Application of a small molecule compound in the preparation of disease drugs related to ASFV E165R protein activity or reagents for inhibiting E165R protein activity

Abstract

This invention discloses the application of a small molecule compound in the preparation of disease drugs related to ASFV E165R protein activity or reagents for inhibiting E165R protein activity, belonging to the field of chemical pharmaceuticals. The small molecule compound is Z423747092, and its molecular formula is C0.05. 24 H 19 ClN6O3. Based on the crystal structure of the ASFV E165R protein, this invention obtained a small molecule compound Z423747092 that specifically binds to ASFV E165R through virtual screening technology. This small molecule compound exhibits high affinity for ASFV E165R, shows no significant cytotoxicity at the cellular level, and significantly inhibits the activity of ASFV E165R protein at concentrations ranging from 0.5 to 128 μM, demonstrating its potential as an active ingredient in drugs targeting African swine fever virus.

Description

Technical Field

[0001] This invention relates to the application of a small molecule compound in the preparation of disease drugs related to the activity of ASFV E165R protein or in reagents that inhibit the activity of E165R protein, belonging to the field of chemical pharmaceuticals. Background Technology

[0002] African swine fever (ASF) is an acute and highly contagious disease caused by the African swine fever virus (ASFV), characterized by fever and hemorrhage in various organs of pigs. ASF is a legally notifiable animal disease mandated by the World Organisation for Animal Health (OIE). In my country, it is listed as a Class A disease in the List of Animal Pathogenic Microorganisms.

[0003] African swine fever (ASF) was introduced to Europe in the 1950s, and it took the entire continent 40 years to eradicate the disease. However, it re-emerged in Georgia from East Africa in 2007, rapidly spreading to Eastern European countries and reaching the Russian Far East in 2017. In August 2018, ASF was first discovered in Shenyang, my country, and within a year, it had spread to 30 provinces, municipalities, and autonomous regions across the country, severely impacting my country's pig farming industry. Currently, there is no vaccine or effective treatment; once an ASF outbreak occurs, it can only be controlled through culling. However, this method not only results in economic losses but also fails to meet the needs of large-scale pig farming in my country. Therefore, effectively controlling ASF is one of the biggest challenges facing the global pig farming industry and a critical issue that urgently needs to be addressed in my country's ASF prevention and control efforts.

[0004] The E165R protein is a non-structural protein encoded by ASFV that functions as a deoxyuridine triphosphate (dUTPase). This protein effectively reduces deoxyuridine concentration and provides a substrate for thymosin synthase, thereby ensuring the integrity of viral DNA during replication. Since dUTPase is mainly found in actively dividing and differentiating cells, while porcine macrophages, which are primarily infected by ASFV, are resting cells and lack dUTPase, ASFV must rely on its own encoded E165R to ensure normal replication within porcine macrophages. The E165R protein is a homotrimeric dUTPase containing five highly conserved motifs that exhibit active enzymatic sites with specific pyrophosphatase activity. In addition, E165R contains a unique bi-subunit active site, exhibiting extremely high tolerance to high temperatures. High-throughput cell screening is a common method for identifying anti-ASFV drugs. While this method is highly accurate, it is relatively expensive, and the target mechanisms of the screened compounds are unclear, potentially leading to side effects on host proteins. Compounds that directly target viruses are often virus-specific, exerting their antiviral effects primarily by acting directly on viral proteins or the viral genome. However, research on drugs targeting the E165R protein of African swine fever virus (ASFV) is currently uncommon. Literature reports that compounds designed based on the active site of the ASFV E165R protein have not shown ideal inhibitory effects on ASFV replication at the cellular level. Therefore, finding compounds targeting E165R that can inhibit ASFV replication at the cellular level is more meaningful. Summary of the Invention

[0005] Purpose of the invention: The purpose of this invention is to provide the application of a small molecule compound in the preparation of disease drugs related to the activity of ASFV E165R protein or in reagents that inhibit the activity of E165R protein.

[0006] Technical Solution: This invention provides the application of a small molecule compound in the preparation of disease drugs related to ASFV E165R protein activity or reagents for inhibiting E165R protein activity. The small molecule compound is Z423747092, and its molecular formula is C0.05. 24 H 19 ClN6O3, structural formula is:

[0007]

[0008] The IUPAC name of the small molecule is N-[5-(2-chlorophenyl)-4H-1,2,4-triazol-3-yl]-2-[4-methyl-4-(naphthalen-2-yl)-2,5-dioxoimid azolidin-1-yl]acetamide

[0009] Furthermore, the disease associated with E165R protein activity is African swine fever.

[0010] Furthermore, the concentration of the small molecule compound in the drug is 0.5–128 μM.

[0011] Furthermore, the drug also includes a pharmaceutically acceptable carrier, which includes at least one of excipients, glidants, diluents, preservatives, colorants, flavoring agents, wetting agents, suspending agents, stabilizers, isotonic agents, solvents, and emulsifiers.

[0012] Furthermore, the dosage form of the drug is selected from any one of tablets, sprays, granules, capsules, oral liquids, injections, and suspensions.

[0013] The present invention also provides an anti-African swine fever virus drug, wherein the active ingredient in the drug is a small molecule compound Z423747092.

[0014] Furthermore, the concentration of the small molecule compound in the drug is 0.5–128 μM.

[0015] The present invention also provides a reagent for inhibiting the activity of E165R protein, wherein the active ingredient in the reagent is a small molecule compound Z423747092.

[0016] Furthermore, the concentration of the small molecule compound in the reagent is 0.5–128 μM.

[0017] Beneficial Effects: Compared with existing technologies, this invention has the following significant advantages: Based on the crystal structure of the ASFVE165R protein, this invention obtained a small molecule compound Z423747092 that specifically binds to ASFVE165R through virtual screening technology. This small molecule compound exhibits high affinity for ASFVE165R, shows no significant cytotoxicity at the cellular level, and significantly inhibits the activity of ASFVE165R protein at concentrations ranging from 0.5 to 128 μM, demonstrating its potential as an active ingredient in drugs targeting African swine fever virus. Attached Figure Description

[0018] Figure 1 This section presents the docking results between the small molecule compound Z423747092 and the ASFV E165R protein.

[0019] Figure 2The first part describes the expression and purification identification of ASFV E165R protein; A is the SDS-PAGE identification of the purification of ASFV E165R protein, where lane M is the Protein Marker, lanes 1 and 2 are the sample effluent, lane 3 is the washing buffer, and lanes 4, 5, 6, and 7 are the purified protein; B is the Western Blot identification of the purification of ASFV E165R protein, where lane M is the Protein Marker, lanes 1 and 4 are the pCold empty vector control, lanes 2 and 3 are the recombinant bacterial lysate, and lanes 5 and 6 are the purified E165R protein.

[0020] Figure 3 Figure 1 shows the SPR affinity identification results of the small molecule compound Z423747092 with the ASFV E165R protein. Figure A shows the sensor images of different concentrations of Z423747092 binding to the E165R protein; Figure B shows the fitted curves of different concentrations of Z423747092 binding to the E165R protein. The vertical axis represents the signal value detected by the sensor; the horizontal axis represents the interaction time of the sample in the sensor.

[0021] Figure 4 The results of the CCK-8 assay for the cytotoxicity of compound Z423747092 against PAM cells are presented.

[0022] Figure 5 : Standard curves of pyrophosphate at different concentrations and absorbance at 575 nm.

[0023] Figure 6 The experiment was conducted to determine the inhibitory activity of compound Z423747092 on the E165R protein of African swine fever virus.

[0024] Figure 7 : represents the inhibition rate of different concentrations of Z423747092 on the activity of African swine fever virus E165R protein. Detailed Implementation

[0025] The technical solution of the present invention will be further described below with reference to the accompanying drawings.

[0026] Unless otherwise stated, the experimental methods, detection methods, and preparation methods disclosed in this invention all employ conventional techniques in molecular biology, biochemistry, chromatin structure and analysis, analytical chemistry, cell culture, recombinant DNA technology, and related fields. These techniques have been well described in existing literature; see Sambrook et al., *MOLECULAR CLONING: ALABORATORY MANUAL*, Second edition, Cold Spring Harbor Laboratory Press, 1989 and Third edition, 2001; Ausubel et al., *CURRENT PROTOCOLS IN MOLECULAR BIOLOGY*, John Wiley & Sons, New York, 1987 and periodic updates; the series *METHODS IN ENZYMOLOGY*, Academic Press, San Diego; Wolffe, *CHROMATIN STRUCTURE AND FUNCTION*, Third edition, Academic Press, San Diego, 1998; *METHODS IN ENZYMOLOGY*, Vol. 304, Chromatin (PM Wassarman and A.P. Wolffe, eds.), Academic Press, San Diego, 1999; and *METHODS IN MOLECULAR*. BIOLOGY, Vol. 119, Chromatin Protocols (PB Becker, ed.) Humana Press, Totowa, 1999, etc.

[0027] Example 1: Screening of small molecule compounds based on the E165R protein structure

[0028] Download the ASFV E165R structure data (PDB ID: 6LJ3) from the protein structure library, remove water molecules and other irrelevant molecules, and minimize the energy of the entire protein structure. Using AutodockVina software, virtually dock 448,388 compounds from the Enamine Advanced drug database with the protein structure. The specific steps are as follows: integrate the compound format from the Enamine Advanced database; set the center position of the box (X-axis: -9.695, Y-axis: 14.741, Z-axis: -7.291) according to the E165R active site, and set the box size to... E165R water molecules and ligands were removed, and the structure was imported into a binding site file. Docking was performed using AutodockVina software to screen for E165R inhibitors. The quality of small molecule compounds was assessed based on prediction results, and the compound with the highest score (Z423747092) was selected as a candidate compound for further functional validation. The prediction results of the protein-protein interaction model for small molecule compound Z423747092 are shown below. Figure 1 ).

[0029] Example 2: Expression and purification of ASFV E165R protein

[0030] (1) Construction of prokaryotic expression plasmid pCold-E165R

[0031] First, design primers with XhoⅠ and XbaⅠ restriction sites:

[0032] Forward primer: 5'-atggagctcggtaccctcgagATGGCAACAAATTTTTTTATTCAACC-3'

[0033] (SEQ ID NO:1);

[0034] Reverse primer: 5'-agcagagattacctatctagaTTAAGTTCTCATAATCCCGGCC-3' (SEQ ID NO:2).

[0035] Then, using the genome of the African swine fever virus strain CHINA / 2018 / AnhuiXCGQ as a template, and the sequences of SEQ ID NO: 1 and SEQ ID NO: 2 as amplification primers, PCR amplification was performed on E165R (SEQ ID NO: 3: ATGGCAACAAATTTTTTTATTCAACCTATCACCGAAGAAGCTGAAGCATACTACCCACCTTCCGTGATAACGAATAAACGGAAGGACCTGGGGTAGACGTATACTGTTGCTCCGACCTAGTGCTTCAACCTGGACTAAATATTGTTCGCCTGCATATTAAAGTAGCATGCGAACACATGGGCAAAAAATGCGGTTTTAAAATCATGGCGAGAAGCAGTATGTGCACCCATGAACGGCTGCTCATCCTTGCAAACGGAATTGGTTTAATAGACCCGGGT). The gene sequence (TATGTGGGCGAGCTCATGCTCAAGATCATTAATCTTGGCGACACCCCGGTCCAAATATGGGCCAAAGAATGTTTGGTGCAGTTGGTGGCCCAAGGTGACCATGTGCCTGACCATATCAACATCCTAAAAAGAAACCAAATATTTCCGCTGTTTGCGCCTACCCCAAGAGGCGAGGGTAGATTTGGGAGCACGGGCGAGGCCGGGATTATGAGAACTTAA) was recovered by agarose gel electrophoresis. The E165R product and pCold vector (catalog number 3361, TAKARA) were double-digested and recovered, ligated using C115 DNA ligase, transformed into DH5α, and screened on resistant LB solid medium. Positive clones were picked for identification, and after sequencing (Qingke Biotechnology Co., Ltd.), the prokaryotic expression plasmid pCold-E165R was obtained.

[0036] (2) Expression and purification of E165R protein

[0037] The prokaryotic expression plasmid pCold-E165R was transformed into competent expression cells BL21. Single clones were picked and cultured in LB resistant medium at 37°C until OD = 0.6-0.8. Expression was induced by adding 0.5 mM IPTG at 15°C, and E165R protein was found to be expressed. His affinity chromatography using a nickel column yielded highly pure E165R protein, and the correctness of the target protein was confirmed by Western blotting. Figure 2 ).

[0038] Example 3: Affinity determination (SPR) of small molecule compound Z423747092 with artificially expressed E165R protein.

[0039] The binding of the compound to the E165R protein was determined using surface plasmon resonance (SPR) technology. The instrument used in the experiment was a Biacore T200. The materials used in the experiment included: NTA sensor chip; E165R protein; compound Z423747092 (Shanghai Taoshu Biotechnology Co., Ltd.); HBS buffer; NTA reagent kit; and analytical grade DMSO.

[0040] The specific experimental steps are as follows:

[0041] (1) Nickel chelation of chip surface: A 1-minute pulse of nickel solution was injected to saturate the NTA chip with nickel at a flow rate of 10 μL / min. The chip was then washed with a running buffer containing 3 mM EDTA.

[0042] (2) Protein coupling: E165R ligand solution was prepared with running buffer HBS at a concentration of 20 μg / mL. The recombinant E165R protein prepared in Example 2 was immobilized on the NTA chip by nickel ion coupling, with Fc-2 as the test channel and Fc-1 as the reference channel.

[0043] (3) Running buffer and compound preparation: The running buffer for compound Z423747092 was 1×HBS containing 5% DMSO. A 5% DMSO concentration calibration curve (4-8 gradient concentration points) was prepared using 4.5% and 5.8% calibration stock solutions. The compound was prepared into multiple gradient concentrations containing 5% DMSO using a 2:5 dilution method. A repeat concentration was set at intervals, followed by a zero concentration.

[0044] (4) Multi-cycle kinetics detection: Kinetics detection was performed in the LNW kinetics module. The analytes of gradient concentrations were placed on the sample holder, channel Fc 2-1 was selected, the injection time was 60s, the dissociation time was 120s, and the flow rate was 30μL / min for kinetics detection.

[0045] (5) Data Analysis: Data analysis was performed using Biacore T200 Evaluation Software. First, solvent correction analysis was performed in the solvent correction module. The solvent correction curve should generally fall within the range of -500 to +1000 RU, with both vertical lines falling within the correction curve range, and the fitted Chi2 less than 2. Then, affinity fitting analysis was performed in Kinetics / Affinity. Steady State Affinity was selected in Affinity to obtain the affinity KD data.

[0046] The results showed that the equilibrium dissociation constant KD for the interaction between the small molecule compound Z423747092 and the artificially expressed ASFV E165R protein was 25.13 μM. Figure 3 ).

[0047] Example 4: CCK-8 assay for the cytotoxicity of different concentrations of compound Z423747092 on PAM cells.

[0048] With 1.5×10 per hole 5 PAM cells were seeded into 96-well cell culture plates and cultured at 37°C. After complete cell adhesion, serially diluted small molecule compound Z423747092 was added to the cells using 1640 medium containing 2% serum, with three replicates for each concentration. After culturing at 37°C for 48 hours, the cell culture medium was discarded under dark conditions, and 100 μL of serum-free 1640 medium and 10 μL of CCK-8 solution (Dongren Chemical Technology Co., Ltd.) were added to each well. After further incubation for 1 hour, the absorbance at 450 nm was measured using a microplate reader.

[0049] The results showed that at a concentration of 100 μM, the small molecule compound Z423747092 maintained a PAM cell survival rate of over 80% and did not affect PAM cell survival. Figure 4 ).

[0050] Example 5: Standard curves of pyrophosphate at different concentrations and absorbance at 575 nm.

[0051] A standard curve for pyrophosphate was plotted following Grindey's method. The prepared pyrophosphate was diluted to a 1 mmol / L standard solution. Ten 1.5 mL centrifuge tubes containing the enzyme-free solution were used. Pyrophosphate standard solution (1 mmol / L) was added in a gradient from 0 to 90 μL, and each tube was brought up to 800 μL using DEPC water. The tubes were then vortexed for 30 s. In the following order, 50 μL of molybdate reagent, 100 μL of A solution (5 g sodium bisulfite and 0.25 g sodium sulfite dissolved in 50 mL distilled water), and 50 μL of C solution (5 g sodium bisulfite and 0.25 g sodium sulfite dissolved in 50 mL distilled water) were added. The tubes were then vortexed for 30 s and allowed to stand at room temperature for 10 min. Then, add 100 μL of LB solution (B solution is obtained by diluting A solution 15 times with distilled water), 50 μL of C solution, and 100 μL of anhydrous ethanol in sequence. Vortex the solution for 30 s, measure the OD value at 575 nm, and plot the linear correlation curve between the pyrophosphate concentration and the OD value at 575 nm.

[0052] The results showed that the correlation between different concentrations of pyrophosphate and its 575 nm absorbance was 0.9925. Figure 5 ).

[0053] Example 6 Enzyme activity inhibition experiment to determine the inhibitory activity of compound Z423747092 on African swine fever virus E165R protein.

[0054] Take an enzyme-free centrifuge tube and add 5 μL of recombinant ASFV E165R protein (1.05 mg / mL) prepared in Example 2 and 5 μL of Z423747092 at different concentrations (0.5 μM, 1 μM, 2 μM, 4 μM, 8 μM, 16 μM, 32 μM, 64 μM, 128 μM) to the enzyme reaction system, and incubate in a metal bath at 37°C for 3 min. Add 1 μL of dUTP (100 mmol / L) to each tube and place them in a 37°C metal bath. After 1 min, stop the heating and add DEPC to the centrifuge tubes to a total volume of 800 μL. Vortex for 30 s. Then, add 50 μL of molybdic acid reagent, 100 μL of A solution (5 g sodium bisulfite and 0.25 g sodium sulfite dissolved in 50 mL distilled water), and 50 μL of C solution (5 g sodium bisulfite and 0.25 g sodium sulfite dissolved in 50 mL distilled water) in sequence. Vortex for 30 s and let stand at room temperature for 10 min. Then, add 100 μL of LB solution (B solution is obtained by diluting A solution 15 times with distilled water), 50 μL of C solution, and 100 μL of anhydrous ethanol in sequence. Vortex for 30 seconds and measure the OD value at 575 nm. Substitute the OD value into the pyrophosphate standard curve to convert the enzyme activity value, and calculate the inhibition rate of different concentrations of compound Z423747092 on the activity of E165R protease.

[0055] Experimental results showed that compound Z423747092 of the present invention significantly inhibited the activity of E165R protein at concentrations ranging from 0.5 to 128 μM, in a dose-dependent manner. Figure 6 When the concentration is 128 μM, its inhibition rate can reach 60%. Figure 7 ).

Claims

1. The use of a small molecule compound in the preparation of a medicine for resisting African swine fever virus, characterized in that, The small molecule compound is Z423747092, and its molecular formula is C 24 H 19 ClN6O3, and its structural formula is 。 2. Use according to claim 1, characterized in that, The concentration of the small molecule compound in the medicine is 0.5-128 μM.

3. Use according to claim 1, characterized in that, The medicine further comprises a pharmaceutically acceptable carrier, which comprises at least one of a flow agent, a diluent, a preservative, a colorant, a flavoring agent, a wetting agent, a suspending agent, a stabilizer, an isotonic agent, a solvent, an emulsifying agent.

4. Use according to claim 1, characterized in that, The dosage form of the medicine is selected from any one of a tablet, a spray, a granule, a capsule, an oral liquid, a needle, a suspension.

Images