A liquid crystal biosensor based on functional nucleic acid regulation of CRISPR-Cas12a for high-sensitivity visual detection of protein markers and a preparation and detection method thereof
The liquid crystal biosensor, which utilizes a CRISPR-Cas12a enzyme catalysis and liquid crystal orientation transfer cascade amplification mechanism, solves the problem of high sensitivity and ease of operation in the detection of low-abundance protein biomarkers in existing technologies. It achieves high-sensitivity instantaneous detection and universal target detection, and is suitable for early screening of diseases such as cancer and COVID-19.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- INSTITUTE OF BASIC MEDICINE & CANCER CHINESE ACADEMY OF SCIENCES (PREPARATORY)
- Filing Date
- 2023-09-06
- Publication Date
- 2026-07-24
AI Technical Summary
Existing POCT technologies struggle to achieve highly sensitive and easy-to-use detection of low-abundance protein biomarkers without the need for large instruments, especially for early screening of diseases such as cancer and COVID-19. Furthermore, liquid crystal biosensors lack universality in target detection.
A CRISPR-Cas12a-based liquid crystal biosensor was designed, utilizing the cascade amplification mechanism of Cas12a enzyme catalysis and liquid crystal orientation transfer, combined with the specific recognition of target proteins by nucleic acid aptamers. Through rational design, high sensitivity and specificity detection are achieved, and the sensor is suitable for point-of-care testing by outputting a visualized optical signal.
It achieves highly sensitive protein biomarker detection, is easy to operate, requires no large instruments, is suitable for point-of-care testing, has higher sensitivity than gold nanoparticle colorimetric test strips, is suitable for grassroots areas and home self-testing, and has the ability to universally detect a variety of protein biomarkers.
Smart Images

Figure CN119574861B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to a liquid crystal biosensor for simultaneously detecting multiple cancer markers, and its preparation and detection methods, belonging to the field of analytical detection technology. Background Technology
[0002] Proteins are the executors of all life functions and are closely related to the occurrence and development of diseases. Currently, the diagnosis of many diseases, including cancer, COVID-19, neurological diseases, and immune inflammation, involves protein detection. For example, cancer screening and recurrence monitoring require the detection of protein-based cancer biomarkers such as CEA, AFP, and CA199. COVID-19 diagnosis can detect biomarkers such as N protein. Currently reported methods for detecting protein biomarkers include electrochemiluminescence (ECL), chemiluminescence immunoassay (LIA), enzyme-linked immunosorbent assay (ELISA), surface-enhanced Raman spectroscopy (SERS), single-particle counting, single-molecule immunoassay array (Simoa), surface plasmon resonance (SPR), and electrochemiluminescence sensing. However, these biomarker detection methods are suitable for large hospital testing laboratories with complete equipment and experienced operators, but they cannot fully meet the needs of early disease screening for a wider population (such as early cancer screening and COVID-19 screening), especially for grassroots areas with relatively weak equipment infrastructure and home self-testing.
[0003] Therefore, many research groups have begun to develop point-of-care (POCT) methods for protein markers, such as paper-based microfluidics, gold nanoparticle colorimetry, SERS-based POCT, and photonic crystal colorimetry, etc. However, three major challenges remain: 1. The sensitivity must meet the detection requirements of some low-abundance disease markers while ensuring that detection and data reading are completely independent of laboratory instruments; 2. The detection method should not require strict operating procedures but should be operated by trained and experienced professionals; 3. Minimal human intervention is required. Existing POCT technologies struggle to overcome these three challenges simultaneously. Therefore, there is an urgent need to develop a detection method that combines high sensitivity, ease of operation, and independence from large instruments.
[0004] Point-of-care testing (POCT) technology based on the CRISPR-Cas system, first reported by Professor Zhang Feng's laboratory in 2017, has attracted widespread attention from researchers due to its high amplification efficiency, compatibility with isothermal nucleic acid amplification and paper-based flow chromatography, and the ability to achieve nucleic acid molecule detection limits as low as aM without the need for complex instruments. Subsequent reports and products related to the detection of nucleic acid molecules such as cfDNA, viral DNA, RNA, and bacterial DNA based on the CRISPR-Cas system have emerged in large numbers. While its application to protein detection has also been reported, the detection sensitivity is limited because proteins cannot be amplified, and its advantages over mature paper-based flow chromatography based on gold nanoparticle colorimetry are not significant. It still cannot meet the requirements for the detection of low-abundance proteins, such as the SARS-CoV-2 N protein.
[0005] Liquid crystal biosensors are a type of biosensing technology suitable for constructing point-of-care testing (POCT) devices. They offer advantages such as simple construction, low cost, low energy consumption, label-free operation, small sample volume, and high sensitivity. Due to their unique advantages, liquid crystal biosensors have gradually attracted widespread attention from researchers both domestically and internationally, achieving certain results in protein label detection and showing broad market prospects. However, to ensure both specificity and sensitivity, it is often necessary to construct a sensitive monolayer membrane that can be disrupted by the target molecule. For example, for transpeptidases, designing and synthesizing amphiphilic molecules containing the amide bond of the enzyme substrate to construct sensors. Currently, the construction methods lack universality, making it difficult to achieve the detection of a wide range of targets by simply replacing existing signal recognition molecules (such as antibodies or nucleic acid aptamers), which greatly limits the practical application of liquid crystal sensors. Summary of the Invention
[0006] To address the shortcomings of existing technologies, this invention provides a liquid crystal biosensor based on functional nucleic acid regulation of CRISPR-Cas12a activity, characterized by visualization and high sensitivity of protein biomarkers, along with its preparation and detection method. This invention designs a CRISPR-Cas12a-liquid crystal cascade amplification system. When the target analyte is present, the activated CRISPR-Cas12a cleaves nucleic acid molecules at the detection interface. The cleavage of the nucleic acid molecules triggers a change in the orientation of the liquid crystal film at the detection interface, which is then amplified and converted into a visualized physical signal through transmission to the bulk phase. For ease of use, the required detection reagents are pre-frozen. During use, simply add the reagents to the detection solution, mix well, and then add the mixture to the pre-prepared detection chip. For convenient quantitative processing, images can be automatically processed and data acquired using MATLAB or similar programs; alternatively, visual colorimetric detection can be performed without relying on such programs.
[0007] The present invention specifically provides the following solution:
[0008] The first aspect of the present invention provides a liquid crystal biosensor for detecting target proteins. The sensor includes a ready-to-use detection reagent and a nucleic acid molecule-functionalized liquid crystal detection interface. The ready-to-use detection reagent includes the following elements or components: a Cas enzyme-crRNA complex with cleavage activity and an activation sequence locking system based on a nucleic acid aptamer-activation sequence-two-dimensional material. The nucleic acid molecule-functionalized liquid crystal detection interface is a liquid crystal interface modified with DNA or RNA molecules, wherein the nucleic acid aptamer specifically recognizes the target protein.
[0009] In a specific embodiment of the present invention, the Cas enzyme is Cas12 and the liquid crystal interface is modified with ssDNA; or the Cas enzyme is Cas13 and the liquid crystal interface is modified with ssRNA.
[0010] In a specific embodiment of the present invention, the nucleic acid aptamer-activated sequence locking system is a nucleic acid aptamer-activated sequence-graphene complex, the structure of which is that the nucleic acid aptamer-activated sequence is coupled by a spacer sequence and then adsorbed onto the graphene surface by a linker sequence.
[0011] In a specific embodiment of the present invention, the target protein is a biomarker protein indicating disease or health risk or a biomarker protein of infectious pathogens.
[0012] In a specific embodiment of the present invention, the target protein is the SARS-CoV-2 N protein, and the corresponding nucleic acid aptamer sequence is: ACGA CAA TAT TCC TTA GGG GCA CCG CTA CAT.
[0013] In a specific embodiment of the present invention, the target protein is carcinoembryonic antigen, and the corresponding nucleic acid aptamer sequence is: TAG CTA TAG GGG GTG AAG GGA TAC CC.
[0014] In a specific embodiment of the present invention
[0015] The Cas enzyme is Cas12a;
[0016] The activation dsDNA sequence is TTTG GAT GAA TGC TAG CCT GTG TC; GA CAC AGG CTA GCA TTCATC CAAA;
[0017] The ligation DNA sequence is ACA TCC AGC ATA AGT TTT TTT CCC CCC CCC CCC CC;
[0018] The crRNA sequence is UAA UUU CUA CUA AGU GUA GAU GAT GAA TGC TAG CCT GTG TC.
[0019] In a specific embodiment of the present invention, the liquid crystal interface is formed by 4-cyano-4'-pentylbiphenyl, the DNA molecule is TAG CGA TAG TAG, and the modification is covalently coupled or non-covalently coupled.
[0020] The present invention further provides the use of the liquid crystal biosensor in the preparation of diagnostic kits.
[0021] The present invention further provides a diagnostic kit comprising the above-mentioned liquid crystal biosensor.
[0022] Preferably, the ready-to-use test reagent and the corresponding buffer component are in the form of a mixed cryopreserved powder.
[0023] Beneficial effects:
[0024] 1. This invention designs a liquid crystal biosensor based on the visualization and high sensitivity of CRISPR-Cas12a activity regulated by functional nucleic acids. High-sensitivity detection is achieved by utilizing the cascade amplification of Cas12a enzyme catalysis and liquid crystal orientation transfer. Based on the principle of nucleic acid aptamers specifically recognizing target proteins, the cascade amplification triggered by the activation of Cas12a enzyme by the target protein is rationally designed to achieve specific detection. Furthermore, the nucleic acid aptamers can be changed according to different targets, thus making this invention universally applicable for detecting other protein biosensors.
[0025] 2. The LCD sensor outputs a visual optical signal, requiring no laser or xenon lamp, only a small LED light source powered by a button battery. Furthermore, it eliminates the need for large instruments, making it potentially suitable for rapid, real-time detection of protein biomarkers.
[0026] 3. This invention can employ image recognition procedures for quantitative detection or visual colorimetric qualitative detection. If direct visual colorimetric qualitative detection is used, the operation is similar to that of colorimetric test strips based on gold nanoparticles, but this method has higher sensitivity than gold nanoparticle colorimetric test strips.
[0027] 4. This invention uses ready-to-use reagents, making it simple and convenient to operate, requiring minimal manpower and no specialized personnel or training. The operation method is similar to that of test strips, but with higher sensitivity. Attached Figure Description
[0028] Figure 1 This is a schematic diagram illustrating the detection principle.
[0029] Figure 2 Gray-scale statistics and heatmaps for different liquid crystal optical signals;
[0030] Figure 3 The working curve for detecting N protein. Detailed Implementation
[0031] The present invention will be further described below with reference to embodiments, but the scope of protection of the present invention is not limited thereto. Unless otherwise specified, the pharmaceuticals involved in the embodiments are all commercially available products.
[0032] Technical terms and definitions
[0033] Cas enzymes with cleavage activity
[0034] Cas12 and Cas13 are enzymes with ligase activity. Guided by the guide RNA sequence, Cas12 and Cas13 activate ligase activity once they bind to the target sequence. This activity will simultaneously cleave the surrounding reporter sequence, thereby amplifying the signal.
[0035] Activate sequence locking system
[0036] This invention utilizes an activation sequence locking system based on a nucleic acid aptamer-activation sequence-two-dimensional adsorption material. This structure is known in the prior art. For example, a nucleic acid aptamer sequence and a Cas12a enzyme activation sequence are linked together via a TTTTTTTTT spacer (the spacer sequence can be a nucleic acid fragment such as a polyT or polyA sequence, or a non-nucleic acid fragment such as polyethylene glycol or an alkyl chain, or a combination of nucleic acid and non-nucleic acid fragments). The aptamer is then adsorbed onto graphene oxide. Because the nucleic acid aptamer-activation sequence is adsorbed onto the graphene, the Cas12a enzyme cannot be activated. When the target protein is present, due to the specific recognition and binding of the target protein to the nucleic acid aptamer, the nucleic acid aptamer-activation sequence detaches from the graphene, allowing it to bind to the Cas12a enzyme and activate it. This process utilizes the nucleic acid aptamer to ensure specific recognition, thereby achieving specific detection.
[0037] Any two-dimensional material with strong adsorption capacity for nucleic acid sequences can be used in this invention, such as graphene, germanene, graphene nanoribbons (GNR), bilayer graphene (BLG), phosphorene, graphene oxide, reduced graphene, fluorinated graphene, MoS2, two-dimensional metal carbides MXenes, etc.
[0038] The linker sequence comprises the following parts: a first part is a fragment complementary to the nucleic acid aptamer; a second part is a random sequence not complementary to the nucleic acid aptamer; a third part is a homopolymeric base region (preferably PolyC) to enhance graphene adsorption; and an optional spacer portion such as polyT. The random sequence is designed for two purposes: first, to eliminate or reduce nonspecificity, the melting temperature of the linker sequence must be sufficiently high, thus requiring a certain sequence length; second, to ensure that the nucleic acid aptamer undergoes a target-induced conformational change after complementary hybridization with the linker sequence, thereby opening the double strand, key bases in the stable secondary conformation of the nucleic acid aptamer after binding to the target cannot participate in hybridization. Experiments and software simulations have shown that a linker sequence length of 14 nt or more can effectively reduce nonspecificity, and the appropriate length of the fragment complementary to the nucleic acid aptamer is 8 nt. Therefore, a 6 nt random sequence is designed to satisfy both of the above objectives.
[0039] The preferred connection sequence of this invention is: ACATCCAGCATAAGT TTT TTT CCC CCC CCC CCC CC
[0040] target protein
[0041] The detection system of this invention can be used for any biomarker protein indicating disease or risk, such as carcinoembryonic antigen, prostate-specific antigen, or alpha-fetoprotein; or proteins of infectious pathogens such as hepatitis B surface antigen, hepatitis B core antigen, or SARS-CoV-2 N protein.
[0042] Nucleic acid aptamers
[0043] The concept of nucleic acid aptamers is well known to those skilled in the art. Those skilled in the art can obtain aptamer sequences that recognize specific target proteins through conventional screening methods. For example, in this invention:
[0044] The nucleotide sequence of the SARS-CoV-2 N protein aptamer is ACCGACAATAATTCCCTTAGGGGCACCGCTACAT;
[0045] The nucleotide sequence of the carcinoembryonic antigen aptamer is TAG CTA TAG GGG GTG AAG GGA TAC CC.
[0046] DMOAP: N,N-Dimethyl-N-[3-(trimethoxysilyl)propyl]octadecylammonium chloride, CAS: 27668-52-6;
[0047] OTAB: Octadecyltrimethylammonium chloride;
[0048] CRISPR: Clusters of Palindromic Repeats
[0049] Cas12a: CRISPR-associated protein 12a
[0050] POCT: Point-of-care testing
[0051] DEPC water: Ultrapure water treated with diethyl pyrocarbonate and sterilized under high temperature and pressure.
[0052] Room temperature: has a meaning known to those skilled in the art, and generally refers to 25±2℃.
[0053] The technical solution of the present invention is as follows:
[0054] A liquid crystal biosensor based on the visualization and high sensitivity of CRISPR-Cas12a protein biomarkers regulated by functional nucleic acids, the liquid crystal biosensor comprising a ready-to-use detection reagent and a DNA-functionalized liquid crystal detection interface.
[0055] The above-mentioned ready-to-use test kit consists of the cas12a-crRNA complex, the nucleic acid aptamer-activation sequence-graphene complex, and the corresponding buffer, frozen in an EP tube.
[0056] The steps for using the above-mentioned liquid crystal biosensor are as follows: add the analyte to the EP tube, mix and dissolve it, and then add the DNA-modified liquid crystal bio-interface.
[0057] According to a preferred embodiment of the present invention, the protein biomarker includes, but is not limited to, the SARS-CoV-2 N protein, wherein the nucleotide sequence for detecting the SARS-CoV-2 N protein is ACCGA CAA TAT TCC TTA GGG GCA CCG CTA CAT.
[0058] The preferred CRISPR-Cas12a activation dsDNA sequence of this invention is TTTG GAT GAA TGC TAG CCTGTG TC; GA CAC AGG CTA GCA TTC ATC CAAA
[0059] The optimized crRNA sequence of this invention is UAA UUU CUA CUA AGU GUA GAU GAT GAA TGCTAGCCT GTG TC
[0060] The preferred linker DNA sequence of this invention is ACA TCC AGC ATA AGT TTT TTT CCC CCC CCCCCCCC
[0061] The preferred sample buffer solution of this invention is: 10mM Tri-HCl, 150mM NaCl, 5mM KCl, 0.5mM MgCl2, pH=7.5, prepared with DEPC water.
[0062] The more specific implementation steps of this invention are as follows:
[0063] The preparation method of the above-mentioned nucleic acid aptamer-activation sequence-graphene complex in this invention comprises the following steps:
[0064] The ligation sequence and graphene oxide were mixed in HEPES buffer (10 mM HEPES, 300 mM NaCl, pH 7.5) and incubated for 3–6 h, followed by incubation at 95 °C for 3–15 min, and then slowly cooled to room temperature. The ratio of ligation sequence to graphene oxide was 1 nmol / 10 μg to ensure saturated adsorption of the ligation DNA onto the graphene oxide. Aptamers containing CRISPR-Cas12a activated dsDNA sequences and complementary DNA sequences were denatured and annealed at a 1:1 ratio, with the activation sequence undergoing specific complementary base pairing to form double-stranded DNA. The annealed aptamer-activated sequence was added to the graphene oxide containing the ligation sequence and incubated at room temperature for 10–120 min to ensure binding of the aptamer-activated sequence to the graphene oxide via complementary base pairing. BSA (1–20 mg / mL) was added and incubated overnight to block the graphene oxide. Centrifuge at 10,000 rpm for 10 minutes to remove the supernatant, wash the precipitate, and repeat 3-5 times to remove free DNA. Store the prepared complex at 4°C for later use.
[0065] The preparation method of the above-mentioned cas12a-crRNA complex in this invention comprises the following steps:
[0066] The Cas12a enzyme and crRNA were mixed and incubated for 1 hour to obtain the Cas12a-crRNA complex. The preferred ratio was 2:1 to 1.5:1.
[0067] In this invention, the crRNA is preferably prepared using DEPC water.
[0068] The preparation method of the above-mentioned ready-to-use detection reagent in this invention comprises the following steps:
[0069] The prepared aptamer-activating sequence-graphene complex was mixed with the cas12a-crRNA complex. The preferred mixture contained 10 μg / mL of the aptamer-activating sequence-graphene complex and 50-500 pM of the cas12a-crRNA complex. A 5 U / μL ribozyme inhibitor was added. The lyophilization method involved freezing the prepared reaction system (without the test sample) at -80°C for 2 hours, followed by vacuum drying at -50°C for 12 hours. The lyophilized reaction system was used by dissolving it in 18–19.6 μL of RNase-free water, adding 0.4–2 μL of the extracted nucleic acid product, and then reacting.
[0070] In this invention, after mixing the solution containing the target substance (such as saliva, urine, PBS solution, etc.) with the sample buffer, 50-300 μL is added to an EP tube containing ready-to-use reaction reagents. The preferred mixing ratio of the solution containing the target substance to the sample buffer is 1:1 to 1:10.
[0071] The preparation method of the above-mentioned liquid crystal biosensor for detecting protein markers includes the following steps:
[0072] (1) Immerse the glass slide in the washing solution at 70-90℃ for 30-60 min, then wash it 3-6 times each with water, anhydrous ethanol and methanol, blow it dry with nitrogen, dry it at 100-120℃ for 10-20 h, place it in a 0.1%-3% DMOAP solution at room temperature for 15-30 min, wash it 3-6 times with three distilled water, blow it dry with nitrogen, cure it at 100-110℃ for 3-5 h, and obtain the glass substrate after cooling.
[0073] (2) Place the copper mesh on the glass substrate of step (1), and inject OTAB-doped 4-cyano-4'-pentylbiphenyl into the copper mesh while it is hot at 35-45°C to construct a liquid crystal biosensing interface. The thickness of the liquid crystal film is 20-60 μm. The preferred concentration of OTAB doping in this patent is:
[0074] (3) Inject the DNA solution into the liquid crystal biosensor interface obtained in step (2), let it stand at room temperature for 10-20 minutes, and wash away the free DNA with PBS buffer to obtain the DNA-modified liquid crystal biosensor.
[0075] According to a preferred embodiment of the present invention, the washing solution in step (1) is prepared by mixing concentrated sulfuric acid with a mass concentration of 98% and hydrogen peroxide with a mass concentration of 30% in a volume ratio of 7:3.
[0076] According to a preferred embodiment of the present invention, the preparation method of OTAB-doped 4-cyano-4'-pentylbiphenyl in step (2) is as follows: OTAB powder is dissolved in chloroform to prepare a 0.1 mM OTAB chloroform solution, and the OTAB chloroform solution and 4-cyano-4'-pentylbiphenyl are mixed at a volume ratio of 1:1, vortexed at 2500 rpm for 1 to 5 minutes to fully mix, and the chloroform is dried with nitrogen to obtain OTAB-doped 4-cyano-4'-pentylbiphenyl.
[0077] In this invention, the DNA-modified liquid crystal biosensor encoded in step (3) exhibits an optical response to the addition of activated Cas12a enzyme.
[0078] In this invention, the DNA in the liquid crystal biosensor interface reaches saturation in step (3); preferably, the concentration of the DNA solution in step (4) is ≥0.01μM; more preferably, the concentration of the encoding DNA solution is 0.01~100μM.
[0079] According to a preferred embodiment of the present invention, the pH of the Tris buffer solution in step (4) is 7 to 8.
[0080] According to a preferred embodiment of the present invention, the solvent used for the DNA solution in step (4) is a buffer solution containing 20 mM Tri-HCl, 150 mM NaCl, 5 mM KCl, 0.5 mM MgCl2, and pH = 7.5.
[0081] The detection method of the liquid crystal biosensor for detecting protein markers described above includes the following steps:
[0082] S1. Mixing ready-to-use reagents with samples: Mix the pre-diluted sample with the ready-to-use reagent frozen in the EP tube at room temperature, shake well and set aside.
[0083] S2, Add DNA-modified liquid crystal sensing substrate: Add the solution obtained in S1 to the DNA-modified liquid crystal sensing substrate, and observe the changes in liquid crystal optical signals using a polarizing microscope or a self-made mobile phone-based small device.
[0084] S3. Visual Signal Collection and Processing: Quantitative or Semi-quantitative Detection: Collect liquid crystal optical morphology images every 5 minutes, process the liquid crystal images to obtain the brightness ratio, and use the dynamic relationship between brightness ratio and time to obtain quantitative or semi-quantitative data. Qualitative Detection: After the liquid crystal morphology has stabilized for 30-90 minutes, observe visually or collect liquid crystal morphology image data for analysis using software.
[0085] S4. For actual samples, such as saliva samples, due to the high concentration of salivary mucin, which has a strong non-specific adsorption capacity and a strong matrix effect, saliva samples require pretreatment. The pretreatment steps are as follows: Add an equal volume of polystyrene microspheres to the saliva sample, shake well, dilute with loading buffer, shake gently for 3-10 minutes, centrifuge for 1-5 minutes using a handheld centrifuge to remove large particles and polystyrene microspheres, filter through a 0.45μm filter membrane to further remove polystyrene microspheres and small particles, then add 50-300μL to an EP tube containing ready-to-use reagents, mix well, and drop onto the liquid crystal detection chip.
[0086] According to a preferred embodiment of the present invention, the protein markers in step S1 include, but are not limited to, carcinoembryonic antigen and SARS-CoV-2N protein, wherein the nucleotide sequence of the carcinoembryonic antigen aptamer is TAG CTA TAG GGG GTG AAG GGA TACCC.
[0087] According to a preferred embodiment of the present invention, the pre-dilution ratio in step S1 is 5-10 times.
[0088] According to a preferred embodiment of the present invention, the sample loading buffer in steps S1 and S4 comprises 20 mM Tri-HCl, 150 mM NaCl, 5 mM KCl, 0.5 mM MgCl2, and a pH of 7.5.
[0089] According to a preferred embodiment of the present invention, the polystyrene characteristics preferred in step S4 are single-particle properties, water solubility, high stability, positive charge, particle size of 5 μm, and high specific surface area.
[0090] According to a preferred embodiment of the present invention, the final concentration of polystyrene in step S4 is preferably 0.1-5 mg / mL.
[0091] According to a preferred embodiment of the present invention, the detection method further includes: establishing a working curve based on the changes in the standard solution of cancer markers and their liquid crystal optical morphology, thereby realizing the quantitative detection of multiple cancer markers in the sample to be tested.
[0092] The technical features of this invention are as follows:
[0093] This invention involves the chemical synthesis of a nucleic acid aptamer sequence linked to a Cas12a enzyme activation sequence via a TTTTTTTTT spacer. This linker sequence is adsorbed onto graphene oxide, a method already reported in the literature, ensuring a better signal-to-noise ratio and less matrix effect in subsequent experiments. Initially, because the nucleic acid aptamer-activation sequence is adsorbed onto the graphene, it cannot activate the Cas12a enzyme. When the target protein is present, due to the specific recognition and binding of the target protein to the nucleic acid aptamer, the nucleic acid aptamer-activation sequence detaches from the graphene, allowing it to bind to the Cas12a enzyme and activate it. This process utilizes the nucleic acid aptamer to ensure specific recognition, thus achieving specific detection.
[0094] In the presence of the target protein, Cas12a is activated, generating the ability to cleave any DNA sequence. A one-to-many relationship exists between the target protein and the cleaved DNA, amplifying the signal. After the DNA modified at the liquid crystal interface is cleaved, it affects the orientation of the interface liquid crystal molecules. This molecular orientation is further transmitted from the interface to the bulk phase (transmission depth approximately 50 μm), further amplifying the signal. This invention ensures detection sensitivity through this cascaded amplification method.
[0095] The liquid crystal detection chip influences the birefringence of light through changes in molecular orientation, generating a visible optical morphology signal. It requires only a button battery-powered LED as a light source, and the signal can be obtained through direct visual observation or by taking a picture with a mobile phone. The data acquisition method is similar to that of commonly used gold particle colorimetric test strips. It does not rely on large instruments, facilitating real-time detection. This invention can also be used for semi-quantitative and quantitative detection; that is, after obtaining the signal image, software programs automatically identify and process it to obtain the brightness ratio (Br), and a standard curve is established using the Br of a standard sample to obtain semi-quantitative and quantitative data.
[0096] The required reagents can be pre-frozen in EP tubes. When using, simply mix the sample with the frozen powder in the EP tube and then add it to the detection chip. No complicated procedures or experienced personnel are required. The detection process is similar to commonly used gold particle colorimetric test strips.
[0097] The method of identifying target proteins based on nucleic acid aptamers is universal, meaning that other target proteins can be detected by changing the nucleic acid aptamer. This overcomes the problem of current liquid crystal sensors requiring the design and synthesis of specific sensing films tailored to the characteristics of the target protein. It also facilitates widespread application to the detection of other protein biomarkers.
[0098] The present invention is further illustrated using the COVID-19 N protein as an example.
[0099] The detection principle of the SARS-CoV-2 N protein in the examples is as follows: Figure 1 As shown, when the SARS-CoV-2N protein is present, the corresponding nucleic acid aptamer recognizes the target and detaches from the graphene due to a conformational change. Upon entering the bulk phase, the Cas12a activation sequence pre-linked to the aptamer binds to the crRNA in the Cas12a enzyme, thereby activating the Cas12a ribozyme activity. The activated Cas12a enzyme affects the orientation of liquid crystal molecules at the interface by cleaving the DNA pre-modified on the liquid crystal interface. This molecular orientation is further transmitted into the bulk phase, amplifying the signal. Furthermore, the change in molecular orientation affects the birefringence of the liquid crystal film, resulting in a visible change in the optical signal.
[0100] Example 1: Preparation using reagents
[0101] A method for preparing a ready-to-use reagent for detecting the N protein of SARS-CoV-2, comprising the following steps:
[0102] The ligation sequence and graphene oxide were mixed in HEPES buffer (10 mM HEPES, 300 mM NaCl, pH 7.5) and incubated for 3 h, followed by incubation at 95 °C for 5 min, and then slowly cooled to room temperature. The ratio of ligation sequence to graphene oxide was 1 nmol / 10 μg to ensure saturated adsorption of the ligation DNA onto the graphene oxide. An aptamer containing a CRISPR-Cas12a activated dsDNA sequence and a complementary DNA sequence were denatured and annealed at a 1:1 ratio, with the activated sequence undergoing specific complementary base pairing to form double-stranded DNA. The annealed aptamer-activated sequence was added to the graphene oxide containing the ligation sequence and incubated at room temperature for 30 min to ensure binding of the aptamer-activated sequence to the graphene oxide via complementary base pairing. The ratio of aptamer-activated sequence to graphene oxide was 1 nmol / 10 μg. BSA (1 mg / mL) was added and incubated overnight to block the graphene oxide. Centrifuge at 10,000 rpm for 10 minutes at 25°C, remove the supernatant, wash the precipitate, and repeat three times to remove free DNA. Store the prepared complex at 4°C for later use. Incubate Cas12a enzyme and crRNA at a 2:1 ratio for 1 hour to obtain the Cas12a-crRNA complex.
[0103] The prepared aptamer-activating sequence-graphene complex was mixed with the cas12a-crRNA complex and a ribozyme inhibitor. The concentration of the aptamer-activating sequence-graphene complex in the mixture was 10 μg / mL, the concentration of the cas12a-crRNA complex was 50 pM, and the concentration of the ribozyme inhibitor was 5 U / μL. The total volume was 100 μL. The prepared mixed solution without the test sample was frozen at -80°C for 2 h, then vacuum dried at -50°C for 12 h; the lyophilized powder was stored at 4°C for later use.
[0104] The nucleotide sequence for detecting the N protein of the novel coronavirus is ACT TAT GCT GGA TGT CGC TTA CGA CAATAT TCC TTA GGG GCA CCG CTA CAT TGA CAC ATC CAG C.
[0105] The CRISPR-Cas12a activation dsDNA sequence is TTTG GAT GAA TGC TAG CCT GTG TC; GA CACAGG CTA GCA TTC ATC CAAA.
[0106] The crRNA sequence is UAA UUU CUA CUA AGU GUA GAU GAT GAA TGC TAG CCT GTG TC.
[0107] The ligation DNA sequence is ACA TCC AGC ATA AGT TTT TTT CCC CCC CCC CCC CC.
[0108] The sample buffer solution consisted of 10 mM Tri-HCl, 150 mM NaCl, 5 mM KCl, 0.5 mM MgCl2, and pH 7.5.
[0109] Example 2: Fabrication of a liquid crystal detection chip
[0110] A method for preparing a liquid crystal detection chip for detecting the N protein of SARS-CoV-2, comprising the following steps:
[0111] (1) Preparation of glass substrate: The glass slide was immersed in 60 mL of a washing solution prepared by mixing 98% concentrated sulfuric acid and 30% hydrogen peroxide in a volume ratio of 7:3. The slide was immersed at 75°C for 30 min, then washed three times each with water, anhydrous ethanol and methanol, dried with nitrogen, dried at 110°C for 12 h, placed in a 0.5% DMOAP solution at room temperature for 15 min, washed five times with three distilled water, dried with nitrogen, cured at 105°C for 3 h, and cooled to obtain the glass substrate.
[0112] (2) Place the G75 copper mesh at the bottom of a separate channel, and inject 1.5 μL of OTAB-doped 4-cyano-4'-pentylbiphenyl heated to 35-45°C into the copper mesh while it is still hot. Then, remove the excess OTAB-doped 4-cyano-4'-pentylbiphenyl with a capillary tube with an inner diameter of 0.5 mm to construct a liquid crystal biosensor interface. The thickness of the liquid crystal biosensor interface is the same as the thickness of the copper mesh, which is about 20 μm.
[0113] The above-mentioned method for preparing OTAB-doped 4-cyano-4'-pentylbiphenyl is as follows: OTAB powder is dissolved in chloroform to prepare a 0.1 mM OTAB chloroform solution. The OTAB chloroform solution and 4-cyano-4'-pentylbiphenyl are mixed at a volume ratio of 1:1 and vortexed at 2500 rpm for 3 min to mix thoroughly. The chloroform is then dried with nitrogen to obtain OTAB-doped 4-cyano-4'-pentylbiphenyl.
[0114] (3) Prepare a 0.01 μM solution of reporter DNA using a buffer solution of 10 mM Tri-HCl, 150 mM NaCl, 5 mM KCl, 0.5 mM MgCl2, and pH 7.5. Modify the liquid crystal biosensor interface, let it stand at room temperature for 60 min, and then exchange the solution with Tris buffer (pH 7-8) ten times to wash away the free reporter DNA, thus obtaining the liquid crystal biosensor.
[0115] The nucleotide sequence of the reporter DNA is TAG CGA TAG TAG
[0116] Example 3: Method for detecting SARS-CoV-2N protein
[0117] A method for detecting the N protein of SARS-CoV-2, which requires the use of ready-to-use reagents in conjunction with a detection chip, includes the following steps:
[0118] S1. Mix 20 μL of PBS solution containing different concentrations of SARS-CoV-2 N protein with 80 μL of loading buffer and shake well. Then add the mixture to an EP tube containing ready-to-use reagent, shake well and set aside.
[0119] S2. Add the mixed ready-to-use reagent and sample mixture obtained in S1 to the DNA-modified liquid crystal sensing substrate. Observe the changes in the liquid crystal optical signal using a polarizing microscope or a self-made mobile phone-based small device. For quantitative or semi-quantitative detection, liquid crystal optical morphology images need to be collected every 5 minutes. This operation can be completed by setting automatic timed photography using mobile phone software.
[0120] S3. Visual Signal Collection and Processing: Quantitative or Semi-quantitative Detection: Collect liquid crystal optical morphology images every 5 minutes, process the liquid crystal images to obtain the brightness ratio, and use the slope of brightness change over time to obtain quantitative or semi-quantitative data. Qualitative Detection: After the liquid crystal morphology stabilizes for 30-90 minutes, visually observe or collect liquid crystal morphology image data and analyze it using software to obtain the brightness ratio, thereby qualitatively estimating the concentration.
[0121] Data Processing: MATLAB was used to automatically identify the images and calculate the values. The calculation principle is that bright and dark areas have different grayscale values. Based on a threshold set by machine learning, bright and dark areas are distinguished. The proportion of bright area pixels to the entire liquid crystal image area is calculated to obtain the proportion of the bright area in the initial liquid crystal morphology. Then, this method is used to obtain the proportion of the bright area in the liquid crystal after adding the sample. The difference between the two is the change in bright area. A working curve is obtained by plotting the standard concentration on the x-axis and the change in bright area on the y-axis. The working curve is shown below. Figure 2 As shown, standard solutions of known concentrations were subsequently tested, and the yields were determined to be between 92.1% and 110.6%.
[0122] The working curve for the SARS-CoV-2 N protein is y = 44.02x - 1.91, R0 2 =0.985; detection limit is 0.31 ng / mL.
[0123] Example 4: Detection of SARS-CoV-2N protein in actual samples (saliva)
[0124] Saliva samples from healthy individuals were collected and mixed with different concentrations of SARS-CoV-2N protein to simulate saliva samples from COVID-19 patients. Saliva samples from healthy individuals were also collected and mixed with an equal volume of PBS solution as a control. Positively charged polystyrene microspheres with a particle size of 5 μm and high specific surface area were then added to the saliva samples. After shaking well, the samples were diluted with loading buffer (total dilution factor of 10 times), gently shaken for 2-3 minutes, and centrifuged using a handheld centrifuge to remove large particles and polystyrene microspheres. The mixture was then filtered through a 0.45 μm filter to further remove polystyrene microspheres and small particles. 100 μL of the solution was added to an EP tube containing ready-to-use reagents, mixed well, and then dropped onto a liquid crystal detection chip.
[0125] Data processing: Algorithm software was used to identify and process the data, calculate the bright areas, input them into the working curve, and determine the SARS-CoV-2 N protein concentration. The yield of N protein in saliva is shown in Table 1.
[0126] Table 1. Yield of N protein detected in saliva
[0127]
[0128] The above description is merely a specific embodiment of the present invention, and the scope of protection of the present invention is not limited thereto. Any variations or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed in the present invention should be included within the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be determined by the scope defined in the claims.
Claims
1. A liquid crystal biosensor for detecting target proteins, the sensor comprising a ready-to-use detection reagent and a nucleic acid molecule-functionalized liquid crystal detection interface, the ready-to-use detection reagent comprising the following elements or components: a Cas enzyme-crRNA complex with cleavage activity and an activation sequence locking system based on a nucleic acid aptamer-activation sequence-two-dimensional material, wherein the nucleic acid molecule-functionalized liquid crystal detection interface is an ssDNA-modified liquid crystal interface, wherein the nucleic acid aptamer specifically recognizes the target protein to be detected; The nucleic acid aptamer-activated sequence locking system is a nucleic acid aptamer-activated sequence-graphene complex, the structure of which is that the nucleic acid aptamer-activated sequence is coupled by a spacer sequence and then adsorbed onto the graphene surface by a linker sequence. The Cas enzyme is Cas12a; The activation dsDNA sequence is TTTG GAT GAA TGC TAG CCT GTG TC; GA CAC AGG CTA GCA TTCATC CAAA; The ligation DNA sequence is ACA TCC AGC ATA AGT TTT TTT CCC CCC CCC CCC CC; The crRNA sequence is UAA UUU CUA CUA AGU GUA GAU GAT GAA TGC TAG CCT GTG TC; The target protein is the SARS-CoV-2 N protein, and the corresponding aptamer sequence is: ACT TAT GCT GGA TGT CGC TTACGA CAA TAT TCC TTA GGG GCA CCG CTA CAT TGA CAC ATC CAG C; The liquid crystal interface is formed by 4-cyano-4'-pentylbiphenyl, and the DNA molecule that modifies the liquid crystal interface is TAG CGA TAGTAG. The modification is covalent or non-covalent.
2. Use of the liquid crystal biosensor of claim 1 in the preparation of diagnostic kits.
3. A diagnostic kit comprising the liquid crystal biosensor of claim 1.
4. The diagnostic kit according to claim 3, wherein the ready-to-use test reagent and the corresponding buffer component are in the form of a mixed cryopreserved powder.