Molecular markers, primers, kits and applications linked to hypocotyl color genes in pepper seedlings

Abstract

This invention discloses a molecular marker linked to a gene controlling hypocotyl color in chili seedlings. Using the Zhangshugang genome version of chili as a reference, a T-to-A mutation occurs at base position 147379328 on chromosome 10 of chili. This invention also discloses primers and a kit for identifying the molecular marker linked to the chili seedling hypocotyl color gene, and its application in the auxiliary screening, identification, and breeding of chili varieties with green or purple hypocotyl colors at the seedling stage. This invention locates a novel gene controlling hypocotyl color in chili seedlings and, based on the mutation site of this gene, develops a molecular marker associated with this gene. This marker can be directly used for identifying morphological markers and corresponding genotypes at the chili seedling stage, and then used for auxiliary breeding, effectively solving problems such as long breeding cycles and susceptibility to environmental influences in conventional breeding methods.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering, and in particular relates to a molecular marker, primer, and kit linked to the hypocotyl color gene in pepper seedlings, and their application in the identification and breeding of morphological markers in pepper seedlings. Background Technology

[0002] Chili pepper (Capsicum annuum L.) is an annual or perennial plant native to tropical Central and South America. It is a warm-season crop, intolerant of frost, but drought-tolerant and relatively tolerant of poor soil. Its small leaves make it suitable for clump planting and dense planting, and it adapts well to a wide range of soil types. Chili peppers account for over 30% of my country's condiment consumption. With China's rapid economic development, rising living standards, and increasing labor costs, high-quality chili peppers have become a primary market demand. Hybrid vigor has achieved significant success in the selection of high-quality crops, and the development of high-yield and disease-resistant high-quality crops is inseparable from hybrid vigor. Chili peppers are cross-pollinated and possess strong hybrid vigor; utilizing hybrid vigor in seed production can greatly improve the yield, resistance, and quality of chili peppers.

[0003] Hybridization techniques have certain limitations in production applications. As the environmental requirements for seedling development become increasingly stringent, breeding operations become more complex and unstable. Markers of seedling morphology become crucial. Based on molecular breeding techniques, varieties with gene deletions / mutations are selected to produce phenotypic characteristics of the relevant gene deletions and mutations during the seedling stage. These phenotypic characteristics, observable early in seedling development, offer a simple, intuitive, and cost-effective approach to hybridization breeding selection.

[0004] Hypocotyl color in young stems is an important morphological marker in seedlings. For example, in tomato research, the deletion of the SlGSTAA gene inhibits anthocyanin accumulation in the hypocotyl, and SlGSTAA is closely linked to the sterility gene ms-10. In production applications, sterile plants are screened by identifying the color of tomato young stems. Most pepper varieties exhibit a purple hypocotyl coloration in the seedling stage due to anthocyanin accumulation, while peppers with green hypocotyls can be directly distinguished from other pepper varieties morphologically. Therefore, developing and controlling molecular markers linked to genes for hypocotyl color in pepper young stems is of great significance in shortening the time required for targeted breeding. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to overcome the deficiencies and defects mentioned in the background art above, and to provide a molecular marker, primer, kit and application linked to the hypocotyl color gene of pepper seedlings.

[0006] To solve the above-mentioned technical problems, the technical solution proposed by this invention is as follows:

[0007] A molecular marker linked to a hypocotyl color gene in chili seedlings, with reference to the 'Zhangshugang' genome version of chili, is located at base 147379328 on chromosome 10 of chili, where a T-to-A mutation occurs.

[0008] Based on a general inventive concept, the present invention also provides primers for identifying molecular markers linked to hypocotyl color genes in pepper seedlings, comprising:

[0009] Reverse primer: 5'-CCCAACCATCACTTTGTCCTT-3';

[0010] Forward primer 1: 5'-GAAGGTGACCAAGTTCATGCTCAGTTGGGATCTTTGAGGAAAAAA ATA-3';

[0011] Forward primer 2: 5'-GAAGGTCGGAGTCAACGGATTCAGTTGGGATCTTTGAGGAAAAAA ATT-3'.

[0012] Preferably, the 5' ends of the two forward primers are connected to different fluorescent adapter sequences, wherein the 5' end of forward primer 1 is connected to the FAM fluorescent adapter sequence, and the 5' end of forward primer 2 is connected to the HEX fluorescent adapter sequence; the FAM and HEX fluorescent adapter sequences are as follows:

[0013] FAM fluorescent linker sequence: GAAGGTGACCAAGTTCATGCT;

[0014] HEX fluorescent linker sequence: GAAGGTCGGAGTCAACGGATT.

[0015] As a general inventive concept, the present invention also provides a kit for identifying molecular markers linked to hypocotyl color genes in pepper seedlings, comprising the primers described above.

[0016] As a general inventive concept, the present invention also provides the application of the above-mentioned molecular markers, primers, or kits in the auxiliary screening, identification, and breeding of chili varieties with green or purple hypocotyls during the seedling stage.

[0017] The above application, preferably, includes the following steps:

[0018] (1) Using the genomic DNA of the sample to be tested as a template, perform PCR amplification using molecularly labeled amplification primers or kits to obtain amplification products;

[0019] (2) Detect and analyze the amplification products.

[0020] In the above application, preferably, in step (2), when performing fluorescence detection on the amplification product, if only the fluorescence signal corresponding to the forward primer 1 connected to the fluorescent adapter sequence is detected in the amplification product, the detection site is a homozygous T:T genotype, and it is determined to be a wild single plant with a purple hypocotyl; if only the fluorescence signal corresponding to the forward primer 2 connected to the fluorescent adapter sequence is detected in the amplification product, the detection site is a homozygous A:A genotype, and it is determined to be a single plant with a green hypocotyl; if the fluorescence signals corresponding to both the forward primers 1 and 2 connected to the fluorescent adapter sequence are detected in the amplification product, the detection site is a heterozygous T:A genotype, and it is determined to be a mutant single plant with a purple hypocotyl.

[0021] In the above application, preferably, in step (1), Touchdown PCR amplification is used; the Touchdown PCR amplification program is: 94℃ for 15 min; 95℃ for 20 s; 65℃-56℃ for 60 s, 10 cycles, with the annealing extension temperature decreasing by 0.8℃ in each cycle; 94℃ for 20 s; 57℃ for 60 s, 30 cycles.

[0022] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0023] (1) This invention utilizes the BSA mapping method to locate a new gene controlling hypocotyl color in chili seedlings, and based on the mutation site of this gene, develops a KASP molecular marker associated with this chili seedling hypocotyl color gene. This marker can be directly used for identifying chili seedling morphological markers and corresponding genotypes, and can then be used for assisted breeding, effectively solving problems such as long conventional breeding cycles and susceptibility to environmental influences.

[0024] (2) The molecular markers, primers and kits developed in this invention are particularly important. In the early stages, the molecular markers, primers or kits can be used to quickly screen satisfactory plants, effectively reducing the planting scale, reducing the workload of later identification, and improving the efficiency and accuracy of selection.

[0025] In conclusion, this invention is of great significance in the practice and research of chili pepper hybrid breeding. Attached Figure Description

[0026] Figure 1 Two parents were used to locate the BSA population: A represents the phenotypes of wild-type Zhangshugang and mutant rf1 plants, and B and C represent the phenotypes of the anthers of wild-type Zhangshugang and mutant rf1 plants, respectively.

[0027] Figure 2The following are partial results of genotyping of the PEPER-hypocotyl-Green-2 molecular marker of the present invention in the F2 population constructed from WT (wild type) and MT (mutant): A indicates that the PCR product has the fluorescence signal corresponding to the forward primer PEPER-hypocotyl-Green-2X, and is a homozygous single plant with purple hypocotyl; B indicates that the PCR product has two fluorescence signals, PEPER-hypocotyl-Green-2X and PEPER-hypocotyl-Green-2Y, and is a heterozygous single plant with purple hypocotyl; C indicates that the PCR product has the fluorescence signal corresponding to the forward primer PEPER-hypocotyl-Green-2Y, and is a homozygous single plant with green hypocotyl.

[0028] Figure 3 BSA mapping results for constructing populations for Zhangshugang and rf1: Chr01-Chr12 represent chromosome numbers. The gene controlling hypocotyl color in pepper seedlings is located on chromosome 10, with a region of approximately 144.06-154.56 Mbp.

[0029] Figure 4 This invention provides a fine localization of the gene controlling hypocotyl color in chili seedlings. Detailed Implementation

[0030] To facilitate understanding of the present invention, the present invention will be described more fully and in detail below with reference to the accompanying drawings and preferred embodiments, but the scope of protection of the present invention is not limited to the following specific embodiments.

[0031] Unless otherwise defined, all technical terms used herein have the same meaning as commonly understood by those skilled in the art. The technical terms used herein are for the purpose of describing particular embodiments only and are not intended to limit the scope of the invention.

[0032] Unless otherwise specified, all raw materials, reagents, instruments and equipment used in this invention can be purchased from the market or prepared by existing methods.

[0033] The chili germplasm involved in this invention was provided by Hunan Agricultural University and can be guaranteed to be sold for at least 20 years.

[0034] Example:

[0035] In this embodiment, the molecular marker linked to the hypocotyl color gene in chili seedlings is based on the whole genome version of chili 'Zhangshugang'. This molecular marker is located at base 147379328 on chromosome 10 of chili, where a T-to-A mutation occurs.

[0036] The method for obtaining the molecular marker linked to the green hypocotyl gene in pepper seedlings in this embodiment is as follows:

[0037] 1. Group building

[0038] Using the backbone chili parent Zhangshugang (which has been selected through multiple generations of self-pollination) Figure 1 As shown in left A), and the mutant material 'rf1' with green hypocotyl during the seedling stage, was the parent ( Figure 1 As shown in right A), the mutant material 'rf1' is a phenotypically stable mutant material obtained by Zhangshugang through EMS mutagenesis screening. The parent 'rf1' with green hypocotyl at the seedling stage was crossed with the parent Zhangshugang with purple hypocotyl at the seedling stage to obtain the F1 generation. The F1 generation was then self-crossed to obtain the F2 population.

[0039] 2. Population phenotypic identification

[0040] Phenotypic identification was performed during the F2 generation seedling stage to observe the hypocotyl color of individual seedlings within the population.

[0041] 3. Preliminary localization of the gene controlling hypocotyl color in chili peppers

[0042] In the F2 population of Zhangshugang×rf1, leaves from 25 seedlings with purple hypocotyls and 25 seedlings with green hypocotyls were selected. Equal amounts of leaves from each plant were mixed to construct a purple / green hypocotyl DNA pool. Leaves from 'rf1' plants were then used as the parental pool. Total DNA was extracted from all three pools using the CTAB method. Libraries were constructed using the TruSeqDNA LT Sample Prep Kit (Illumina), and genome sequencing was performed using the Illumina Novaseq PE150 platform. After rigorous quality control, the reads were aligned to the pepper reference genome using bwa software.

[0043] SNP loci were located throughout the genome using SAMtools software. Analysis revealed that the sequencing depths of the wild-type and mutant pools were 18.48× and 20.99×, respectively, both covering over 99% of the genome. Base quality values ​​greater than or equal to 30, mapping quality values ​​greater than or equal to 30, and base depths greater than or equal to 2 and less than or equal to 80 in both F2 pools, and greater than or equal to 2 and less than or equal to 40 in both parents, ultimately yielding 814,328 differentially expressed SNPs. The maximum allele frequency (SNP-index) and corresponding ΔSNP-index value were calculated for the recessive pool, plotted with a 2Mb window and a 200kb step size, as shown below. Figure 3Since SNPs associated with the target trait are linked to surrounding SNPs on chromosomes, candidate intervals have ΔSNP-index values ​​above 0.5 or close to 1, while in genomic regions without trait association, ΔSNP-index values ​​are randomly distributed around 0.5. Observation of the distribution of ΔSNP-index values ​​revealed a distinct peak region across the entire genome, with ΔSNP-index values ​​above 0.5 and close to 1, located on chromosome 10 between 144.06 and 154.56 Mbp. This indicates that the gene regulating hypocotyl color in pepper seedlings is located within this region.

[0044] 4. Fine mapping of genes controlling hypocotyl color in chili peppers

[0045] Step 3 yielded the chromosomal region regulating hypocotyl color in chili pepper seedlings. To further narrow down the candidate region for the fertility restoration gene, DNA sequence variations within the region were analyzed, and a KASP marker was developed. This KASP marker was then used to genotype individual plants in the F2 population, identifying the exchanged plants. Based on the phenotypic data of plant fertility and the identified genotypes of the exchanged plants, the fertility restoration gene was located in the 147.2-147.7 MB region of chromosome 10. Figure 4 Finally, sequencing revealed a T-to-A mutation at position 147379328 on chromosome 10 of the pepper genome.

[0046] 5. Application of molecular markers linked to hypocotyl color genes in chili seedlings in chili seedling hypocotyl color

[0047] In the F2 population constructed by Zhangshugang and rf1, leaves from 314 individual plants were selected for genotyping verification. The specific steps are as follows:

[0048] (1) Extraction of plant leaf DNA using the CTAB method: Fresh young leaves were placed into a 2ml grinding tube containing zirconium beads, frozen with liquid nitrogen, and then quickly transferred to a grinder. After grinding at 60Hz for 45s, the zirconium beads were poured out, and 800ul of CTAB solution preheated to 65℃ was added. The mixture was shaken and placed in a 65℃ water bath for 30min, shaking once every 10min. The sample was then removed and placed at room temperature, and 500ul of CTAB solution was added. After mixing the DNA extraction solution (chloroform / isoamyl alcohol, 24:1 mixture), shake vigorously to ensure thorough mixing. Centrifuge at 12000 rpm for 10 min. Carefully aspirate 500 μL of the supernatant into a new 1.5 mL centrifuge tube. Add 500 μL of pre-chilled isopropanol solution (pre-chilled at -20°C). Mix slowly and incubate at -20°C for at least 2 hours or overnight. Remove the mixture stored at -20°C and centrifuge at 12000 rpm for 10 min at 4°C. Discard all supernatant. The DNA precipitate will remain at the bottom of the centrifuge tube. Blot off excess water. Add 500 μL of 75% ethanol to the DNA precipitate and gently shake to allow the DNA precipitate to float. Centrifuge at 12000 rpm for 30 s at 4°C and discard the supernatant. Air dry the ethanol-washed DNA. Dissolve the DNA precipitate in 100 μL of ddH2O (containing RNase at a final concentration of 1%). Incubate at 37°C for 1 h before removing the DNA sample for later use.

[0049] (2) Molecular markers were used to identify the individual genotypes of each plant in the RIL population.

[0050] 1) Genotyping primers designed for the T-to-A mutation at 147379328 bp on chromosome 10 are as follows (as shown in SEQ ID NO: 1-3 respectively):

[0051] Reverse primer PEPER-hypocotyl-Green-2C: 5'-AGCTGATACAAACTTAACGCTGTG-3';

[0052] Forward primer PEPER-hypocotyl-Green-2X: 5'-GAAGGTGACCAAGTTCATGCT CAGTTGGGATCTTTGAGGAAAAAAATA-3';

[0053] Forward primer PEPER-hypocotyl-Green-2Y: 5'-GAAGGTCGGAGTCAACGGATT CAGTTGGGATCTTTGAGGAAAAAAATT-3'.

[0054] The 5' ends of the two forward primers are connected to different fluorescent adapter sequences. Specifically, the 5' end of the forward primer PEPER-hypocotyl-Green-2X is connected to the FAM fluorescent adapter sequence, and the 5' end of the forward primer PEPER-hypocotyl-Green-2Y is connected to the HEX fluorescent adapter sequence. The FAM and HEX fluorescent adapter sequences are as shown in SEQ ID NO:4-5, respectively:

[0055] FAM fluorescent linker sequence: GAAGGTGACCAAGTTCATGCT;

[0056] HEX fluorescent linker sequence: GAAGGTCGGAGTCAACGGATT.

[0057] 2) PCR amplification was performed using the primers described above, and the reaction system is shown in Table 1.

[0058] Table 1: PCR reaction system

[0059]

[0060]

[0061] Touchdown PCR was used, and the amplification program was as follows: 94℃ for 15 min; 95℃ for 20 s; 65℃-56℃ for 60 s, 10 cycles, with the annealing extension temperature decreasing by 0.8℃ in each cycle; 94℃ for 20 s; 57℃ for 60 s, 30 cycles.

[0062] 3) Genotyping analysis: When performing fluorescence detection on the amplification products, if only the fluorescence signal corresponding to the forward primer PEPER-hypocotyl-Green-2X with the fluorescent adapter sequence is detected in the amplification products, the detection site is a homozygous T:T genotype, and it is identified as a wild-type single plant with a purple hypocotyl; if only the fluorescence signal corresponding to the forward primer PEPER-hypocotyl-Green-2Y with the fluorescent adapter sequence is detected in the amplification products, the detection site is a homozygous A:A genotype, and it is identified as a single plant with a green hypocotyl; if the fluorescence signal corresponding to both the forward primers PEPER-hypocotyl-Green-2X and PEPER-hypocotyl-Green-2Y with the fluorescent adapter sequence is detected in the amplification products, the detection site is a heterozygous T:A genotype, and it is identified as a mutant single plant with a purple hypocotyl.

[0063] The results showed that three types of fluorescence signals were observed: 71 plants exhibited homozygous T:T fluorescence, 164 plants exhibited A:T fluorescence, and 79 plants exhibited A:A fluorescence. The hypocotyl color type and genotype results for some plants are shown in Table 2.

[0064] The phenotypic survey data showed that the genotype was highly consistent with the hypocotyl color phenotype of the plant, with a consistency rate of 100%.

[0065] Table 2: Results of PEPER-hypocotyl-Green-2 marker application in select individual plants in the F2 population constructed from 'Zhangshugang' and rf1.

[0066]

[0067]

[0068]

[0069] The above results fully demonstrate that the PEPER-hypocotyl-Green-2 marker has universality and accuracy, and can be applied to the identification and screening of chili seedlings.

[0070] The above identification results indicate that, in breeding, by selecting materials that detect the fluorescence signal corresponding to primer PEPER-hypocotyl-Green-2Y, it is possible to breed chili pepper materials with green hypocotyls at the seedling stage. By retaining materials that detect the fluorescence signal corresponding to primer PEPER-hypocotyl-Green-2X, it is possible to breed homozygous chili pepper materials with purple hypocotyls at the seedling stage. By retaining materials that detect fluorescence signals corresponding to both primers mentioned above, it is possible to breed heterozygous materials with purple hypocotyls at the seedling stage. The results are shown in [see attached table]. Figure 2 Early screening using molecular markers can reduce the workload of later screening and identification, thus accelerating the breeding process.

Claims

1. A primer for identifying a molecular marker linked to a hypocotyl color gene in pepper seedlings, characterized in that, include: Reverse primer: 5'-CCCAACCATCACTTTGTCCTT-3'; Forward primer 1: 5'-GAAGGTGACCAAGTTCATGCTCAGTTGGGATCTTTGAGGAAAAAAATA-3'; Forward primer 2: 5'-GAAGGTCGGAGTCAACGGATTCAGTTGGGATCTTTGAGGAAAAAAATT-3'.

2. The primer as described in claim 1, characterized in that, The 5' ends of the two forward primers are connected to different fluorescent adapter sequences. Forward primer 1 has a FAM fluorescent adapter sequence at its 5' end, and forward primer 2 has a HEX fluorescent adapter sequence at its 5' end. The FAM and HEX fluorescent adapter sequences are as follows: FAM fluorescent linker sequence: GAAGGTGACCAAGTTCATGCT; HEX fluorescent linker sequence: GAAGGTCGGAGTCAACGGATT.

3. A kit for identifying molecular markers linked to hypocotyl color genes in pepper seedlings, characterized in that, Includes the primers described in claim 1 or 2.

4. The application of a primer as described in claim 1 or 2 or a kit as described in claim 3 in the auxiliary screening, identification and breeding of chili pepper varieties with green or purple hypocotyls during the seedling stage.

5. The application as described in claim 4, characterized in that, Includes the following steps: (1) Using the genomic DNA of the sample to be tested as a template, perform PCR amplification using the primers as described in claim 1 or 2 or the kit as described in claim 3 to obtain the amplification product; (2) Detect and analyze the amplification products.

6. The application as described in claim 5, characterized in that, In step (2), when performing fluorescence detection on the amplification product, if only the fluorescence signal corresponding to the forward primer 1 connected to the fluorescent adapter sequence is detected in the amplification product, the detection site is a homozygous T:T genotype, and it is determined to be a wild single plant with a purple hypocotyl; if only the fluorescence signal corresponding to the forward primer 2 connected to the fluorescent adapter sequence is detected in the amplification product, the detection site is a homozygous A:A genotype, and it is determined to be a single plant with a green hypocotyl; if the fluorescence signal corresponding to both the forward primers 1 and 2 connected to the fluorescent adapter sequence is detected in the amplification product, the detection site is a heterozygous T:A genotype, and it is determined to be a mutant single plant with a purple hypocotyl.

7. The application as described in claim 5, characterized in that, In step (1), Touchdown PCR amplification is used; the Touchdown PCR amplification program is as follows: 94℃ for 15 min; 95℃ for 20 s; 65℃-56℃ for 60 s, 10 cycles, with the annealing extension temperature decreasing by 0.8℃ in each cycle; 94℃ for 20 s; 57℃ for 60 s, 30 cycles.

Images