cloning of female sterile genes and the application of molecular marker-assisted female fertility breeding, and has important theoretical and application value. Summary of the invention

[0004] In view of this, the present invention aims to overcome the defects in the prior art and propose a molecular marker linked to the female fertility of cucumber and its application, so as to provide a new approach for the prediction, identification and auxiliary screening of female fertile cucumber materials, as well as breeding.

[0005] To achieve the above object, the technical solution of the present invention is achieved as follows:

[0006] In a first aspect, the present invention provides a molecular marker linked to a cucumber female fertility regulating gene, which is a T to C mutation occurring at position 23568336 bp on chromosome 6 of the cucumber genome.

[0007] Preferably, the genotypes corresponding to the molecular markers are: T:T is a wild genotype with female fertility, T:C is a wild genotype with female fertility, and C:C is a mutant genotype with female sterility.

[0008] In a second aspect, the present invention also provides a primer set for regulating mutation of female fertility of cucumber, the sequence of the primer set is:

[0009] The forward primers are shown in SEQ ID No.1 and SEQ ID No.2, and the reverse primer is shown in SEQ ID No.3:

[0010] SEQ ID No.1:

[0011] K23568336F-1: GAAGGTGACCAAGTTCATGCTTTCAAACAT ATTTGAAATTGTAAAATTGAATAC;

[0012] SEQ ID No.2:

[0013] K23568336F-2: GAAGGTCGGAGTCAACGGATTTCAAACATA TTTGAAATTGTAAAATTGAATAT;

[0014] SEQ ID No.3:

[0015] K23568336C: AAATATGGCAGCTCATAATGCTTTTGAAATT AAT.

[0016] Preferably, the 5' ends of the two primers K23568336F-1 and K23568336F-2 are connected to different fluorescent linker sequences. Further preferably, the fluorescent linker is a FAM linker or a HEX linker, and the sequence of the FAM linker is: GAAGGTGACCAAGTTCAT GCT; the sequence of the HEX linker is: GAAGGTCGGAGTCAACGGATT.

[0017] In a third aspect, the present invention also provides the use of the above-mentioned molecular markers linked to the cucumber female fertility regulating gene for identifying and / or assisting in screening cucumber female fertility.

[0018] In a fourth aspect, the present invention also provides the use of the above-mentioned molecular markers linked to the cucumber female fertility regulating gene in cucumber female fertility breeding.

[0019] In a fifth aspect, the present invention also provides a method for detecting female fertility of cucumber using the above molecular markers, comprising the following steps:

[0020] (1) Using the genomic DNA of the sample to be tested as a template, PCR amplification is performed using molecularly labeled amplification primers to obtain an amplification product;

[0021] (2) Detect and analyze the amplified products.

[0022] Preferably, when the amplified product is subjected to fluorescence detection, if it is a T:T genotype, it is determined to be a female fertile wild plant; if it is a homozygous C:C genotype, it is determined to be a female sterile mutant plant; if it is a heterozygous T:C genotype, it is determined to be a female fertile wild plant.

[0023] Preferably, touchdown PCR is used in step (1); the touchdown PCR amplification program is: 94°C for 15 min; 95°C for 20 s; 65°C-56°C for 60 s, 10 cycles, with the annealing extension temperature decreasing by 0.8°C in each cycle; 94°C for 20 s; 57°C for 60 s, 26 cycles.

[0024] Compared with the prior art, the present invention has the following advantages:

[0025] The present invention uses the method of BSA positioning and KASP typing to locate a regulatory site that controls the female fertility of cucumber, and develops a KASP molecular marker associated with the female fertility regulatory gene of cucumber based on the mutation site. It can be directly used for the identification of female fertility of cucumber and the corresponding genotype, and then the molecular marker is relied on for auxiliary breeding. By using the molecular marker in the early stage, the target plant can be quickly screened, the planting scale is effectively reduced, the workload of later identification is reduced, and the selection efficiency is improved. Therefore, the present invention is of great significance in studying the cloning of female fertility genes of cucumber and breeding applications. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1Phenotypic comparison between wild type 10Y and mutant 10ym, ad, TTC staining (a, b) to detect pollen viability of wild type 10Y and mutant 10ym and pollen tube germination experiment (c, d) to detect pollen tube elongation ability of wild type 10Y and mutant 10ym, scale bar is 100μm; e, f are the fruits after mutual hybridization or self-pollination between wild type 10Y and mutant 10ym, scale bar is 5cm; g is the longitudinal section of the fruit 40 days after pollination, the red dotted line part represents seeds, scale bar is 5cm.

[0027] Figure 2 This is the location map of the female sterility gene in cucumber, where A: BSA mixed pool sequencing SNP polymorphism analysis; B: KASP marker screening and location analysis (K1 to K10 are KASP markers). DETAILED DESCRIPTION

[0028] Unless otherwise defined, the technical terms used in the following examples have the same meanings as those generally understood by those skilled in the art to which the present invention belongs. The test reagents used in the following examples, unless otherwise specified, are all conventional biochemical reagents; the experimental methods, unless otherwise specified, are all conventional methods.

[0029] The present invention will be described in detail below with reference to the embodiments.

[0030] Example Obtaining molecular markers linked to cucumber female fertility regulating genes

[0031] 1. Phenotype and inheritance of female sterile mutant materials

[0032] 1. Phenotype of female sterile cucumber mutant

[0033] Cucumber is a typical unisexual plant. After pollination, female flowers will form seeds and females are fertile. The project team found a natural female sterile mutant material in the high-generation inbred line 10Y with normal female fertility, named 10ym. TTC was used to test the pollen viability and pollen tube germination of the wild type and mutant, and there was no significant difference between the two materials ( Figure 1 a- Figure 1 d). When wild-type 10Y and mutant 10ym were cross-pollinated, it was found that when mutant 10ym was the male parent and wild-type 10Y was the female parent, that is, when mutant 10ym male pollen was pollinated on wild-type 10Y female flowers, the fruit swelled and seeds were successfully obtained, which was similar to the result of self-pollination of wild-type 10Y. However, when wild-type 10Y male pollen was used to pollinate mutant 10ym female flowers or 10ym was self-pollinated, the fruit swelled but could not form seeds ( Figure 1 e- Figure 1 g). Therefore, compared with the wild type 10Y, the mutant 10ym has a female sterile phenotype.

[0034] 2. Genetic laws of female infertility

[0035] The mutant 10ym was used as the male parent, and the distant female fertile wild type 1-5 (distantly related to 10Y) was used as the female parent. Six generations of segregation populations were constructed, and phenotypic investigations were performed. The phenotypic investigations showed that the F1 plants were female fertile, and in the F2 segregation population of 116 individual plants, 86 plants were female fertile and 30 plants were female sterile; in the population where the female fertile material was the backcross parent, all were female fertile; in the population where the female sterile material was the backcross parent, 46 plants were female fertile and 42 plants were female sterile. This indicated that the female sterility of the mutant was a recessive inheritance controlled by a single gene.

[0036] Table 1 Statistics of genetic laws of female infertility

[0037]

[0038] 2. Localization of female sterility genes

[0039] 1. Group Construction

[0040] The female sterile mutant 10ym was used as the male parent, and the female fertile wild type 1-5 (distantly related to 10Y) was used as the female parent. The mutant 10ym was hybridized with the wild type 1-5 to obtain F1, and the F1 was self-pollinated to obtain the F2 segregating population.

[0041] 2. BSA-seq preliminary positioning of female sterility genes

[0042] From the F2 population, 20 female fertile (dominant) and 20 female sterile (recessive) plants were randomly selected to extract their genomic DNA, and equal amounts of DNA were mixed to construct dominant and recessive pools, respectively. Whole-genome resequencing was performed on the dominant and recessive pools, as well as the mutants 10ym and wild types 1-5, using the Illumina Hiseq2500 sequencing platform. The reads were aligned to the cucumber reference genome using the bwa software, and the bcftools software was used to find SNP sites in the whole genome. Then, the SNP sites that were homozygous and different between the offspring and the parents were screened out, and the SNP-index values ​​of the dominant pool and the recessive pool were calculated. The SNP-index values ​​of the recessive pool and the dominant pool were subtracted to obtain the △SNP-index value. We found that the 5Mb region on chromosome 6 was significantly higher than the domain value and was a candidate region for the female sterility gene ( Figure 2 A).

[0043] 3. Fine positioning of genes regulating female sterility and development of molecular markers

[0044] Based on the variation information of the candidate region, 10 pairs of KASP markers were developed (primer sequences are shown in Table 2). The positioning interval of the female sterility gene was further narrowed by the KASP markers (primer sequences are shown in Table 2). The KASP markers were applied to individual plants in the F2 population. Different primers were labeled with different fluorescent markers, and different fluorescence was emitted after PCR extension. The genotype was determined based on the fluorescence value. Using 200 recessive plants in the F2 population, combined with the KASP genotyping results, the female sterility candidate gene was located in the 378.6kb region between molecular markers K4 and K6. The base genotype at position 23568336 in this region was 100% consistent with the female fertility phenotype ( Figure 2 B). When the bases at position 23568336 are T:T, it indicates female fertility; when they are T:C, it indicates female fertility; when they are C:C, it indicates female sterility. Based on the results, a SNP marker K5 was developed at this position for the detection of female fertility of F2 plants, and the genotype and phenotype were completely consistent (primer sequences are shown in Table 2).

[0045] Table 2 KASP detection marker primer sequences

[0046]

[0047]

[0048] When molecular markers are used, the following steps are specifically included: (1) using the genomic DNA of the sample to be tested as a template, using the amplification primers of the molecular markers to perform touchdown PCR amplification to obtain an amplification product; (2) detecting and analyzing the amplification product.

[0049]

[0050]

[0051] When the amplified product is subjected to fluorescence detection, if the sample PCR product only detects the fluorescence signal corresponding to primer K23568336F-1, the detection site is T:T genotype, and it is determined to be a cucumber female fertile phenotype plant; if the sample PCR product only detects the fluorescence signal corresponding to primer K23568336F-2, the detection site is C:C genotype, and it is determined to be a cucumber female sterile phenotype plant; if both fluorescence signals are detected at the same time, the detection site is T:C genotype, and it is determined to be a cucumber female fertile phenotype plant.

[0052] When molecular markers were applied, Touchdown PCR was used, and the amplification program was: 94°C for 15 min; 95°C for 20 s; 65°C-56°C for 60 s, for 10 cycles, with the annealing extension temperature decreasing by 0.8°C in each cycle; 94°C for 20 s; 57°C for 60 s, for 26 cycles.

[0053] The sample to be tested is a leaf.

[0054] Table 3 Female fertility phenotypes and genotypes of some individual plants in the parental 1-5, 10 μm, F1 and constructed F2 populations of K5 marker

[0055]

[0056]

[0057]

[0058] The above identification results show that by retaining the material with the C:C fluorescent signal corresponding to primer K5 detected through molecular marker identification and screening in breeding, female sterile cucumber materials can be bred. By retaining the material with the T:T fluorescent signal corresponding to primer K5 detected, female fertile homozygous materials can be bred. By retaining the material with the T:C fluorescent signal detected, female fertile heterozygous materials can be bred. The screening of molecular markers in the early stage can reduce the workload of later screening and identification, and accelerate the breeding process.

[0059] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A molecular marker linked to a cucumber female fertility regulating gene, characterized in that: The molecular marker is a mutation from T to C occurring at the 23568336 bp position on chromosome 6 of the cucumber genome.

2. The molecular marker according to claim 1, characterized in that: The genotypes corresponding to the molecular markers are: T:T is a wild genotype with female fertility, T:C is a wild genotype with female fertility, and C:C is a mutant genotype with female sterility.

3. A primer set for regulating mutation of female fertility in cucumber, characterized in that: The primer set sequences are: the forward primers are shown in SEQ ID No.1 and SEQ ID No.2, and the reverse primer is shown in SEQ ID No.3: SEQ ID No.1: K23568336F-1: GAAGGTGACCAAGTTCATGCTTTCAAACAT ATTTGAAATTGTAAAATTGAATAC; SEQ ID No.2: K23568336F-2: GAAGGTCGGAGTCAACGGATTTCAAACATA TTTGAAATTGTAAAATTGAATAT; SEQ ID No.3: K23568336C: AAATATGGCAGCTCATAATGCTTTTGAAATT AAT.

4. The cucumber female fertility regulating mutation primer set according to claim 3, characterized in that: The 5' ends of the two primers K23568336F-1 and K23568336F-2 were connected to different fluorescent linker sequences respectively.

5. The cucumber female fertility regulating mutation primer set according to claim 4, characterized in that: The fluorescent linker is a FAM linker or a HEX linker. The sequence of the FAM linker is: GAAGGTGACCAAGTTCATGCT; the sequence of the HEX linker is: GAAGGTCGGAGTCAACGGATT.

6. Use of the molecular marker linked to the cucumber female fertility regulating gene as claimed in claim 1 or 2 for identifying and / or assisting in screening cucumber female fertility.

7. Use of the molecular marker linked to the cucumber female fertility regulating gene as claimed in claim 1 or 2 in cucumber female fertility breeding.

8. A method for detecting female fertility of cucumber using the molecular markers of claim 1 or 2, characterized in that: The steps include: (1) Using the genomic DNA of the sample to be tested as a template, PCR amplification is performed using molecularly labeled amplification primers to obtain an amplification product; (2) Detect and analyze the amplified products.

9. The detection method according to claim 8, characterized in that: When the amplified product is subjected to fluorescence detection, if it is a T:T genotype, it is determined to be a female fertile wild plant; if it is a homozygous C:C genotype, it is determined to be a female sterile mutant plant; if it is a heterozygous T:C genotype, it is determined to be a female fertile wild plant.

10. The detection method according to claim 8, characterized in that: Touchdown PCR is used in step (1); the Touchdown PCR amplification program is: 94° C. for 15 min; 95℃20s; 65℃-56℃60s, 10 cycles, annealing extension temperature decreased by 0.8℃ in each cycle; 94℃20s; 57℃60s, 26 cycles.

Images