KASP molecular marker closely linked with pepper leaf curl, primer, kit and application
By developing a KASP molecular marker at chromosome 130757030 on pepper chromosome 9, the phenotypic selection difficulty of pepper leaf curling trait was solved, enabling rapid and accurate identification of pepper leaf traits, improving breeding efficiency and material purity, and making it suitable for efficient molecular breeding of pepper leaf type traits.
Patent Information
- Application Number
- CN202610276564.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-09
- Publication Date
- 2026-04-03
- Estimated Expiration
- 2046-03-09
AI Technical Summary
Traditional breeding methods for selecting the phenotypic trait of leaf curling in peppers are difficult and inefficient, and cannot be accurately identified in the early seedling stage, resulting in low efficiency of genetic improvement and a lack of efficient molecular marker-assisted selection technology.
We developed a KASP molecular marker closely linked to pepper leaf curling. Primers were designed using the SNP site at 130757030 on chromosome 9 of pepper (Zhangshugang version of the genome). Accurate association between genotype and phenotype was achieved through PARMS PCR amplification and fluorescence signal scanning. A KASP molecular marker kit was provided for the identification of pepper leaf types.
It enables rapid and accurate screening of pepper leaf curling traits under any environment, improving breeding selection efficiency and accuracy, reducing the breeding cycle, and ensuring the purity and selection efficiency of breeding materials.
Smart Images

Figure CN121780768A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of chili pepper breeding, and in particular relates to a KASP molecular marker, primers, kits and applications that are closely linked to chili pepper leaf curling. Background Technology
[0002] Chili peppers are an important vegetable and economic crop, with their yield and quality closely related. As the main organ for photosynthesis, the morphology and structure of leaves directly affect light capture efficiency, canopy ventilation and light penetration, and water transpiration, thus determining the final yield and stress resistance. Among these traits, leaf flatness (whether it is curled or not) is a key agronomic characteristic: moderately curled leaves help to create an upright plant shape, increase planting density, enhance field ventilation, reduce the likelihood of disease, and improve water use efficiency by reducing transpiration under drought conditions. Therefore, precisely selecting chili pepper varieties with ideal leaf shapes (flat or curled) according to the needs of different ecological zones and cultivation models is one of the important goals of modern chili pepper breeding.
[0003] However, leaf curling is usually a quantitative trait or controlled by multiple genes, and is easily affected by environmental factors (such as light, water, and temperature). In traditional breeding, selection mainly relies on field phenotypic observation. This method has significant drawbacks, such as long cycle, low efficiency, great dependence on season and climate, and inability to accurately identify in the early seedling stage, which seriously restricts the efficiency of genetic improvement of this trait.
[0004] Molecular marker-assisted selection (MART) technology, by detecting DNA markers closely linked to target traits, enables rapid, accurate, and non-destructive selection of target genotypes at any stage of crop growth (especially the seedling stage) and under any environment. This significantly shortens the breeding cycle and improves selection efficiency and accuracy. Among these technologies, KASP (Kinetic Spectroradioselective Availability) technology has become the mainstream genotyping platform in crop molecular breeding due to its high throughput, low cost, high precision, and ease of automation. However, in peppers, research on molecular markers for the specific trait of leaf curling / flattening that can be used for efficient genotyping remains very limited.
[0005] Therefore, addressing the industry pain points of phenotypic selection difficulties and low efficiency in breeding pepper leaf curling traits, as well as the technological gap of lacking practical and efficient molecular markers, there is an urgent need to develop a KASP molecular marker and its supporting technologies that are closely linked to pepper leaf curling traits, are stable and reliable, and suitable for high-throughput detection. The development of such markers will provide a key tool for achieving precise and efficient molecular breeding of pepper leaf curling traits, possessing significant theoretical value and application prospects. Summary of the Invention
[0006] The technical problem to be solved by the present invention is to overcome the shortcomings of the prior art and provide a KASP molecular marker, primer, kit and application that is closely linked to the curling of pepper leaves.
[0007] To solve the above-mentioned technical problems, the technical solution proposed by this invention is as follows:
[0008] A KASP molecular marker closely linked to pepper leaf curling, using the Zhangshugang version of the genome (https: / / ted.bti.cornell.edu / ftp / pepper / genome / Zhangshugang / ) as a reference genome, exhibits a single nucleotide polymorphism (SNP) with an A-to-G substitution at position 130757030 on chromosome 9 of pepper. Its nucleotide sequence is shown in SEQ ID NO:1. TGCATTGTACAAGGAACTCTGCATGCCTGTGTTGGTCCTCTTGTAACAGTTCCTCATGAAGGGGGAAAGAGTTTACTATTTCCCACAGGGTCATATGGAACTGCATTGTACAAGGAACTCTGCATGCCTGTGTTGGTCCTCTTGTAACAGTTCCTCATGAAGGGGAAAGAGTTTACTATTTCCCACAGGGTCATATGGAAC[A / G]GGTATCTTTTGATTTACATTTTCTTCCATGATCTTTATCTTTTCAGGTCTTATGTGCACTTTTTGTTTTCTCATGCAAACGTGAAAGATATATAAACCCTCAATCATATGTTGATGTTTCATATGTTATTTTTTGTTGCATTTTCTAGGATAGTTTTATCATAAAGACGTGTGATAAGTAACAGTGCTTCTCTTCTCCA.
[0009] As a general inventive concept, the present invention also provides primers for identifying KASP molecular markers closely linked to chili leaf curling, comprising: Forward primer 1: 5'-GAAGGTGACCAAGTTCATGCTTTTCCCACAGGGTCATATGGAACA-3'; Forward primer 2: 5'-GAAGGTCGGAGTCAACGGATTTTTCCCACAGGGTCATATGGAACG-3'; Reverse primer: 5'-GCATGAGAAAACAAAAAGTGCACA-3'.
[0010] Preferably, the two forward primers are connected to different fluorescent adapter sequences. The 5' end of forward primer 1 is connected to the FAM fluorescent adapter sequence, which is GAAGGTGACCAAGTTCATGCT; the 5' end of forward primer 2 is connected to the HEX fluorescent adapter sequence, which is GAAGGTCGGAGTCAACGGATT.
[0011] In a general inventive concept, the present invention also provides a kit for identifying KASP molecular markers closely linked to chili leaf curling, comprising the primers described above.
[0012] As a general inventive concept, the present invention also provides the application of the primers as described above or the kits as described above in the assisted breeding of peppers with target leaf types or in the identification of pepper leaf types, wherein the target leaf type includes flat leaves or curled leaves; the leaf type includes flat or curled; and the pepper is a long pepper.
[0013] In the above application, preferably, in the process of identifying the type of chili pepper leaves, the zhangshugang genome version of chili pepper is used as a reference. If the base at 130757030 on chromosome 9 of chili pepper is homozygous A / A or heterozygous A / G, the plant is determined to be a single chili pepper plant with flat leaves. If the base at 130757030 on chromosome 9 of chili pepper is homozygous G / G, the plant is determined to be a single chili pepper plant with curled leaves.
[0014] The above-mentioned application, preferably, includes the following specific process for identifying chili pepper leaf types: (1) Extract DNA from the peppers to be tested as a template; (2) PARMS PCR amplification, fluorescence signal scanning, and genotyping were performed using the primers or kits described above.
[0015] In the preferred application described above, genomic DNA from the sample to be tested is used as a template, and PARMS PCR amplification is performed using molecularly labeled amplification primers with a quantitative PCR device. When the fluorescent group and its corresponding fluorescence quencher are close together, the fluorescence emitted by the fluorescent group will be absorbed by the quencher, resulting in the emission of fluorescence at a longer wavelength, or the release of heat. In this case, the fluorescence signal of the group cannot be detected within the wavelength corresponding to this fluorescence. Once the two are separated, the fluorescence signal can be detected. PARMS uses the principle of fluorescence resonance energy transfer (FRET) to detect the amplification signal of FAM and HEX fluorescent primers. When the corresponding allele is amplified, a corresponding fluorescence signal will appear.
[0016] In the above application, preferably, during fluorescence signal scanning, if only FAM fluorescence signal is detected, the genotype is homozygous A / A; if only HEX fluorescence signal is detected, the genotype is homozygous G / G; if both FAM and HEX fluorescence signals are detected simultaneously, the genotype is heterozygous A / G.
[0017] In the above application, preferably, when the genotype is homozygous A / A or heterozygous A / G, the plant's leaves are determined to have a flat phenotype; when the genotype is homozygous G / G, the plant's leaves are determined to have a curled phenotype.
[0018] In the above-described application, preferably, the reaction procedure for PARMS PCR amplification is as follows: pre-denaturation at 94°C for 15 minutes; then 10 cycles of landing PCR: each cycle includes 94°C for 20 seconds, 78°C for 10 seconds, with the annealing temperature decreasing by 0.5°C from 62°C to 57°C per cycle; followed by 35 cycles of conventional PCR: each cycle includes 94°C for 20 seconds, 57°C for 60 seconds; and finally, incubation at 37°C for 30 seconds.
[0019] Compared with the prior art, the advantages of the present invention are as follows: (1) This invention is the first to identify an SNP (A / G) locus closely linked to the leaf curling trait at position 130757030 bp on chromosome 9 of pepper. The KASP molecular marker developed based on this locus enables accurate association between genotype and phenotype, completely overcoming the drawbacks of traditional breeding methods that rely on visual observation, are susceptible to environmental influences, and cannot be identified at the seedling stage. Using this marker, satisfactory plants can be quickly screened, effectively reducing the planting scale, decreasing the workload of later identification, and improving the efficiency and accuracy of selection.
[0020] (2) The molecular markers and their application methods of the present invention can rapidly screen out single plants carrying the homozygous curled genotype (G / G) in breeding populations for breeding densely planted curled-leaf varieties; when breeding flat-leaf varieties, single plants carrying the curled allele (G) can be quickly identified and eliminated to ensure the purity of breeding materials and improve selection efficiency. This provides a practical solution for targeted and efficient molecular design breeding of pepper leaf type traits. Attached Figure Description
[0021] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0022] Figure 1 Leaf phenotypes of the F2 population and its parents; Figure 2 This is a statistical analysis of the curling index and frequency of the cultivated breeding population in this embodiment of the invention; Figure 3 The following is an example of the initial BSA localization map in this embodiment of the invention: A represents the distribution of ΔSNP-index values on chromosome 1 of pepper, B represents the distribution of ΔSNP-index values on chromosome 2 of pepper, C represents the distribution of ΔSNP-index values on chromosome 3 of pepper, D represents the distribution of ΔSNP-index values on chromosome 4 of pepper, E represents the distribution of ΔSNP-index values on chromosome 5 of pepper, F represents the distribution of ΔSNP-index values on chromosome 6 of pepper, G represents the distribution of ΔSNP-index values on chromosome 7 of pepper, H represents the distribution of ΔSNP-index values on chromosome 8 of pepper, I represents the distribution of ΔSNP-index values on chromosome 9 of pepper, J represents the distribution of ΔSNP-index values on chromosome 10 of pepper, K represents the distribution of ΔSNP-index values on chromosome 11 of pepper, and L represents the distribution of ΔSNP-index values on chromosome 12 of pepper. The yellow line represents the threshold line with a confidence level of 0.99, and the blue line represents the threshold line with a confidence level of 0.95. Figure 4 This is a genotyping diagram of leaf curling in the F2 population detected by KASP in an embodiment of the present invention. Detailed Implementation
[0023] To facilitate understanding of the present invention, the present invention will be described more fully and in detail below with reference to the accompanying drawings and preferred embodiments, but the scope of protection of the present invention is not limited to the following specific embodiments.
[0024] Unless otherwise defined, all technical terms used herein have the same meaning as commonly understood by those skilled in the art. The technical terms used herein are for the purpose of describing particular embodiments only and are not intended to limit the scope of the invention.
[0025] Unless otherwise specified, all reagents and raw materials used in this invention are commercially available products or products that can be prepared by known methods.
[0026] Example 1: Obtaining KASP molecular markers linked to the chili leaf curling gene 1. Phenotypic identification of genetic populations The parent materials used were the naturally mutant chili pepper 'D26', which was observed and homozygous through multiple generations of self-pollination in experimental fields at Hunan Agricultural University, and its wild-type chili pepper 'A124'. The naturally mutant material and its wild-type are preserved at the Chili Pepper Germplasm Center of the College of Horticulture, Hunan Agricultural University, and can be obtained by the public from the Chili Pepper Germplasm Center of the College of Horticulture, Hunan Agricultural University. The applicant promises to provide them to the public within 20 years from the date of application.
[0027] Five hundred and forty pepper accessions from the F2 generation genetic mapping population, constructed using two materials, 'D26' (curled-leaf) and 'A124' (non-curled-leaf), were planted. The leaf curling phenotype was investigated. Five leaves per plant were photographed with a digital camera, and the leaf width and fully unfolded width were measured using a ruler. The leaf curling index was calculated as: Curling Index = (Leaf unfolded width - Leaf width) / Leaf unfolded width. This completed the phenotypic identification of the leaf curling trait. Figure 1 , Figure 2 As shown.
[0028] 2. Blade curling QTL positioning To locate the QTL loci controlling leaf curling, the QTL-SEQ method was used. From the F2 segregating population, 30 plants with extremely curled leaves and 30 plants with flat leaves were selected to construct two near-isogenic pools. Whole-genome resequencing was performed on the two parental pools and the two extreme DNA pools. Reads were aligned to the pepper reference genome (Zhangshugang version: http: / / ted.bti.cornell.edu / ftp / pepper / genome / Zhangshugang / ) using BWA software. SNP loci were then identified using SAM tools. Analysis revealed that SNP loci with multiple genotypes were filtered out, retaining only biselequities; SNP loci with read support less than 4 were filtered out; homozygous and consistent SNP loci between pools were filtered out; SNP loci with recessive pool genotypes not derived from recessive parents were filtered out; and homozygous and inconsistent SNP loci not belonging to either parent were filtered out, ultimately yielding high-quality, reliable SNP loci. Plotting with a 1Mb window and a 100kb step size is shown below. Figure 3 As shown.
[0029] Since SNPs associated with the target trait are linked to surrounding SNPs on chromosomes, the ΔSNP index should be above 0.5 or close to 1. In genomic regions without trait association, the ΔSNP index shows a random distribution around 0. Observing the distribution of ΔSNP index values, based on the distribution of SNP-Index on the genome in the two progeny pools, we selected a region where the SNP-index in one progeny pool was close to 1, and the SNP-index in the other progeny pool was close to 0, with the difference between the two above the 99% confidence line. We found a region on chromosome 9 (113.5M-161.3M) as a candidate region. Further genotyping analysis yielded the localization region (130.5 M - 132.0 M).
[0030] SNP loci within the localization interval were further analyzed and predicted. PARMS PCR primers were designed, and PCR amplification was performed using DNA from both parents and F1 as templates. Preliminary screening removed KASP markers that could not distinguish genotypes or had poor distinguishing effects. Further genotyping analysis was performed on the F2 population using KASP markers as templates. The marker Chr09_130757030 was found to perform excellent genotyping, with results perfectly matching the phenotypic traits and completely distinguishing whether the leaves of the population were curled. Therefore, Chr09_130757030 was ultimately selected as the KASP marker. (See below) Figure 4 As shown.
[0031] For this site, we designed KASP competitive allele-specific primers (sequences are shown in SEQ ID NO:2-4).
[0032] Example 2: Application of KASP molecular markers linked to the pepper leaf curling gene This embodiment aims to illustrate how to use the KASP primers developed in Example 1 to perform genotyping and phenotypic prediction on the pepper material to be tested.
[0033] 1. DNA was extracted from 540 individual plants in the F2 genetic population using the CTAB method. (1) Dithiothreitol (DTT, 0.2%) was added to the CTAB extract; (2) Add two fresh leaves (the size of the centrifuge tube cap) to a 2.0 ml centrifuge tube; grind them thoroughly into powder with liquid nitrogen, add 800-900 µL of CTAB buffer, and mix well; (3) Water bath at 65 ℃ for 30 min, gently invert and shake twice during the process, and then cool to room temperature below 15 ℃ after the water bath; (4) Add 500 chloroform / isoamyl alcohol (24:1) and mix well for 4 min to ensure that the sample is fully mixed with chloroform; (5) Centrifuge at 12,000 rpm for 10 min, take 500 µL of the supernatant, add it to a 1.5 mL centrifuge tube containing 500 µL of isopropanol, and gently invert to mix; let stand in a 4℃ refrigerator for 30 minutes. (6) Centrifuge at 12,000 rpm for 15 min, discard the supernatant, wash the precipitate with 500 μL of 75% alcohol, centrifuge at 12,000 rpm for 5 min, and discard the supernatant; (7) Air-dry the DNA to allow the alcohol to evaporate completely; add 100 µL of pure water (containing 1% RNase to a final concentration) to dissolve the DNA; (8) Remove RNA by water bath at 37 ℃ for 1 h; take DNA for electrophoresis detection. After confirming that the band is intact, use a micro spectrophotometer to determine the DNA concentration. The ratio of 260 / 280 and 260 / 230 should be greater than 1.8. Dilute the DNA to 100 ng and store at -20 ℃ for later use.
[0034] 2. Detection of KASP molecular markers in leaf curling (1) A kit purchased from Wuhan Jingtai Biotechnology Co., Ltd. was used. Two universal fluorescent primers were included in the PARMS 2X Master Mix: two were allele-specific forward primers, and one was a universal reverse primer. The two allele-specific forward primers had different 3' bases, corresponding to different alleles. The allele-specific forward primers produced different fluorescent signals through competitive PCR. The adapter sequence matching FAM fluorescence was GAAGGTGACCAAGTTCATGCT, and the adapter sequence matching HEX fluorescence was GAAGGTCGGAGTCAACGGATT.
[0035] Two allele-specific forward primers and one universal reverse primer were designed by SNPWay (http: / / www.snpway.com / ) and synthesized by Qingke Biotechnology (PAGE purification), as shown in SEQ ID NO:2~4 respectively: Forward primer 1: 5'-GAAGGTGACCAAGTTCATGCTTTTCCCACAGGGTCATATGGAACA-3'; Forward primer 2: 5'-GAAGGTCGGAGTCAACGGATTTTTCCCACAGGGTCATATGGAACG-3'; Reverse primer: 5'-GCATGAGAAAACAAAAAGTGCACA-3'.
[0036] (2) The classification system is shown in Table 1.
[0037] Table 1 Classification System
[0038] The PCR amplification reaction procedure was as follows: pre-denaturation at 94℃ for 15 minutes; then 10 cycles of landing PCR: each cycle included 94℃ for 20 seconds, 78℃ for 10 seconds, with the annealing temperature decreasing by 0.5℃ from 62℃ to 57℃ each cycle; followed by 35 cycles of conventional PCR: each cycle included 94℃ for 20 seconds, 57℃ for 60 seconds; and finally, incubation at 37℃ for 30 seconds.
[0039] (3) Classification results After the reaction, the fluorescence scanning module of the instrument was used to read the endpoint fluorescence signal. If only the homozygous dominant FAM fluorescence signal corresponding to the forward primer 1 connected to the fluorescent adapter sequence was detected, the plant was identified as a homozygous single plant with flat leaves. If only the homozygous recessive Hex fluorescence signal corresponding to the forward primer 2 connected to the fluorescent adapter sequence was detected, the plant was identified as a homozygous single plant with curled leaves. If both Hex and FAM heterozygous fluorescence signals corresponding to the forward primers 1 and 2 connected to the fluorescent adapter sequences were detected simultaneously, the plant was identified as a heterozygous single plant with flat leaves.
[0040] The results were used to identify the leaf curling phenotype of 540 individual plants in the F2 population of Example 1 using KASP markers. Some results are shown in Table 2.
[0041] Table 2. KASP curl index and genotype in the F2 population
[0042] Statistical analysis showed that all plants with the G / G genotype had a leaf curling index greater than or equal to 30%, exhibiting a stable curled phenotype; while plants with the A / A or A / G genotypes had a leaf curling index less than 30%, exhibiting a flattened phenotype. The genotype identification results were consistent with the phenotypic identification results.
Claims
1. A KASP molecular marker closely linked to chili leaf curling, characterized in that, Using the zhangshugang version of the gene as a reference gene, a single nucleotide polymorphism (SNP) with an A-to-G substitution occurred at position 130757030 on chromosome 9 of pepper. The flanking nucleotide sequence is as follows: TGCATTGTACAAGGAACTCTGCATGCCTGTGTTGGTCCTCTTGTAACAGTTCCTCATGAAGGGGGAAAGAGTTTACTATTTCCCACAGGGTCATATGGAACTGCATTGTACAAGGAACTCTGCATGCCTGTGTTGGTCCTCTTGTAACAGTTCCTCATGAAGGGGAAAGAGTTTACTATTTCCCACAGGGTCATATGGAAC[A / G]GGTATCTTTTGATTTACATTTTCTTCCATGATCTTTATCTTTTCAGGTCTTATGTGCACTTTTTGTTTTCTCATGCAAACGTGAAAGATATATAAACCCTCAATCATATGTTGATGTTTCATATGTTATTTTTTGTTGCATTTTCTAGGATAGTTTTATCATAAAGACGTGTGATAAGTAACAGTGCTTCTCTTCTCCA.
2. A primer for identifying a KASP molecular marker closely linked to chili leaf curling, characterized in that, include: Forward primer 1: 5'-GAAGGTGACCAAGTTCATGCTTTTCCCACAGGGTCATATGGAACA-3'; Forward primer 2: 5'-GAAGGTCGGAGTCAACGGATTTTTCCCACAGGGTCATATGGAACG-3'; Reverse primer: 5'-GCATGAGAAAACAAAAAGTGCACA-3'.
3. The primer as described in claim 2, characterized in that, The two forward primers are connected to different fluorescent adapter sequences. The 5' end of forward primer 1 is connected to the FAM fluorescent adapter sequence, which is GAAGGTGACCAAGTTCATGCT. The 5' end of forward primer 2 is connected to the HEX fluorescent adapter sequence, which is GAAGGTCGGAGTCAACGGATT.
4. A kit for identifying KASP molecular markers closely linked to pepper leaf curling, characterized in that, Includes the primers as described in claim 2 or 3.
5. The application of a primer as described in claim 2 or 3, or a kit as described in claim 4, in assisted breeding of target leaf type peppers or in identifying pepper leaf types, wherein, The target leaf shape includes flat leaves or curled leaves; the leaf type includes flat or curled; the chili pepper is a long, thin pepper.
6. The application as described in claim 5, characterized in that, In the process of identifying the type of chili pepper leaves, the zhangshugang genome version of chili pepper is used as a reference. If the base at 130757030 on chromosome 9 of chili pepper is homozygous A / A or heterozygous A / G, the plant is identified as a single chili pepper plant with flat leaves. If the base at 130757030 on chromosome 9 of chili pepper is homozygous G / G, the plant is identified as a single chili pepper plant with curled leaves.
7. The application as described in claim 5, characterized in that, The specific process for identifying chili pepper leaf types includes: (1) Extract DNA from the peppers to be tested as a template; (2) PCR amplification, fluorescence signal scanning, and genotyping are performed using the primers as described in claim 2 or 3 or the kit as described in claim 4.
8. The application as described in claim 7, characterized in that, If only FAM fluorescence signal is detected, the genotype is homozygous A / A; if only HEX fluorescence signal is detected, the genotype is homozygous G / G; if both FAM and HEX fluorescence binding signals are detected simultaneously, the genotype is heterozygous A / G; when the genotype is homozygous A / A or heterozygous A / G, the plant's leaves are determined to have a flat phenotype; when the genotype is homozygous G / G, the plant's leaves are determined to have a curled phenotype.
9. The application as described in claim 7, characterized in that, The PCR amplification reaction procedure is as follows: pre-denaturation at 94℃ for 15 minutes; then 10 cycles of landing PCR: each cycle includes 94℃ for 20 seconds, 78℃ for 10 seconds, with the annealing temperature decreasing by 0.5℃ from 62℃ to 57℃ each cycle; followed by 35 cycles of conventional PCR: each cycle includes 94℃ for 20 seconds, 57℃ for 60 seconds; and finally, incubation at 37℃ for 30 seconds.
Citation Information
Patent Citations
Molecular marker linked with capsicum annuum leaf color etiolation gene and application
CN111500761A
Molecular marker closely linked with capsicum fruitshape gene, primer, kit and application
CN118563015A
KASP molecular marker for identifying pepper floral leaf generation and application of KASP molecular marker
CN120158538A
Chili multi-branch gene CaBr1 linked KASP molecular marker as well as primer, kit and application of chilli multi-branch gene CaBr1 linked KASP molecular marker
CN121249954A
Molecular marker linked with green character of hypocotyl of capsicum annuum l., mutant gene, typing primer, and use thereof
WO2024131112A1