Plant biomass saccharifying enzyme composition

Abstract

Provided are: an enzyme preparation which is effective for reducing the viscosity when saccharifying plant biomass; and a method for producing the enzyme preparation. An enzyme composition comprising the following (A), (B) and (C): (A) a cellulase; (B) a homopolygalacturonic acid decomposing enzyme comprising a polygalacturonase and a pectin lyase; and (C) one or more substances selected from the group consisting of arabinofuranosidase and galactanase.

Description

Technical Field

[0001] The present invention relates to saccharifying enzyme compositions for plant biomass. Background Art

[0002] The technology of biorefining of sugar or value-added products from plant biomass raw materials of renewable resources is highly anticipated as a method for building a sustainable society. Among biomass raw materials, agricultural production waste containing starch or cellulose can obtain a large amount of sugar, i.e., glucose, which is the most commonly used fermentation raw material by decomposing it, and therefore many technical developments for recovering sugar from these biomass raw materials have been implemented. In addition, it is known that in addition to starch and cellulose, plant biomass raw materials also contain hemicellulose, pectin, and lignin.

[0003] Pectin is present in large quantities in the primary cell wall of plants and in the middle lamella located in the intercellular space. It is a complex polysaccharide mainly composed of three domains: homogalacturonic acid (HG), rhamnogalacturonic acid I (RG-I), and rhamnogalacturonic acid II (RG-II). HG is a polymer mainly composed of polygalacturonic acid, which is formed by α-1,4-bonding of D-galacturonic acid in which part of the carboxyl group at the 6th position is methylated and part of the hydroxyl groups at the 2nd and 3rd positions are acetylated. Rhamnogalacturonic acid I (RG-I) is a polymer with a repeating structure of rhamnose and galacturonic acid disaccharides as the main chain, and has galactan side chains connected by galactose residues, arabinan side chains connected by arabinose residues, and arabinogalactan side chains composed of arabinose residues and galactose residues. Rhamnogalacturonan II (RG-II) is a domain with the most complex structure among pectins. It is composed of a polygalacturonic acid main chain formed by α-1,4-bonding, and side chains composed of about 30 sugars such as L-rhamnose, D- or L-galactose, L-arabinose, D-galacturonic acid, D-glucuronic acid, D-apiose, L-fucose, 2-O-methyl-L-fucose, 2-O-methyl-D-xylose, aceric acid (3-O-carboxy-5-deoxy-L-xylose), 2-keto-3-deoxy-D-manno-2-octulose, and 3-deoxy-D-lyxo-2-hepturonic acid are bonded to the O-2 position or O-3 position of the galacturonic acid.

[0004] Pectin does not contain glucose and is thought to have no effect on the amount of glucose that can be recovered from plant residues. However, the high viscosity of pectin poses a major challenge to the recovery efficiency of sugars from sugar liquids (which are obtained by decomposing plant biomass) and to the sugar production process.

[0005] In the saccharification process of pectin-containing plant biomass using enzymes, amylase and amyloglucosidase for converting starch into glucose, and cellulase for converting cellulose into glucose are required. In addition, in order to reduce the viscosity of the sugar solution, a technology of combining cellulase with pectinase is also used. For example, it is known to add polygalacturonase (Patent Document 1), add arabinan endo-1,5-alpha-L-arabinosidase (Patent Document 2), etc.

[0006] However, the viscosity-lowering effect is not necessarily sufficient, and commercially available pectinase preparations contain a variety of enzymes in addition to enzymes involved in viscosity reduction, resulting in a large amount required, which is not practical in terms of cost.

[0007] Therefore, when saccharifying pectin-containing plant biomass, it is necessary to develop an enzyme preparation that can reduce the viscosity of the sugar solution at low cost.

[0008] Patent Document 1: Japanese Patent Publication No. 59-37953

[0009] Patent Document 2: International Patent Publication No. 2015 / 097017 Summary of the invention

[0010] The present invention relates to the following 1) to 9).

[0011] 1) An enzyme composition comprising the following (A), (B) and (C):

[0012] (A) cellulase;

[0013] (B) homogalacturonase comprising polygalacturonase and pectin lyase;

[0014] (C) at least one selected from the group consisting of arabinofuranosidase and galactanase.

[0015] 2) A method for saccharifying plant biomass, comprising: bringing the enzyme composition described in 1) into contact with the plant biomass.

[0016] 3) A method for producing sugar from plant biomass, comprising: bringing the enzyme composition described in 1) into contact with the plant biomass.

[0017] 4) A method for producing ethanol from plant biomass, comprising: bringing the enzyme composition described in 1) into contact with the plant biomass.

[0018] 5) A recombinant filamentous fungus, wherein (b1) a polygalacturonase gene, (b2) a pectin lyase gene, and (c) one or more genes selected from the group consisting of an arabinofuranosidase gene and a galactanase gene are introduced.

[0019] 6) A method for producing the enzyme composition described in 1), comprising the step of culturing the recombinant filamentous fungus described in 5).

[0020] 7) A plant biomass viscosity reducer, comprising the enzyme composition described in 1) as an active ingredient.

[0021] 8) A method for reducing the viscosity of plant biomass, comprising: bringing the enzyme composition described in 1) into contact with plant biomass.

[0022] 9) Use of the enzyme composition described in 1) for reducing the viscosity of plant biomass. DETAILED DESCRIPTION

[0023] The present invention relates to an enzyme preparation effective for reducing the viscosity of plant biomass during saccharification and a method for producing the same.

[0024] The inventors of the present invention have found that an enzyme composition containing a blend of cellulase and a specific pectinase can effectively suppress the increase in viscosity of slurry when saccharifying pectin-containing plant biomass, and that the enzyme composition can be easily produced using a recombinant filamentous fungus.

[0025] According to the present invention, it is possible to provide inexpensively a saccharifying enzyme composition that suppresses the increase in viscosity of slurry in a saccharification process of plant biomass containing pectin and enables efficient saccharification of plant biomass.

[0026] (1. Enzyme composition)

[0027] The enzyme composition of the present invention comprises the following (A), (B) and (C):

[0028] (A) Cellulase,

[0029] (B) homogalacturonase comprising polygalacturonase and pectin lyase,

[0030] (C) at least one selected from the group consisting of arabinofuranosidase and galactanase.

[0031] (A) Cellulase is a general term for enzymes that decompose cellulose, including endoglucanases (EC 3.2.1.4) that cut cellulose from the inside of the molecule, exoglucanases (cellobiohydrolases, EC 3.2.1.91) that decompose cellulose from the reducing or non-reducing ends to release cellobiose, and β-glucosidases (EC 3.2.1.21). In the present invention, enzymes belonging to any of these categories may be used, and multiple types may be used in combination.

[0032] As the origin of this cellulase, Bacillus subtilis, Aspergillus niger, Irpex lacteus, Humicura insorens, Trichoderma viride, Trichoderma reesei and the like are known. In the present invention, cellulase derived from the genus Trichoderma is preferably used.

[0033] In the present invention, the cellulase may be in the form of a culture obtained by solid culture or liquid culture of the above-mentioned cellulase-producing bacteria according to a conventional method, a concentrate obtained by purifying it, or a crude enzyme powder obtained by drying it. In addition, commercially available cellulase preparations, such as Celluclast (NOVOZYME), Meicelase (Meiji Seika Pharma Co., Ltd.), Sumizyme C, Sumizyme AC (Shin Nippon Chemical Industry Co., Ltd.), etc., may also be used.

[0034] From the viewpoint of inhibiting the saccharification of biomass and the increase in viscosity of the slurry, the cellulase is formulated as follows: for example, so that the cellulase activity of the enzyme composition is 2.0 U or more, preferably 2.2 U or more, more preferably 2.4 U or more, and 5.0 U or less, preferably 4.0 U or less, more preferably 3.6 U or less, or 2.0 to 5.0 U, preferably 2.2 to 4.0 U, more preferably 2.4 to 3.6 U per 1 mg of protein in the enzyme composition.

[0035] The cellulase activity refers to the value obtained by quantifying the reducing sugar as the product of the enzyme reaction by colorimetric method by allowing the cellulase to act at pH 4.8 and 50°C using filter paper as a substrate, wherein 1 unit (1U) of enzyme refers to the amount of enzyme that generates 1 μmol of reducing sugar equivalent to glucose in 1 minute.

[0036] The homogalacturonase (B) is an enzyme that decomposes the homogalacturonic acid (HG) domain in pectin, and in the present invention, includes at least polygalacturonase and pectin lyase.

[0037] Polygalacturonase is an enzyme that hydrolyzes the α-1,4-glycosidic bond of D-galacturonic acid constituting pectin acid (EC 3.2.1.15).

[0038] Pectin lyase is an enzyme that catalyzes a reaction that converts pectin into oligosaccharides having an unsaturated bond between C-4 and C-5 of the terminal residues (EC 4.2.2.10).

[0039] As polygalacturonase and pectin lyase in the present invention, enzymes from Aspergillus, Penicillium, Rhizopus, etc. can be used. The polygalacturonase and pectin lyase can be in the form of a culture obtained by solid culture or liquid culture of a microorganism having polygalacturonase production ability or pectin lyase production ability according to a conventional method, a concentrate obtained by purifying it, or a crude enzyme powder obtained by drying it. In addition, commercially available polygalacturonase preparations and pectin lyase preparations can also be used, for example, Sumizyme AP2 (Shin Nippon Chemical Industry Co., Ltd.), Sucrase N (Mitsubishi Chemical), and polygalacturonase solution (Sigma, P4716) from Aspergillus niger.

[0040] The polygalacturonase is formulated as follows: for example, so that the polygalacturonase activity of the enzyme composition is 30 U or more, specifically, 30 U or more, preferably 60 U or more, more preferably 90 U or more, more preferably 150 U or more, and 1200 U or less, preferably 600 U or less, more preferably 450 U or less, or preferably 30 to 1200 U, more preferably 60 to 600 U, more preferably 90 to 450 U, more preferably 150 to 450 U, per 1 mg of protein in the enzyme composition.

[0041] The polygalacturonase activity refers to the value obtained by quantifying the reducing sugar as the product of the enzyme reaction by a colorimetric method when polygalacturonic acid solution is used as a substrate and polygalacturonic acid is allowed to act on it at pH 4.0 and 50°C, wherein 1 unit (1U) of the enzyme refers to the amount of enzyme that generates 1 μmol of reducing sugar equivalent to D-galacturonic acid within 1 minute.

[0042] The pectin lyase is formulated as follows: for example, the pectin lyase activity of the enzyme composition is 1 U or more, specifically, 1 U or more, preferably 1.5 U or more, more preferably 1.7 U or more, and 27 U or less, preferably 16 U or less, more preferably 10 U or less, or preferably 1 to 27 U, more preferably 1.5 to 16 U, more preferably 1.7 to 10 U, per 1 mg of protein in the enzyme composition.

[0043] The pectin lyase activity refers to the process of using polygalacturonic acid solution as substrate to allow pectin lyase to act at pH 4.0 and 50°C, and converting the unsaturated oligogalacturonic acid as the product of the enzyme reaction into unsaturated digalacturonic acid with a molar molecular absorption coefficient of 4600 M -1 cm -1 The value obtained by measurement is that 1 unit (1U) of the enzyme means the amount of the enzyme that generates 1 μmol of unsaturated oligogalacturonic acid in 1 minute.

[0044] The arabinofuranosidase (c) is an enzyme that hydrolyzes arabinose side chains from the non-reducing end side and is classified into EC 3.2.1.55.

[0045] Galactanase is a hydrolase that hydrolyzes the glycosidic bonds of galactan and is classified into EC 3.2.1.89, EC 3.2.1.164, and EC 3.2.1.181.

[0046] Rhamnogalacturonic acid I (RG-I) in pectin is a polymer having a repeating structure of a disaccharide of rhamnose and galacturonic acid as the main chain, and having galactan side chains formed by connecting galactose residues, arabinan side chains formed by connecting arabinose residues, and arabinogalactan side chains composed of arabinose residues and galactose residues. Arabinofuranosidase and galactanase participate in the decomposition of the side chains of the rhamnogalacturonic acid I (RG-I) structure in pectin. In this sense, in the present invention, the arabinofuranosidase and galactanase are sometimes referred to as pectinase.

[0047] As the arabinofuranosidase and galactanase in the present invention, enzymes from the genus Aspergillus, Penicillium, Rhizopus, etc. can be used. The arabinofuranosidase and galactanase may be in the form of a culture obtained by solid culture or liquid culture of a microorganism having the ability to produce arabinofuranosidase or galactanase, respectively, according to a conventional method, a concentrate obtained by purifying the same, or a crude enzyme powder obtained by drying the same. In addition, commercially available arabinofuranosidase preparations and galactanase preparations can also be used, for example, α-L-arabinofuranosidase (Aspergillus niger) (Megazyme, E-AFASE), α-L-arabinofuranosidase (Aspergillus nidulans) (Megazyme, E-ABFAN), endo-β-1,4-galactanase (Aspergillus niger) (Megazyme, E-EGALN), endo-β-1,4-galactanase (Cellvibrio japonicus) (Megazyme, E-GALCJ), endo-β-1,4-galactanase (Clostridium thermocellum) (Megazyme, E-GALCT).

[0048] Arabinofuranosidase is formulated as follows: for example, so that the arabinofuranosidase activity of the enzyme composition is 0.1 U or more, specifically, 0.1 U or more, preferably 1 U or more, more preferably 3 U or more, and 50 U or less, preferably 25 U or less, more preferably 15 U or less, or preferably 0.1 to 50 U, more preferably 1 to 25 U, more preferably 3 to 15 U, per 1 mg of protein in the enzyme composition.

[0049] Here, arabinofuranosidase activity refers to the value obtained by allowing arabinofuranosidase to act at pH 4.0 and 50°C using a 4-nitrophenyl-α-L-arabinofuranoside solution as a substrate, and quantifying 4-nitrophenol as the enzyme reaction product by a colorimetric method, wherein 1 unit (1U) of enzyme refers to the amount of enzyme that generates 1 μmol of 4-nitrophenol in 1 minute.

[0050] The galactanase is formulated as follows: for example, so that the galactanase activity of the enzyme composition is 3 U or more, specifically, 3 U or more, preferably 5 U or more, more preferably 20 U or more, and 250 U or less, preferably 100 U or less, more preferably 80 U or less, or preferably 3 to 250 U, more preferably 5 to 100 U, more preferably 20 to 80 U, per 1 mg of protein in the enzyme composition.

[0051] The galactanase activity refers to the value obtained by quantifying the reducing sugar as the enzyme reaction product by a colorimetric method when galactanase is allowed to act at pH 4.0 and 50°C using a galactan solution as a substrate, wherein 1 unit (1U) of the enzyme refers to the amount of enzyme that generates 1 μmol of reducing sugar equivalent to galactose in 1 minute.

[0052] The enzyme composition of the present invention can be formulated by mixing the three enzymes (A), (B) and (C) mentioned above and, if necessary, various carriers, excipients and other additives conventionally used in such enzyme preparations. The dosage form is tablets, powders, granules, liquids, etc., and can be formulated by conventional methods.

[0053] In addition, in the enzyme composition of the present invention, the content ratio of (B) homogalacturonanase and (C) one or more selected from arabinofuranosidase and galactanase ((B) + (C)) is preferably 1% by mass or more, more preferably 5% by mass or more, more preferably 10% by mass or more, and preferably 50% by mass or less, more preferably 45% by mass or less, more preferably 40% by mass or less, based on the ratio contained in the protein in the enzyme composition. In addition, it is preferably 1% to 50% by mass, more preferably 5% to 45% by mass, and more preferably 10% to 40% by mass.

[0054] In the (B) homogalacturonase, the ratio of polygalacturonase to pectin lyase to be used is not particularly limited, and they can be blended at any ratio.

[0055] The enzyme composition of the present invention may also contain enzymes other than (A) to (C), such as amylase, glucoamylase, β-glucosidase, glucanase, hemicellulase, xylanase, xylosidase, protease, lipase, etc., as appropriate.

[0056] The enzyme composition of the present invention is an enzyme composition (plant biomass saccharifying agent) for saccharifying plant biomass (preferably pectin-containing plant biomass), and more specifically, is an enzyme composition that reduces the viscosity of the plant biomass after saccharification compared to the case of saccharification using only cellulase.

[0057] Examples of biomass that can be treated by the enzyme composition include substances containing cellulose and pectin, such as tubers such as cassava, sweet potato, potato, or their residues; corn, corn husk, apple residues, citrus peels, etc., preferably cassava or cassava residues.

[0058] (2. Production of enzyme composition using recombinant filamentous fungi)

[0059] The enzyme composition of the present invention can also be produced by culturing a recombinant filamentous fungus into which (b1) a polygalacturonase gene, (b2) a pectin lyase gene, and (c) one or more genes selected from an arabinofuranosidase gene and a galactanase gene have been introduced.

[0060] Examples of the (b1) polygalacturonase gene include the PgaB gene, the PgaI gene, and the PgaII gene.

[0061] The polygalacturonase gene is preferably derived from a filamentous fungus, and preferred examples include genes derived from microorganisms of the genus Aspergillus (e.g., Aspergillus niger, Aspergillus japonicus, Aspergillus aculeatus), microorganisms of the genus Rhizopus (e.g., Rhizopus oryzae, Rhizopus delemar), microorganisms of the genus Talaromyces (e.g., Talaromyces cellulolyticus), microorganisms of the genus Penicillium (e.g., Penicillium roqueforti), and the like.

[0062] Among them, the PgaB gene, PgaI gene, and PgaII gene of Aspergillus niger are more preferred.

[0063] The PgaB gene of Aspergillus niger is registered in the public database of NCBI with the accession number XM_025597756 (SEQ ID NO: 1).

[0064] The PgaI gene of Aspergillus niger is registered in the public database of NCBI with the accession number XM_025596768 (SEQ ID NO: 3).

[0065] The PgaII gene of Aspergillus niger is registered in the public database of NCBI with the accession number XM_025602343.1 (SEQ ID NO: 5).

[0066] Examples of the (b2) pectin lyase gene include the PelD gene and the PelF gene.

[0067] The pectin lyase gene is preferably derived from filamentous fungi, and examples thereof include genes derived from microorganisms of the genus Aspergillus (e.g., Aspergillus niger, Aspergillus japonicus, Aspergillus ludhuensis, Aspergillus aculeatus), microorganisms of the genus Penicillium (e.g., Penicillium digitatum, Penicillium solitum), and microorganisms of the genus Talaromyces (e.g., Talaromyces rugulosus, Talaromyces cellulosus)).

[0068] Among them, the PelD gene and the PelF gene of Aspergillus niger are more preferred.

[0069] The PelD gene of Aspergillus niger is registered in the NCBI database with the accession number XM_025604039.1 (sequence number 7).

[0070] The PelF gene of Aspergillus niger is registered in the NCBI database with the accession number XM_001401024.2 (sequence number 9).

[0071] (c) Examples of the arabinofuranosidase gene include the Abf gene, and examples of the galactanase gene include the Gal gene.

[0072] The arabinofuranosidase gene and the galactanase gene are preferably derived from filamentous fungi, and preferred examples include genes derived from microorganisms of the genus Aspergillus (e.g., Aspergillus niger, Aspergillus japonicus, Aspergillus aculeatus), microorganisms of the genus Rhizopus (e.g., Rhizopus oryzae, Rhizopus delemar), microorganisms of the genus Talaromyces (e.g., Talaromyces cellulolyticus), microorganisms of the genus Trichoderma (e.g., Trichoderma reesei), and microorganisms of the genus Penicillium (e.g., Penicillium roqueforti, Penicillium chrysogenum).

[0073] Among them, the Abf gene and the Gal gene of Aspergillus niger are more preferred.

[0074] The Abf gene of Aspergillus niger is registered in the NCBI database with accession number L29005.1 (amino acid sequence AAC41644.1) (SEQ ID NO: 11). The Gal gene of Aspergillus niger is registered in the NCBI database with accession number AJ305303.1 (amino acid sequence CAC83735.1) (SEQ ID NO: 13).

[0075] As a means for introducing the (b1) polygalacturonase gene, the (b2) pectin lyase gene, and (c) one or more genes selected from the group consisting of the arabinofuranosidase gene and the galactanase gene in the present invention into filamentous fungi, for example, a vector or DNA fragment containing a polynucleotide encoding each enzyme gene is introduced into a host filamentous fungus (parent strain).

[0076] Wherein, the vector containing the polynucleotide encoding each enzyme gene is an expression vector, preferably an expression vector capable of importing the polynucleotide into a host filamentous fungus and expressing the polynucleotide in the host. In addition, the vector preferably comprises the polynucleotide and a control region operably connected thereto. The vector can be a plasmid or the like that can autonomously propagate and replicate outside the chromosome, or a vector that is integrated into the chromosome.

[0077] Here, "operably linked" means that the gene and the control region are linked in such a way that the gene can be expressed under the control of the control region. The steps of "operably linking" a gene and a control region are well known to those skilled in the art.

[0078] Specific examples of the vector include, for example, pBluescript II SK(-) (Stratagene), pUC18 / 19, pUC118 / 119 and other pUC vectors (Takara Bio), pET vectors (Takara Bio), pGEX vectors (GE Healthcare), pCold vectors (Takara Bio), pHY300PLK (Takara Bio), pUB110 (Mckenzie, T. et al., 1986, Plasmid 15 (2): 93-103), pBR322 (Takara Bio), pRS403 (Stratagene), pMW218 / 219 (Nippon Gene), pRI909 / 910 and other pRI vectors (Takara Bio), pBI vectors (Clontech), IN3 vectors (Inplanta Innovations), pPTR1 / 2 (Takara Bio), pDJB2 (DJBallance et al., 1996), pQB2 (DJBallance et al., 2001 ... al., Gene, 36, 321-331, 1985), pAB4-1 (van Hartingsveldt W et al., Mol Gen Genet, 206, 71-75, 1987), pLeu4 (MIGRoncero et al., Gene, 84, 335-343, 1989), pPyr225 (CD Skory et al., Mol Genet) Genomics, 268, 397-406, 2002), pFG1 (Gruber, F. et al., Curr Genet, 18, 447-451, 1990), etc.

[0079] Examples of DNA fragments containing polynucleotides encoding the respective enzyme genes include PCR amplified DNA fragments and restriction enzyme-cleaved DNA fragments. Preferably, the DNA fragment may be an expression cassette comprising the polynucleotide of the present invention and a control region operably linked thereto.

[0080] The control region contained in the above-mentioned vector or DNA fragment is a sequence for expressing each enzyme gene of the present invention in a host into which the vector or DNA fragment is introduced, and for example, expression regulatory regions, replication origins, etc. such as promoters or terminators can be cited. The type of the control region can be appropriately selected according to the type of host cell into which the vector or DNA fragment is to be introduced. As required, the vector or DNA fragment can also have a selection marker such as an antibiotic tolerance gene, an amino acid synthesis-related gene, etc.

[0081] Preferably, the control region contained in the above-mentioned vector or DNA fragment is operably linked to the upstream of (b1) polygalacturonase gene, (b2) pectate lyase gene and (c) one or more genes selected from arabinofuranosidase gene and galactanase gene, and is a control region (so-called strong control region) having the function of constitutively expressing or highly expressing downstream genes. Examples of such strong control regions include cbh1 promoter, cbh2 promoter, egl1 promoter, xyn1 promoter, xyn2 promoter, xyn3 promoter, etc. of Trichoderma reesei.

[0082] Further examples of the strong control region include, but are not limited to, the control region of the rRNA operon, the control region of the gene encoding ribosomal protein, and the like.

[0083] The target polynucleotide and control region contained in the above-mentioned vector or DNA fragment can be introduced into the host's cell nucleus, but can also be introduced into the host genome. Alternatively, the target polynucleotide contained in the above-mentioned vector or DNA fragment can be directly introduced into the host genome and operably connected to the high expression promoter on the genome. As a means for introducing polynucleotides into the genome, homologous recombination can be cited.

[0084] The vector or DNA fragment can be introduced into the above-mentioned host cells by using a common transformation method, for example, electroporation, transformation, transfection, conjugation, protoplast method, gene gun method, Agrobacterium method and the like.

[0085] The recombinant filamentous bacteria imported with the target vector or DNA fragment can be selected using a selection marker. For example, when the selection marker is an antibiotic tolerance gene, by culturing cells in a culture medium adding the antibiotic, it is possible to select a transformed cell imported with the target vector or DNA fragment. In addition, for example, when the selection marker is an amino acid synthesis-related gene, after the filamentous strain of the amino acid defect is genetically introduced, the filamentous strain imported with the target vector or DNA fragment can be selected with the presence or absence of the amino acid defect as an index. Alternatively, by investigating the DNA sequence of the recombinant strain using PCR, it is also possible to confirm the introduction of the target vector or DNA fragment.

[0086] According to the above steps, a recombinant filamentous fungus can be prepared in which the (b1) polygalacturonase gene, (b2) pectin lyase gene and (c) one or more genes selected from the group consisting of arabinofuranosidase gene and galactanase gene of the present invention are introduced into a filamentous strain. The recombinant filamentous fungus of the present invention has the ability to produce cellulase, homopolygalacturonase, and arabinofuranosidase and / or galactanase.

[0087] The filamentous fungi used as the host (parent strain) in the present invention are not limited as long as they are fungi that produce cellulase as a biomass saccharifying enzyme and are of a genus or species different from the introduced (b1) polygalacturonase gene, (b2) pectin lyase gene and (c) one or more genes selected from arabinofuranosidase gene and galactanase gene. Examples include filamentous fungi belonging to the phylum Eumycota and phylum Oomycota. Specifically, examples of the filamentous fungi include Trichoderma, Aspergillus, Penicillium, Neurospora, Fusarium, Chrysosporium, Humicola, Emericella, Hypocrea, Acremonium, Chrysosporium, Myceliophthora, Piromyces, Talaromyces, Thermoascus, and Thielavia, and are preferably filamentous fungi of the genus Trichoderma.

[0088] Examples of the filamentous fungi of the genus Trichoderma include Trichoderma reesei, Trichoderma longibrachiatum, Trichoderma harzianum, Trichoderma koningii, and Trichoderma viride. Trichoderma reesei is preferred, and Trichoderma reesei PCD-10 strain (FERM P-8172) and Trichoderma reesei PC-3-7 strain (ATCC66589) are more preferred.

[0089] The filamentous fungus used as the parent strain may be a wild-type strain, a strain artificially cultivated from the wild-type strain, or a variant (mutant) or mutant in which the nucleotide sequence in the genome is substituted, added, deleted or modified.

[0090] As a preferred example of the recombinant filamentous fungi of the present invention, there can be listed recombinant filamentous fungi in which the PgaB gene of Aspergillus niger, the PelD gene of Aspergillus niger, the Abf gene of Aspergillus niger or the Gal gene of Aspergillus niger are introduced into Trichoderma reesei PC-3-7 strain (ATCC66589) or its variants. Specifically, the strains disclosed in the examples described below can be listed.

[0091] The above-mentioned recombinant filamentous fungi are cultured in the presence of a cellulase-inducing substance, enzymes are generated and accumulated in the culture, and the enzymes are collected from the culture, thereby producing an enzyme composition comprising: (A) cellulase, (B) homogalacturonase comprising polygalacturonase and pectin lyase, and (C) one or more selected from arabinofuranosidase and galactanase.

[0092] Among them, the "cellulase inducing substance" is not limited as long as it is a substance that induces the production of cellulase by cellulase-producing filamentous fungi, and examples thereof include: cellulose; sophorose; and compounds selected from cellooligosaccharides such as cellobiose, cellotriose, cellotetraose, cellopentaose and cellohexaose.

[0093] Among them, cellulose includes polymers formed by polymerization of glucose through β-1,4-glycosidic bonds and derivatives thereof. There is no particular limitation on the degree of polymerization of glucose. In addition, derivatives such as carboxymethylation, hydroformylation or esterification can be cited. In addition, cellulose can be a complex with β-glucoside as a glycoside, lignin and / or hemicellulose, such as lignocellulose, and a complex with pectin, etc. Cellulose can be crystalline cellulose or non-crystalline cellulose.

[0094] The cellulase inducing substance can be added by any method such as one-time addition (batch method), batch addition (batch feeding method) or continuous addition (feeding method). The amount of the cellulase inducing substance added to the culture medium can be any amount that can induce the filamentous fungi of the present invention to produce cellulase and pectinase, and it varies according to the addition method. The total amount is preferably 0.1% by mass or more, more preferably 0.5% by mass or more, more preferably 1% by mass or more, and preferably 40% by mass or less, more preferably 35% by mass or less, and more preferably 30% by mass or less. In addition, it is preferably 0.1-40% by mass, more preferably 0.5-35% by mass, and more preferably 1-30% by mass.

[0095] Among them, the amount added in the case of one-time addition is preferably 0.1% by mass or more, more preferably 0.5% by mass or more, more preferably 1% by mass or more, and preferably 16% by mass or less, more preferably 14% by mass or less, more preferably 12% by mass or less. In addition, it is preferably 0.1 to 16% by mass, more preferably 0.5 to 14% by mass, and more preferably 1 to 12% by mass.

[0096] The culture medium used in the method of the present invention may contain nutrients necessary for the growth of the filamentous fungi of the present invention and the production of cellulase and pectinase, such as carbon sources, nitrogen sources, inorganic salts, and vitamins, and may be any type of synthetic medium or natural medium.

[0097] As a carbon source, as long as it is a carbon source that can be utilized by the recombinant filamentous bacteria of the present invention, specifically, in addition to the above-mentioned cellulase inducing substances, sugars such as glucose and fructose; alcohols such as ethanol and glycerol; organic acids such as acetic acid, etc. can also be listed. These can be used alone or in combination. As a carbon source, it is desirable to use sugars such as glucose and fructose, and glucose is more preferred. At this time, the amount of glucose added is preferably 0.1% by mass or more, more preferably 0.5% by mass or more, more preferably 2.5% by mass or more, and preferably 15% by mass or less, more preferably 10% by mass or less, and more preferably 5% by mass or less, relative to the culture medium. In addition, it is preferably 0.1 to 15% by mass, more preferably 0.5 to 10% by mass, and more preferably 2.5 to 5% by mass. In addition, the amount of cellulase inducing substances and glucose in the culture medium is preferably 10:1 to 1:1 in terms of mass ratio, and more preferably 4:1 to 2:1.

[0098] Examples of the nitrogen source include ammonia, ammonium salts such as ammonium sulfate, nitrogen compounds such as amines, and natural nitrogen sources such as peptone and soybean hydrolyzate.

[0099] Examples of the inorganic salt include potassium phosphate, magnesium sulfate, sodium chloride, ferrous sulfate, potassium carbonate, and the like.

[0100] Examples of vitamins include biotin and thiamine, etc. If necessary, substances required for the growth and development of the recombinant filamentous fungus of the present invention may be added.

[0101] The culture is preferably carried out under aerobic conditions such as shaking culture or aeration stirring culture. The culture temperature is preferably 10°C or higher, more preferably 20°C or higher, more preferably 25°C or higher, and preferably 50°C or lower, more preferably 42°C or lower, more preferably 35°C or lower. In addition, it is preferably 10 to 50°C, more preferably 20 to 42°C, and more preferably 25 to 35°C.

[0102] The pH during the culture is 3 to 9, preferably 4 to 5. The culture time is 10 hours to 10 days, preferably 2 to 7 days.

[0103] After the cultivation is completed, the culture is recovered, and the cell is crushed by ultrasound or pressure as required, and after solid-liquid separation by filtration or centrifugation, ultrafiltration, salting out, dialysis, chromatography, etc. are appropriately combined to obtain an enzyme composition comprising (A) cellulase, (B) homogalacturonase comprising polygalacturonase and pectin lyase, and (C) one or more enzyme compositions selected from arabinofuranosidase and galactanase. In addition, there is no particular limitation on the degree of separation and purification. The culture supernatant or its crude separation and purification product itself can also be used as the enzyme composition of the present invention.

[0104] (3. Saccharification of plant biomass)

[0105] By using the enzyme composition of the present invention, plant biomass is decomposed and saccharified, so that monosaccharides can be manufactured. Specifically, the enzyme composition of the present invention is contacted (coexisted) with biomass in an aqueous medium, stirred or vibrated, and heated, thereby saccharifying the plant biomass, so that monosaccharides can be manufactured. In this case, compared with the case of saccharification treatment using only cellulase, the viscosity of the slurry after saccharification treatment can be reduced by more than 50%, and the degree of reduction is preferably more than 60%, more preferably more than 70%. That is, according to the enzyme composition of the present invention, in the saccharification treatment of plant biomass such as cassava containing a large amount of pectin, high viscosity can be suppressed and saccharification efficiency can be improved. Therefore, the enzyme composition of the present invention can also be used as a plant biomass viscosity reducer, and can be used for reducing the viscosity of plant biomass. That is, by contacting the enzyme composition of the present invention with plant biomass, the viscosity of plant biomass can be reduced.

[0106] Examples of the viscosity include a viscosity measured at a solid content concentration of 10 to 20% by mass and 50° C. using a B-type viscometer.

[0107] In the saccharification of plant biomass, the pH and temperature of the reaction solution may be within the ranges in which cellulase and pectinase are not inactivated, and generally, when the reaction is carried out under normal pressure, the temperature is 5 to 95° C. and the pH is 1 to 11.

[0108] The process of saccharifying plant biomass may be performed in a batch process or in a continuous process.

[0109] (4. Production of ethanol)

[0110] Ethanol can be produced by adding ethanol fermentation microorganisms to the sugar solution obtained by saccharifying plant biomass and performing fermentation. As ethanol fermentation microorganisms, yeasts of the genus Saccharomyces, the genus Kluyveromyces, or bacteria of the genus Zymomonas are known, but are not limited to these. Fermentation is carried out, for example, under the following conditions: 24 to 96 hours; temperature 26 to 34°C; pH is pH 3 to 6, preferably pH 4 to 5. In addition, the saccharification step and the fermentation step may be carried out separately or simultaneously as parallel multiple fermentations (synchronous saccharification and fermentation, SSF). SSF can be carried out by adding yeast and enzymes together, for example, under the following conditions: 24 to 96 hours; temperature 26 to 34°C; pH is pH 3 to 6, preferably pH 4 to 5. When implementing SSF, a pre-saccharification step at a temperature exceeding 50°C may be carried out before fermentation. Further details about the method for carrying out saccharification and fermentation are well known to those skilled in the art.

[0111] The present invention also includes the following embodiments as examples, but the present invention is not limited to these embodiments.

[0112] <1> An enzyme composition comprising the following (A), (B) and (C):

[0113] (A) cellulase;

[0114] (B) homogalacturonase comprising polygalacturonase and pectin lyase;

[0115] (C) at least one selected from the group consisting of arabinofuranosidase and galactanase.

[0116] <2> The enzyme composition according to <1>, wherein the enzyme composition is used for saccharification of plant biomass.

[0117] <3> The enzyme composition according to <2>, wherein the enzyme composition can reduce the viscosity of the plant biomass after saccharification compared to the case where the saccharification is performed using only cellulase.

[0118] <4> The enzyme composition according to <3>, wherein the enzyme composition can reduce the slurry viscosity of plant biomass by 50% or more, preferably 60% or more, and more preferably 70% or more, compared to a case where saccharification is performed using cellulase alone.

[0119] <5> An enzyme composition as described in any one of <1> to <4>, wherein the cellulase activity is 2.0U or more, preferably 2.2U or more, more preferably 2.4U or more, and 5.0U or less, preferably 4.0U or less, more preferably 3.6U or less, or 2.0-5.0U, preferably 2.2-4.0U, more preferably 2.4-3.6U per 1mg of protein in the enzyme composition.

[0120] <6> An enzyme composition as described in any one of <1> to <5>, wherein the polygalacturonase activity is 30 U or more, preferably 60 U or more, more preferably 90 U or more, more preferably 150 U or more, and is 1200 U or less, preferably 600 U or less, more preferably 450 U or less, or is preferably 30-1200 U, more preferably 60-600 U, more preferably 90-450 U, more preferably 150-450 U, per 1 mg of protein in the enzyme composition.

[0121] <7> An enzyme composition as described in any one of <1> to <6>, wherein the pectin lyase activity is 1 U or more, preferably 1.5 U or more, more preferably 1.7 U or more, and is 27 U or less, preferably 16 U or less, more preferably 10 U or less, or preferably 1 to 27 U, more preferably 1.5 to 16 U, more preferably 1.7 to 10 U, per 1 mg of protein in the enzyme composition.

[0122] <8> An enzyme composition as described in any one of <1> to <7>, wherein the arabinofuranosidase activity is 0.1U or more, preferably 1U or more, more preferably 3U or more, and 50U or less, preferably 25U or less, more preferably 15U or less, or preferably 0.1 to 50U, more preferably 1 to 25U, more preferably 3 to 15U per 1 mg of protein in the enzyme composition.

[0123] <9> An enzyme composition as described in any one of <1> to <8>, wherein the galactanase activity is 3 U or more, preferably 5 U or more, more preferably 20 U or more, and 250 U or less, preferably 100 U or less, more preferably 80 U or less, per 1 mg of protein in the enzyme composition, or preferably 3 to 250 U, more preferably 5 to 100 U, more preferably 20 to 80 U.

[0124] <10> An enzyme composition as described in any one of <1> to <9>, wherein the content ratio of (B) homogalacturonase and (C) one or more selected from arabinofuranosidase and galactanase ((B) + (C)) in the enzyme composition per unit protein is preferably 1 or more, more preferably 5 or more, more preferably 10 or more, and preferably 50 or less, more preferably 45 or less, more preferably 40 or less, or preferably 1-50, more preferably 5-45, more preferably 10-40.

[0125] <11> A method for saccharifying plant biomass, comprising the step of contacting the enzyme composition according to any one of <1> to <10> with the plant biomass.

[0126] <12> A method for producing sugar from plant biomass, comprising the step of contacting the enzyme composition according to any one of <1> to <10> with the plant biomass.

[0127] <13> A method for producing ethanol from plant biomass, comprising the step of contacting the enzyme composition according to any one of <1> to <10> with the plant biomass.

[0128] <14> The method according to any one of <11> to <13>, wherein the plant biomass is pectin-containing plant biomass.

[0129] <15> The method according to any one of <11> to <13>, wherein the plant biomass is cassava or a residue thereof.

[0130] <16> The method according to <14> or <15>, wherein the method can reduce the viscosity of the plant biomass contacted with the enzyme composition of any one of <1> to <10> compared to a case where the plant biomass is contacted with cellulase alone.

[0131] <17> A recombinant filamentous fungus, wherein (b1) a polygalacturonase gene, (b2) a pectin lyase gene, and (c) one or more genes selected from the group consisting of an arabinofuranosidase gene and a galactanase gene are introduced.

[0132] <18> The method for producing an enzyme composition according to any one of <1> to <10>, comprising the step of culturing the recombinant filamentous fungus according to <17>.

[0133] <19> The recombinant filamentous fungus according to <17>, wherein (b1) the polygalacturonase gene is the PgaB gene, (b2) the pectate lyase gene is the PelD gene, and (c) is the Abf gene or the Gal gene.

[0134] <20> The method according to <18>, wherein (b1) the polygalacturonase gene is the PgaB gene, (b2) the pectate lyase gene is the PelD gene, and (c) is the Abf gene or the Gal gene.

[0135] <21> A plant biomass viscosity reducer, comprising the enzyme composition described in any one of <1> to <2> and <5> to <10> as an active ingredient.

[0136] <22> A method for reducing the viscosity of plant biomass, wherein:

[0137] The method comprises the step of contacting the enzyme composition according to any one of <1> to <2> and <5> to <10> with plant biomass.

[0138] <23> Use of the enzyme composition according to any one of <1> to <2> and <5> to <10> for reducing the viscosity of plant biomass.

[0139] Example

[0140] <Example 1: Preparation of cellulase>

[0141] Cellulase was obtained by culturing Trichoderma reesei E1AB1 strain (Enzyme and Microbial Technology, Vol. 82, January 2016, pp. 89-95).

[0142] The culture was carried out as follows. On an enzyme production medium (3% KC Flock W-400G (Nippon Paper), 0.14% (NH4)2SO4, 1.28% diammonium citrate, 0.2% KH2PO4, 0.03% Cacl2·2H2O, 0.03% MgSO4·7H2O, 0.1% Bacto peptone, 0.05% Bacto yeast extract, 0.1% Tween 80, 0.1% trace element, 50 mM tartaric acid buffer (pH 4.0); % are w / v%), spores of the strain were grown to 2×10 5 The cells were inoculated at 100 μg / mL and cultured with shaking at 28°C for 5 days.

[0143] The composition of trace elements is as follows: 6 mg of H3BO3, 26 mg of (NH4)6Mo7O 24·4H2O, 100 mg of FeCl3·6H2O, 40 mg of CuSO4·5H2O, 8 mg of MnCl2·4H2O, and 200 mg of ZnCl2 were fixed to 100 mL with distilled water. The obtained culture was centrifuged, and the supernatant was filtered through a filter. The obtained culture supernatant was used as cellulase for the following research.

[0144] <Example 2: Preparation of pectinase>

[0145] (1) cDNA Synthesis of Aspergillus niger NBRC105649

[0146] Aspergillus niger (A. niger) strain NBRC105649 was purchased from the Biotechnology Center of the Product Evaluation Technology Foundation. The NBRC105649 strain was inoculated into a pectin medium (1% pectin from citrus (Wako Pure Chemical Industries, Ltd.), 0.14% (NH4)2SO4, 0.2% KH2PO4, 0.03% Cacl2·2H2O, 0.03% MgSO4·7H2O, 0.1% Bacto peptone, 0.05% Bacto yeast extract, 0.1% trace element, 50 mM tartaric acid buffer (pH 4.0). The culture was shaken at 28°C for 3 days, and the cultured cells were recovered with Miracloth (Millipore), frozen with liquid nitrogen, and disrupted with a multi-bead oscillator (MultiBeads Shocker, Yasui Instruments). At this time, a metal cone was used as the pulverizing medium, and the cells were disrupted at 1700 rpm for 30 seconds. The disrupted cells were spun using RNeasy Mini RNA was extracted using a QIAQUICK® Kit (QIAGEN) according to the protocol. The RNA solution was then used in a SuperScript III First-Strand Synthesis System for RT-PCR (Thermo Fisher Scientific) to synthesize cDNA of the NBRC105649 strain.

[0147] (2) Preparation of expression vectors for Pga, Pel, Abf, Gal, and Bga1

[0148] Using the Pichia expression vector pD912 (ATUM) as a template, PCR was performed using the Fw primer 1 (sequence number 15) and Rv primer 1 (sequence number 16) shown in Table 1 to amplify fragment (A). Using the cDNA of the NBRC105649 strain as a template, PCR was performed using the Fw primer 2 (sequence number 17) and Rv primer 2 (sequence number 18) shown in Table 1 to amplify the amplified fragment (B). The obtained DNA fragments (A) and (B) were processed according to the operating specifications of the In-Fusion HD Cloning Kit (Takara Bio) to construct the connection plasmid pD912-Pga.

[0149] The amplified fragment (C) was amplified by PCR using the cDNA of the NBRC105649 strain as a template and the Fw primer 3 (sequence number 19) and Rv primer 3 (sequence number 20) shown in Table 1. The obtained DNA fragments (A) and (C) were processed according to the operating specifications of the In-Fusion HD Cloning Kit to construct the connection plasmid pD912-Pel.

[0150] The amplified fragment (D) was amplified by PCR using the cDNA of the NBRC105649 strain as a template and the Fw primer 4 (sequence number 21) and Rv primer 5 (sequence number 22) shown in Table 1. The obtained DNA fragments (A) and (D) were processed according to the operating specifications of the In-Fusion HD Cloning Kit to construct the connection plasmid pD912-AnAbf.

[0151] The amplified fragment (E) was amplified by PCR using the cDNA of the NBRC105649 strain as a template and the Fw primer 5 (sequence number 23) and Rv primer 5 (sequence number 24) shown in Table 1. The obtained DNA fragments (A) and (E) were processed according to the operating specifications of the In-Fusion HD Cloning Kit to construct the connection plasmid pD912-AnGal.

[0152] The amplified fragment (I) was amplified by PCR using the cDNA of the NBRC105649 strain as a template and the Fw primer X (sequence number 48) and Rv primer X (sequence number 49) shown in Table 1. The obtained DNA fragments (A) and (I) were processed according to the operating specifications of the In-Fusion HD Cloning Kit to construct the connection plasmid pD912-Bga1.

[0153] [Table 1]

[0154] Primers for gene fragment amplification

[0155] Primer name sequence Sequence number Fw Primer 1 TAAAGGGGCGGCCGCTCAAGAG 15 Rv Primer 1 AGCTTCGGCCTCTCTTTTCT 16 Fw Primer 2 AGAGAGGCCGAAGCTGCTCCTCTCGAGAAGCGCTC 17 Rv Primer 2 GCGGCCGCCCCTTTATTAATCGCTGCAGGAAGCGC 18 Fw Primer 3 AGAGAGGCCGAAGCTGTCGGTGTCTCCGGCACTCC 19 Rv Primer 3 GCGGCCGCCCCTTTATTACAGGTTACCCTGACCAG 20 Fw Primer 4 AGAGAGGCCGAAGCTATCTCCTTGAAGGTCTCCAC 21 Rv Primer 4 GCGGCCGCCCCTTTACTAGTTCGCCGCCAGGACAG 22 Fw Primer 5 AGAGAGGCCGAAGCTGCCCTGACCTACCGCGGGGC 23 Rv Primer 5 GCGGCCGCCCCTTTATCAGAGGTCCTCAAACACGG 24 Fw Primer 17 AGAGAGGCCGAAGCTGCCCAGAACCAGACGGAGAC 48 Rv Primer 17 GCGGCCGCCCCTTTATCAAGCAAACTTCAACCTCT 49

[0156] (3) Preparation of transformants

[0157] Pichia pastoris PPS-90102 (ATUM) was transformed with each target gene expression vector prepared in (2) according to the operating procedures of ATUM.

[0158] (4) Cultivation of transformants

[0159] The culture of Pichia pastoris was carried out as follows. Each transformant was inoculated on BMD1% medium (0.2M potassium phosphate (pH6.0), 13.4g / L yeast nitrogen base (Yeast Nitrogen Base), 0.4mg / L biotin (Biotin), 1.1% glucose), and shake culture was carried out at 28°C. After the bacterial cells increased to a certain amount, methanol was added to induce expression. After 3 to 5 days, each culture was centrifuged and separated after the enzyme expression amount was confirmed by SDS-PAGE for each culture obtained, and then filtered through a filter to obtain each culture supernatant. The obtained culture supernatant was concentrated and used as various pectinase (Pga, Pel, Abf, Gal) enzyme solutions.

[0160] <Example 3> Quantification of protein

[0161] The protein concentration of the enzyme solution was quantitatively measured by the Coomassie Brilliant Blue method (Bradford method). The Coomassie Brilliant Blue method (Bradford method) was performed using Quick Start Protein Assay (Bio-Rad) to calculate the protein concentration based on a standard curve using bovine serum albumin as a standard protein.

[0162] <Example 4> Determination of enzyme units

[0163] (1) Pectate lyase activity

[0164] The method for determining the activity of pectate lyase is as follows. For 80 μL of substrate solution prepared by mixing 25 μL of 1% (w / v) polygalacturonic acid (polygalacturonic acid sodium salt, Sigma-Aldrich), 10 μL of 0.5M sodium acetate buffer (pH 4.0), and 45 μL of milliQ water, add 20 μL of enzyme solution appropriately diluted with milliQ water, react at 50°C for 5 minutes, and then add 100 μL of 50mM hydrochloric acid aqueous solution to stop the enzyme reaction. After stirring and mixing, measure the absorbance at 235nm. As a blank, a sample is prepared in which an enzyme solution is added after adding a hydrochloric acid aqueous solution to the reaction solution treated without adding the enzyme solution. The amount of unsaturated oligogalacturonic acid generated is calculated using the molar molecular absorption coefficient of unsaturated digalacturonic acid, 4600M -1 cm -1 One unit (1U) of the enzyme is defined as the amount of the enzyme that generates unsaturated oligogalacturonic acid equivalent to 1 μmol of unsaturated digalacturonic acid in 1 minute under the above reaction conditions.

[0165] (2) Polygalacturonase activity

[0166] The method for determining polygalacturonase activity is as follows. For 80 μL of substrate solution prepared by mixing 25 μL of 1% (w / v) polygalacturonic acid (polygalacturonic acid sodium salt, Sigma-Aldrich), 10 μL of 0.5M sodium acetate buffer (pH 4.0), and 45 μL of milliQ water, add 20 μL of enzyme solution appropriately diluted with milliQ water, react at 50°C for 5 minutes, add 100 μL of 3,5-dinitrosalicylic acid reagent, and color development of reducing sugars is performed at 99°C for 10 minutes. After rapid cooling in ice water, the absorbance at 540 nm is measured to determine the amount of reducing sugars generated. As a blank, a sample is prepared by adding 3,5-dinitrosalicylic acid reagent to the reaction solution treated without adding enzyme, adding enzyme solution, and performing color development in the same manner. One unit (1U) of enzyme is defined as the amount of enzyme that releases reducing sugars equivalent to 1 μmol of D-galacturonic acid in 1 minute under the above reaction conditions. When both polygalacturonase and pectin lyase are present in the enzyme solution, the difference obtained by subtracting the unit of pectin lyase obtained by (1) from the unit calculated from the amount of reducing sugar is taken as the polygalacturonase activity.

[0167] (3) Arabinofuranosidase activity

[0168] The method for determining the activity of arabinofuranosidase is as follows. For 80 μL of substrate solution prepared by mixing 20 μL of 5 mM 4-nitrophenyl-α-L-arabinofuranoside (Sigma-Aldrich), 10 μL of 0.5 M sodium acetate buffer (pH 4.0), and 40 μL of milliQ water, add 20 μL of enzyme solution appropriately diluted with milliQ water, react at 50°C for 5 minutes, add 100 μL of 0.4 M sodium carbonate, and measure the absorbance at 420 nm. As a blank, a sample of enzyme solution inactivated at 99°C is added after adding sodium carbonate solution to the reaction solution obtained by treatment without adding enzyme solution. One unit (1U) of enzyme is defined as the amount of enzyme that generates 1 μmol of 4-nitrophenol in 1 minute under the above reaction conditions.

[0169] (4) Galactanase activity

[0170] The method for determining galactanase activity is as follows. For 80 μL of substrate solution prepared by mixing 25 μL of 1% (w / v) galactan (Galactan (Potato), Megazyme), 10 μL of 0.5M sodium acetate buffer (pH 4.0), and 45 μL of milliQ water, add 20 μL of enzyme solution appropriately diluted with milliQ water, react at 50°C for 5 minutes, add 100 μL of 3,5-dinitrosalicylic acid reagent, and color development of reducing sugars is performed at 99°C for 10 minutes. After rapid cooling in ice water, the absorbance at 540 nm is measured to determine the amount of reducing sugars generated. As a blank, a sample is prepared in which 3,5-dinitrosalicylic acid reagent is added to the reaction solution obtained by treatment without adding enzymes, and then the enzyme solution is added and color development is performed in the same manner. One unit (1 U) of the enzyme is defined as the amount of the enzyme that releases reducing sugars equivalent to 1 μmol of galactose in 1 minute under the above reaction conditions.

[0171] (5) Cellulase activity

[0172] The cellulase activity was measured by the microplate-scale filter paper decomposition activity test method reported in "MICROPLATE-BASEDFILTER PAPER ASSAY TO MEASURE TOTAL CELLULASE ACTIVITY" (BIOTECHNOLOGY AND BIOENGINEERING, December 30, 2004; 88(7): 832-7. DOI: 10.1002 / BIT.20286.). 20 μL of the appropriately diluted sample was added to 40 μL of citric acid buffer (50 mM, pH 4.8) containing filter paper cut to a diameter of 7 mm (WHATMAN NO.1, GE HEALTHCARE), and the reaction was carried out at 50°C for 1 hour. A sample without filter paper was prepared in the same manner and used as a blank sample. Then, 120 μL of DNS solution was added to stop the reaction, heated at 95°C for 5 minutes, and cooled in ice water for 5 minutes. The resulting solution 36 μL is mixed with 160 μL of milliQ water, the absorbance at 540nm of the mixed solution is measured, and the absorbance increase is calculated with the value after deducting the blank. Next, a standard curve made of glucose concentration and absorbance at 540nm of gradient dilution is used to calculate the amount of reducing sugar generated in the reaction solution with the glucose amount conversion value. The same operation is performed with samples of different dilution rates to obtain the dilution rate of the sample required to generate reducing sugar equivalent to 0.08mg glucose / 20μL cellulase solution, and the filter paper decomposition activity (FPU / mL) of the sample before dilution is calculated. Further, the concentration of cellulase is measured by the method of Example 4, and the unit of expression of cellulase activity is converted to FPU / mg-protein. Regarding the activity unit, the enzyme activity of reducing sugar equivalent to 1μmol of glucose in 1 minute is set to "1U".

[0173] <Example 5> Measurement of viscosity

[0174] The viscosity was measured using a tuning fork vibration viscometer (SV-10H manufactured by A&D Corporation).

[0175] Test example: Saccharification of cassava residue

[0176] <Test Example 1-Comparative Example>

[0177] 4 g of cassava residue was weighed in a 100 mL baffled conical flask by dry weight, and 0.002 mg-protein / g-substrate of α-amylase and ultrapure water (milli-Q water) were added to make the substrate concentration 15 wt%. Then, the baffled flask was fully mixed, sealed with a cotton plug and covered with aluminum foil, and gelatinized at 90°C for 2 hours (autoclave, LSX-700 manufactured by TOMY). Then, after cooling to 50°C with an oscillator set to 50°C (PRXY-30-R-3F manufactured by PRECI), glucoamylase was added to make it 0.05 mg-protein / g-substrate, and the reaction was carried out at 50°C and 200 rpm for 18 hours. After saccharification, it did not become a liquid state, and its viscosity could not be measured.

[0178] <Test Example 2-Comparative Example>

[0179] The same examination as in Test Example 1 was conducted except that the enzyme composition 1 shown in Table 2 was further added to the gelatinized substrate so as to give 0.2 mg-protein / g-substrate. The slurry after saccharification was not in a liquid state, and its viscosity could not be measured.

[0180] <Test Example 3-Comparative Example>

[0181] The same examination as in Test Example 1 was conducted except that the enzyme composition 2 shown in Table 2 was further added to the substrate after gelatinization so as to have 0.2 mg-protein / g-substrate. The viscosity of the slurry after saccharification was 84 mPa·s.

[0182] <Test Example 4-Comparative Example>

[0183] The same examination as in Test Example 1 was conducted except that the enzyme composition 3 shown in Table 2 was further added to the substrate after gelatinization so as to have a concentration of 0.2 mg-protein / g-substrate. The viscosity of the slurry after saccharification was 79 mPa·s.

[0184] <Test Example 5-Comparative Example>

[0185] The same examination as in Test Example 1 was conducted except that the enzyme composition 4 shown in Table 2 was further added to the substrate after gelatinization so as to have a concentration of 0.2 mg-protein / g-substrate. The viscosity of the slurry after saccharification was 459 mPa·s.

[0186] <Test Example 6>

[0187] The same examination as in Test Example 1 was conducted except that the enzyme composition 5 shown in Table 3 was further added to the substrate after gelatinization so as to have a content of 0.16 mg-protein / g-substrate. The viscosity of the slurry after saccharification was 26.8 mPa·s.

[0188] <Test Example 7>

[0189] The same examination as in Test Example 1 was conducted except that the enzyme composition 6 shown in Table 3 was further added to the substrate after gelatinization so as to have a content of 0.16 mg-protein / g-substrate. The viscosity of the slurry after saccharification was 16.6 mPa·s.

[0190] <Test Example 8>

[0191] The same examination as in Test Example 1 was conducted except that the enzyme composition 7 shown in Table 3 was further added to the substrate after gelatinization so as to have a content of 0.16 mg-protein / g-substrate. The viscosity of the slurry after saccharification was 14.5 mPa·s.

[0192] <Test Example 9>

[0193] The same examination as in Test Example 1 was conducted except that the enzyme composition 8 shown in Table 3 was further added to the substrate after gelatinization so as to have a content of 0.16 mg-protein / g-substrate. The viscosity of the slurry after saccharification was 17.3 mPa·s.

[0194] <Test Example 10>

[0195] The same examination as in Test Example 1 was conducted except that the enzyme composition 9 shown in Table 4 was further added to the substrate after gelatinization so as to have a content of 0.15 mg-protein / g-substrate. The viscosity of the slurry after saccharification was 47.3 mPa·s.

[0196] <Test Example 11>

[0197] The same examination as in Test Example 1 was conducted except that the enzyme composition 10 shown in Table 4 was further added to the substrate after gelatinization so as to have a content of 0.15 mg-protein / g-substrate. The viscosity of the slurry after saccharification was 37.9 mPa·s.

[0198] <Test Example 12>

[0199] The same examination as in Test Example 1 was conducted except that the enzyme composition 11 shown in Table 4 was further added to the substrate after gelatinization so as to have a content of 0.15 mg-protein / g-substrate. The viscosity of the slurry after saccharification was 19.7 mPa·s.

[0200] <Test Example 13>

[0201] The same examination as in Test Example 1 was conducted except that the enzyme composition 12 shown in Table 4 was further added to the substrate after gelatinization so as to have a content of 0.15 mg-protein / g-substrate. The viscosity of the slurry after saccharification was 17.3 mPa·s.

[0202] <Test Example 14>

[0203] The same examination as in Test Example 1 was conducted except that the enzyme composition 13 shown in Table 4 was further added to the substrate after gelatinization so as to have a content of 0.15 mg-protein / g-substrate. The viscosity of the slurry after saccharification was 23.1 mPa·s.

[0204] <Test Example 15>

[0205] The same examination as in Test Example 1 was conducted except that the enzyme composition 14 shown in Table 4 was further added to the substrate after gelatinization so as to have a content of 0.15 mg-protein / g-substrate. The viscosity of the slurry after saccharification was 23.8 mPa·s.

[0206] <Test Example 16>

[0207] The same examination as in Test Example 1 was conducted except that the enzyme composition 15 shown in Table 4 was further added to the substrate after gelatinization so as to have a content of 0.15 mg-protein / g-substrate. The viscosity of the slurry after saccharification was 19.9 mPa·s.

[0208] <Test Example 17>

[0209] The same examination as in Test Example 1 was conducted except that the enzyme composition 16 shown in Table 4 was further added to the substrate after gelatinization so as to have a content of 0.15 mg-protein / g-substrate. The viscosity of the slurry after saccharification was 39.0 mPa·s.

[0210] <Test Example 18-Comparative Example>

[0211] The same examination as in Test Example 1 was conducted except that the enzyme composition 17 shown in Table 5 was further added to the substrate after gelatinization so as to have a content of 0.14 mg-protein / g-substrate. The viscosity of the slurry after saccharification was 115 mPa·s.

[0212] <Test Example 19>

[0213] The same examination as in Test Example 1 was conducted except that the enzyme composition 18 shown in Table 5 was further added to the substrate after gelatinization so as to have a content of 0.14 mg-protein / g-substrate. The viscosity of the slurry after saccharification was 71.8 mPa·s.

[0214] <Test Example 20>

[0215] The same examination as in Test Example 1 was conducted except that the enzyme composition 19 shown in Table 6 was further added to the substrate after gelatinization so as to have a content of 0.13 mg-protein / g-substrate. The viscosity of the slurry after saccharification was 49.1 mPa·s.

[0216] <Test Example 21>

[0217] The same examination as in Test Example 1 was conducted except that the enzyme composition 20 shown in Table 6 was further added to the substrate after gelatinization so as to have a content of 0.15 mg-protein / g-substrate. The viscosity of the slurry after saccharification was 47.5 mPa·s.

[0218] <Test Example 22-Comparative Example>

[0219] The same study as in Test Example 1 was conducted except that the enzyme composition 21 containing AnBga1, a pectin side chain degrading enzyme shown in Table 7, was further added to the substrate after gelatinization so as to be 0.15 mg-protein / g-substrate. The viscosity of the slurry after saccharification was 1440 mPa·s. AnBga1 is β-galactosidase, which is an exo-type galactan degrading enzyme.

[0220] <Test Example 23-Comparative Example>

[0221] The same study as in Test Example 1 was conducted except that the enzyme composition 22 containing E-ARABCJ (Megazyme) which is a pectin side chain degrading enzyme shown in Table 7 was further added to the substrate after gelatinization so as to be 0.15 mg-protein / g-substrate. The viscosity of the slurry after saccharification was 4010 mPa·s. E-ARABCJ is an endo-type arabinan degrading enzyme.

[0222] <Test Example 24-Comparative Example>

[0223] The same study as in Test Example 1 was conducted except that the E-BGLAN (Megazyme) enzyme composition 23 of the pectin side chain degrading enzyme shown in Table 7 was further added to the substrate after gelatinization so as to be 0.15 mg-protein / g-substrate. The viscosity of the slurry after saccharification was 530 mPa·s. E-BGLAN is β-galactosidase, which is an exo-type galactan degrading enzyme.

[0224] [Table 2]

[0225]

[0226] [Table 3]

[0227]

[0228] [Table 4]

[0229]

[0230] [Table 5]

[0231]

[0232] [Table 6]

[0233]

[0234] [Table 7]

[0235]

[0236] <Example 6> Construction of cellulase and pectinase producing strain

[0237] (1) Construction of Gal expression vector

[0238] Plasmid pUC-eg3, in which the region from upstream to downstream of the eg3 gene from Trichoderma reesei (SEQ ID NO. 47) was inserted into the HincII restriction enzyme cut point of pUC118 (Takara Bio), was used as a template, and PCR was performed using Fw primer 6 (SEQ ID NO. 25) and Rv primer 6 (SEQ ID NO. 26) shown in Table 7 to amplify fragment (A). In addition, PCR was performed using genomic DNA of Trichoderma reesei as a template, and Fw primer 7 (SEQ ID NO. 27) and Rv primer 7 (SEQ ID NO. 28) shown in Table 7 to amplify the amplified fragment (B). The obtained DNA fragments (A) and (B) were treated according to the operating specifications of the In-Fusion HD Cloning Kit (Takara Bio) to construct a plasmid pUC-eg3-pyr4 in which the pyr4 gene was connected downstream of the eg3 gene.

[0239] Furthermore, the fragment (C) obtained by PCR amplification using the pUC-eg3-pyr4 as a template and the Fw primer 8 (sequence number 29) and Rv primer 8 (sequence number 30) shown in Table 7, and the fragment (D) obtained by PCR amplification using the genomic DNA of Trichoderma reesei as a template and the Fw primer 9 (sequence number 31) and Rv primer 9 (sequence number 32) shown in Table 7 were similarly treated with the In-Fusion HD Cloning Kit, thereby obtaining the plasmid pUC-Δeg3::Pcbh1-cbh1-pyr4.

[0240] Next, the fragment (E) amplified by PCR using the pUC-Δeg3::Pcbh1-cbh1-pyr4 as a template and the Fw primer 10 (sequence number 33) and Rv primer 10 (sequence number 34) shown in Table 7, and the fragment (F) amplified by PCR using the plasmid pUC-eg3 as a template and the Fw primer 11 (sequence number 35) and Rv primer 11 (sequence number 36) shown in Table 7 were similarly treated with the In-Fusion HD Cloning Kit to obtain plasmid pUC-Δeg3::Pcbh1-cbh1-pyr4_1000.

[0241] Next, the fragment (G) amplified by PCR using pUC-Δeg3::Pcbh1-cbh1-pyr4_1000 as a template and using Fw primer 7 (sequence number 27) and Rv primer 9 (sequence number 32) shown in Table 7, and the fragment (H) amplified by PCR using the genomic DNA of Trichoderma reesei as a template and using Fw primer 12 (sequence number 37) and Rv primer 12 (sequence number 38) shown in Table 8 were similarly treated with the In-Fusion HD Cloning Kit to obtain plasmid pUC-Δeg3::Pcbh1-cbh1-pyr4(re).

[0242] The fragment (I) amplified by PCR using pUC-Δeg3::Pcbh1-cbh1-pyr4(re) as a template and using Fw primer 13 (sequence number 39) and Rv primer 13 (sequence number 40) shown in Table 7, and the fragment (J) amplified by PCR using genomic DNA of Trichoderma reesei as a template and using Fw primer 14 (sequence number 41) and Rv primer 14 (sequence number 42) shown in Table 7 were similarly treated with the In-Fusion HD Cloning Kit to obtain plasmid pUC-Δeg3::Pxyn1-cbh1-pyr4(re).

[0243] Furthermore, the fragment (K) amplified by PCR using pUC-Δeg3::Pxyn1-cbh1-pyr4(re) as a template and using Fw primer 15 (sequence number 43) and Rv primer 15 (sequence number 44) shown in Table 7, and the fragment (L) amplified by PCR using cDNA of Aspergillus niger NBRC105649 strain as a template and using Fw primer 16 (sequence number 45) and Rv primer 16 (sequence number 46) shown in Table 7 were similarly treated with the In-Fusion HD Cloning Kit to obtain the GAL2 expression plasmid pUC-Δeg3::Pxyn1-AnGAL-pyr4(re).

[0244] [Table 8]

[0245] Primers for gene fragment amplification

[0246]

[0247] (2) Preparation of transformants

[0248] The strain expressing pgaB and pelD in the uracil-deficient strain of Trichoderma reesei E1AB1 (Japanese Patent Application No. 2021-154749) was designated as SP21, and the strain was transformed with the vector constructed in (1) above. The introduction was performed using the protoplast PEG method. The transformants were screened using a selective medium with acetamide as the sole nitrogen source (2.0% glucose, 1.1 M sorbitol, 2.0% agar, 0.2% KH2PO4, 0.06% CaCl2·2H2O, 0.06% MgSO4·7H2O, 0.06% acetamide, 0.1% trace element 2; % are all w / v%). The composition of trace element 2 is as follows: 0.5 g of FeSO4·7H2O, 0.2 g of CoCl2, 0.16 g of MnSO4·H2O, and 0.14 g of ZnSO4·7H2O are fixed to 100 mL with distilled water. After the screened transformants are stabilized by inoculation and subculture, the strains that stably maintain the target gene are further screened by colony PCR. The obtained transformants are designated as SP21·Gal.

[0249] (3) Enzyme production

[0250] The enzyme production medium was inoculated with spores of SP21 or SP21·Gal to a concentration of 2×10 5The culture was centrifuged and filtered through a filter to obtain each culture supernatant. The obtained culture supernatant was used as an enzyme solution for research.

[0251] Test example: Saccharification of cassava residue

[0252] <Test Example 21>

[0253] The same examination as in Test Example 1 was performed except that 0.05 mg-protein / g-substrate of glucoamylase and 0.2 mg-protein / g-substrate of culture supernatant from SP21 were added to the substrate after gelatinization. The viscosity of the slurry after saccharification was 60.0 mPa·s.

[0254] <Test Example 22>

[0255] The same examination as in Test Example 1 was conducted except that 0.05 mg-protein / g-substrate of glucoamylase and 0.2 mg / g-protein / g-substrate of culture supernatant derived from SP21·Gal were added to the substrate after gelatinization. The viscosity of the slurry after saccharification was 18.0 mPa·s.

[0256] <Test Example 23>

[0257] The enzyme units in the culture supernatants derived from SP21 and SP21·Gal were measured. The results are shown in Table 9.

[0258] [Table 9]

[0259]

Claims

1. An enzyme composition, wherein Contains the following (A), (B), and (C): (A) cellulase; (B) homogalacturonase comprising polygalacturonase and pectin lyase; (C) at least one selected from the group consisting of arabinofuranosidase and galactanase.

2. The enzyme composition according to claim 1, wherein The enzyme composition is used to saccharify plant biomass.

3. The enzyme composition according to claim 2, wherein The enzyme composition can reduce the viscosity of plant biomass after saccharification, compared with the case where saccharification is performed using only cellulase.

4. The enzyme composition according to any one of claims 1 to 3, wherein The cellulase activity is 2.0 to 3.5 U per 1 mg of protein in the enzyme composition.

5. The enzyme composition according to any one of claims 1 to 4, wherein The polygalacturonase activity is 30 U to 1200 U per 1 mg of protein in the enzyme composition.

6. The enzyme composition according to any one of claims 1 to 5, wherein The pectin lyase activity is 1 to 27 U per 1 mg of protein in the enzyme composition.

7. The enzyme composition according to any one of claims 1 to 6, wherein The arabinofuranosidase activity is 0.1 to 50 U per 1 mg of protein in the enzyme composition.

8. The enzyme composition according to any one of claims 1 to 7, wherein The galactanase activity is 3 to 250 U per 1 mg of protein in the enzyme composition.

9. The enzyme composition according to any one of claims 1 to 8, wherein The content of (B) homogalacturonanase and (C) at least one selected from arabinofuranosidase and galactanase in the enzyme composition, that is, ((B) + (C)), in the protein is 1% to 50% by mass.

10. A method for saccharifying plant biomass, wherein: include: A step of contacting the enzyme composition according to any one of claims 1 to 9 with plant biomass.

11. A method for producing sugars from plant biomass, wherein: include: A step of contacting the enzyme composition according to any one of claims 1 to 9 with plant biomass.

12. A method for producing ethanol from plant biomass, wherein: include: A step of contacting the enzyme composition according to any one of claims 1 to 9 with plant biomass.

13. The method according to any one of claims 10 to 12, wherein: The plant biomass is plant biomass containing pectin.

14. The method according to any one of claims 10 to 12, wherein: The plant biomass is cassava or its residues.

15. The method according to claim 13 or 14, wherein: The method reduces the viscosity of plant biomass contacted with the enzyme composition according to any one of claims 1 to 9 as compared to the case of contacting with cellulase alone.

16. A recombinant filamentous bacterium, wherein: (b1) a polygalacturonase gene, (b2) a pectin lyase gene, and (c) one or more genes selected from the group consisting of an arabinofuranosidase gene and a galactanase gene are introduced.

17. A method for producing the enzyme composition according to any one of claims 1 to 9, wherein include: The step of culturing the recombinant filamentous bacteria according to claim 16.

18. The recombinant filamentous bacteria according to claim 16, wherein (b1) the polygalacturonase gene is the PgaB gene, (b2) the pectate lyase gene is the PelD gene, and (c) the Abf gene or the Gal gene.

19. The method of claim 17, wherein: (b1) the polygalacturonase gene is the PgaB gene, (b2) the pectate lyase gene is the PelD gene, and (c) the Abf gene or the Gal gene.

20. A plant biomass viscosity reducer, wherein: The enzyme composition according to any one of claims 1 to 2 and 4 to 9 is used as an active ingredient.

21. A method for reducing the viscosity of plant biomass, wherein: include: A step of contacting the enzyme composition according to any one of claims 1 to 2 and 4 to 9 with plant biomass.

22. Use of the enzyme composition according to any one of claims 1 to 2 and 4 to 9 for reducing the viscosity of plant biomass.

Images