Application of Lettuce LsOFP6 Gene in Controlling Leaf Angle Traits

By cloning the lettuce LsOFP6 gene and using recombinant vectors and CRISPR-Cas9 technology to regulate the lettuce leaf angle trait, the problem of unclear genetic patterns of the lettuce leaf angle trait was solved, and rapid regulation of the lettuce leaf angle and improved breeding efficiency were achieved.

CN119591685BActive Publication Date: 2025-09-23HENAN AGRICULTURAL UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411837673.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-13
Publication Date
2025-09-23
Estimated Expiration
2044-12-13

AI Technical Summary

Technical Problem

The genetic laws of the lettuce leaf angle trait are unclear, and the existing technology lacks effective gene cloning methods, making it difficult to regulate the lettuce leaf angle trait through the gene regulatory network.

Method used

The lettuce leaf angle trait gene was located through hybrid breeding, BSR-seq and map-based cloning methods, and the LsOFP6 gene was cloned. The recombinant vector and CRISPR-Cas9 technology were used to regulate the lettuce leaf angle trait. The lettuce leaf angle was adjusted by expression cassette or knocking out the LsOFP6 gene.

Benefits of technology

It has achieved the rapid separation and regulation of the lettuce leaf angle trait, provided new lettuce breeding gene resources, improved the theoretical and practical efficiency of lettuce breeding, and met the needs of facility agriculture and plant factories.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HDA0005187161790000011
    Figure HDA0005187161790000011
  • Figure HDA0005187161790000012
    Figure HDA0005187161790000012
  • Figure HDA0005187161790000013
    Figure HDA0005187161790000013
Patent Text Reader

Abstract

The present invention belongs to the field of plant engineering technology and discloses the application of the lettuce LsOFP6 gene in controlling the leaf angle trait of lettuce. The full length of the gene is shown in SEQ ID NO.1. LsOFP6 The results showed that the loss of function of the gene LsOFP6 The gene can transform small-leaf angular lettuce into large-leaf angular lettuce. LsOFP6 The results showed that LsOFP6 It can transform large-leaf romaine lettuce into small-leaf romaine lettuce. LsOFP6 The cloning of genes has opened up a new direction for the study of plant leaf angle development and plant type, and also provided genetic resources and theoretical guidance for the variety breeding of small-leaf angled lettuce.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the technical field of plant engineering, and particularly relates to application of a lettuce LsOFP6 gene in controlling the leaf angle trait of lettuce. Background Art

[0002] Lettuce (Lactuca sativa L.) is a plant of the genus Lactuca in the Asteraceae family, originating and domesticated in the Mediterranean region. Based on its plant shape and edible parts, lettuce can be further divided into leaf lettuce (Lactuca sativa Linn. var. ramosa Hort.) and stem lettuce (Lactuca sativa Linn. var. angustata Irish ex Bremer). The leaf angle of lettuce, specifically the angle between the leaf and the stem, is a crucial determinant of plant shape. Compared to lettuce with a larger leaf angle, lettuce with a smaller leaf angle boasts a more compact plant shape, higher planting density per unit area, and higher yields. This facilitates harvesting and transportation, better meeting the needs of facility agriculture and plant factories, making it highly sought after by growers and consumers. Globally, lettuce is an important cash vegetable crop, with my country being the world's largest producer of lettuce, resulting in its significant economic value. The completion of the lettuce genome sequencing in 2017 facilitated the cloning and functional analysis of genes encoding various agronomic traits in lettuce.

[0003] The leaf angle trait of lettuce is a quantitative trait controlled by multiple genes and easily affected by environmental factors. There are few reports on the inheritance of the leaf angle trait of lettuce and the genes that control the leaf angle trait. The applicant previously cloned a gene LsNRL4 that controls the leaf angle trait of lettuce through genetic positioning. LsNRL4 became the first gene that controls the leaf angle trait identified in lettuce, but the regulatory network of lettuce leaf angle is still unclear. Therefore, cloning other genes that control the leaf angle trait of lettuce and analyzing their mechanism of action have important theoretical and application value. Summary of the Invention

[0004] The object of the present invention is to provide an application of the lettuce LsOFP6 gene in controlling the leaf angle trait of lettuce. The protein encoded by the gene is shown in SEQ ID NO.3, and the corresponding CDS sequence is shown in SEQ ID NO.2.

[0005] In order to achieve the above object, the present invention adopts the following technical measures:

[0006] Obtaining the gene LsOFP6 related to the leaf angle trait of lettuce:

[0007] The present invention obtains F1 hybrids by hybridizing small-leaf angled lettuce with large-leaf angled lettuce, and then further self-pollinates to obtain F2 populations. Using the F2 population, the gene that controls the leaf angle trait of lettuce is located by combining BSR-seq and map-based cloning methods. Gene annotation and candidate gene analysis are performed on the located interval to identify the candidate genes, and the key gene LsOFP6 that controls the leaf angle trait of lettuce is successfully cloned. This gene encodes a transcriptional auxiliary factor of the Ovate family proteins (OFP) family. OFP family genes play a key regulatory role in the maintenance of plant apical meristems, leaf development, and flowering regulation. Sequence analysis found that in large-leaf angled lettuce, the 352nd base "G" in the coding sequence of this gene mutated to the base "T", resulting in premature translation termination and loss of gene function, which in turn causes the leaf angle to increase. The difference between the Lsofp6 gene and its alleles lies in whether the 352nd base "G" in its coding sequence mutates to the base "T".

[0008] The LsOFP6 gene has no introns. The protein encoded by the LsOFP6 gene is shown in SEQ ID NO.3, its CDS is shown in SEQ ID NO.2, and the full length of the LsOFP6 gene is shown in SEQ ID NO.1.

[0009] The protection scope of the present invention includes:

[0010] The lettuce LsOFP6 gene is used in controlling or detecting the leaf angle trait of lettuce. The protein encoded by the lettuce LsOFP6 gene is shown in SEQ ID NO.3.

[0011] The applications mentioned above are:

[0012] Application of increasing the expression level of lettuce LsOFP6 gene in reducing the angle of lettuce leaves;

[0013] The above application is to introduce a substance that increases the expression of the lettuce LsOFP6 gene into lettuce, wherein the substance is an expression cassette containing the LsOFP6 gene, a recombinant vector, a recombinant microorganism or an in vitro recombinant cell;

[0014] Application of knocking out or inhibiting the expression of lettuce LsOFP6 gene in increasing the angle of lettuce leaves;

[0015] In the above-mentioned applications, the knockout is achieved by homologous recombination or CRISPR-Cas9 methods, and the protein translated from the knocked-out gene has no original function or cannot be translated into protein.

[0016] In the above-mentioned applications, the inhibition is achieved by antisense RNA technology or interfering RNA technology.

[0017] In the above-mentioned application, the knockout method adopts the CRISPR-Cas9 method, and the gRNA sequence is: TGACTCCAATGTCGTGCAA.

[0018] In the above application, the lettuce plant with increased leaf angle obtained after knockout contains the sequence shown in SEQ ID NO.4 or SEQ ID NO.5.

[0019] Detection of the application of the gene encoding the protein shown in SEQ ID NO. 3 in the screening or breeding of lettuce leaf angle traits.

[0020] The above application is judged by the method that the lettuce with small leaf angle is detected by the gene. The application of the gene encoding the protein shown in SEQ ID NO. 3 in creating transgenic lettuce with large leaf angle or small leaf angle.

[0021] In the above application, preferably, the lettuce LsOFP6 gene is represented by SEQ ID NO. 1 or SEQ ID NO. 2. Compared with the prior art, the present invention has the following advantages:

[0022] This invention proposes a method for rapidly isolating genes that control lettuce leaf angle, which has important theoretical significance for the research and breeding of lettuce leaf angle and other vegetable leaf angles. It also provides important theoretical insights into the molecular mechanisms of lettuce leaf angle and the regulatory pathways for leaf development and plant architecture. Furthermore, the LsOFP6 gene has not been reported to be involved in the leaf angle phenotype of any plant to date. This gene could provide a new genetic resource for lettuce breeding, facilitating the development of new lettuce varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 Schematic diagram of the phenotypes of small-leaf angled lettuce (left) and large-leaf angled lettuce (right), with a scale of 10 cm.

[0024] Figure 2 A schematic diagram showing that there is a genetic locus controlling the leaf angle trait of lettuce at approximately 120Mb on chromosome 2 of lettuce.

[0025] Figure 3 The effects of overexpression and knockout of the LsOFP6 gene on the leaf angle of lettuce;

[0026] Wherein: (a) The LsOFP6 gene was overexpressed in large-leaf angle lettuce to obtain the positive overexpression transgenic plant LsOFP6-OX#1, and the phenotype of LsOFP6-OX#1 changed from a large leaf angle to a small leaf angle (left first, left second); the LsOFP6 gene was knocked out in small-leaf angle lettuce to obtain the homozygous LsOFP6 gene knockout plant Lsofp6-KO#1, and the phenotype of Lsofp6-KO#1 changed from a small leaf angle to a large leaf angle (right second, right first); scale bar, 10 cm;

[0027] (b) Genotypic and phenotypic analysis of individual plants of the T1 generation of the transgenic plant LsOFP6-OX#1; the wells with amplified bands represent plants containing LsOFP6 transgene insertion; the wells without amplified bands represent plants without LsOFP6 transgene insertion.

[0028] (c) Comparison of the nucleotide sequences of the homozygous knockout LsOFP6 gene plants Lsofp6-KO#1 and Lsofp6-KO#2 with the LsOFP6 gene. DETAILED DESCRIPTION

[0029] Unless otherwise specified, the technical solutions described in the present invention are all conventional solutions in the field; the reagents or materials described are all from commercial channels unless otherwise specified.

[0030] Example 1:

[0031] Obtaining the lettuce leaf angle gene LsOFP6:

[0032] 1. Genetic analysis of leaf angle in lettuce

[0033] To analyze the genetic pattern of lettuce leaf angle, the present invention used small leaf angle lettuce (S12) and large leaf angle lettuce (S14) to obtain F1 hybrids (Zhang et al. 2017). The F1 hybrids were self-pollinated to obtain F2 populations. Statistical analysis of leaf angle phenotypes was performed on each individual in the F2 population. The results showed that only plants with large leaf angle phenotypes and small leaf angle phenotypes were found in the F2 population, with no other phenotypes. The ratio of small leaf angle plants to large leaf angle plants was 3:1 (χ 2 < 2 (0.05,1)=3.84, P>0.05), which proved that in this population, the lettuce leaf angle trait was controlled by a single gene and the large leaf angle phenotype was a recessive trait.

[0034] The genetics of leaf angle in an F2 population were analyzed using BSA combined with RNA-seq. Within the F2 segregating population, 20 individuals with small leaf angles were selected to form a "small leaf angle pool," and 20 individuals with large leaf angles were selected to form a "large leaf angle pool." RNA was extracted from each of these pools and analyzed using next-generation sequencing. Sequencing data were aligned to the lettuce reference genome (Lactucasativa vs. Salinas V8), and the Δ(SNP-index) value for each single nucleotide polymorphism (SNP) was calculated. The results revealed a clear QTL locus on chromosome 2 controlling the leaf angle trait.

[0035] 2. Map-based cloning of the LsOFP6 gene

[0036] To clone the key gene controlling the leaf angle trait of lettuce in the F2 population, this study used map-based cloning and molecular markers to locate the candidate gene within a region of approximately 0.963 Mb between OFP6-M11 (119.321 Mb) and OFP6-M18 (120.284 Mb). Sequence annotation analysis of this interval revealed that it encodes 10 genes, of which LG2191590 showed significant sequence divergence between the two pools. Therefore, we selected this gene as a candidate gene. LG2191590 encodes an ortholog of the Arabidopsis OFP6 (AT3G52525) gene, which we named LsOFP6. Sanger sequencing analysis found that compared with the LsOFP6 gene of the small leaf angle parent (the full length of the LsOFP6 gene is shown in SEQ ID NO.1, CDS sequence SEQ ID NO.2, and amino acid sequence SEQ ID NO.3), the 352nd base "G" in the CDS sequence of the LsOFP6 allele Lsofp6 in the large leaf angle parent mutated to the base "T", resulting in premature termination of Lsofp6 gene translation and loss of gene function, thereby causing the leaf angle to increase.

[0037] Example 2:

[0038] Application of LsOFP6 gene in controlling leaf angle of lettuce:

[0039] (1) Using the cDNA of small-leaf angled lettuce (S12) as a template, primers: AGH738F: ATGCCTACTGTGAAGAGGAAACTC and AGH738R: TTAAACCGAAAGGCTGTTCCAGA, the target fragment amplified was the sequence shown in SEQ ID NO.2, which was inserted into the pRI101 plant expression vector (the vector was linearized by BamHI and XhoI) by homologous recombination and transformed into large-leaf angled lettuce under Agrobacterium-mediated transformation. Transgenic detection primers: PH7L19F: ACTGACGTAAGGGATGACGC; GFPR: GGACACGCTGAACTTGTG were used to detect transgenic plants. A total of 5 transgenic plants were obtained, and all 5 transgenic plants showed the phenotype of small-leaf angled lettuce ( Figure 3 The second left image in (a) shows the phenotype of one of the transgenic plants, LsOFP6-OX#1. Analysis of the leaf angle phenotype and genotype of the T1 generation of one of the transgenic lines revealed that the plants with the transgene insertion all exhibited a small leaf angle phenotype, while the plants without the transgene insertion exhibited a large leaf angle phenotype ( Figure 3 Middle (b) shows that the leaf angle phenotype of the transgenic plants co-segregates with the transgenic insertion fragment, further verifying that LsOFP6 has the function of controlling the leaf angle of lettuce.

[0040] (2) Using CRISPR-Cas9 technology, the LsOFP6 gene in lettuce was knocked out. The gRNA sequence was: TGACTCCAATGTCGTGCAA. The gRNA and U6 promoter sequence were inserted into the CRISPR-Cas9 knockout vector pKSE401 linearized with BsaI (Tang et al. 2018) by homologous recombination, and transformed into lettuce under Agrobacterium-mediated transformation. Transgenic plants were detected using transgenic detection primers: U26F: tgtcccaggattagaatgattaggc; U29R: agccctcttctttcgatccatcaac, and a total of 2 gene-knockout transgenic plants were obtained. The knockout events of each line were analyzed by Sanger sequencing ( Figure 3 In (c), the mutant sequences obtained by sequencing are as follows: Lsofp6-KO#1: ACACAGCAACTCATGACTCCAATGTCGTGCAGGTTTGGGTGGCTCA Lsofp6-KO#2: ACACAGCAACTCATGACTCCAATGTCGTGCATTGGGTGGCTCA

[0041] Analysis of the T1 phenotypes and genotypes of all two transgenic lines revealed that plants with homozygous knockout of the LsOFP6 gene all exhibited a large leaf angle phenotype, while plants without or heterozygous knockout of the LsOFP6 gene exhibited a small leaf angle phenotype ( Figure 3 Middle (a) (right) shows the leaf angle phenotype of one of the transgenic plants, Lsofp6-KO#1, indicating that the LsOFP6 gene knockout event co-segregates with the leaf angle phenotype, further verifying that LsOFP6 has the function of controlling the leaf angle of lettuce.

[0042] In summary, from the above experiments, it can be seen that overexpression of the LsOFP6 gene in large-leaf angle lettuce can change the phenotype of large-leaf angle lettuce to small-leaf angle, and knocking out the LsOFP6 gene in small-leaf angle lettuce to obtain a homozygous knockout strain can change the phenotype of small-leaf angle lettuce to large-leaf angle.

Claims

1. Lettuce LsOFP6 Application of genes in controlling leaf angle traits of lettuce, the lettuce LsOFP6 The protein encoded by the gene is shown in SEQ ID NO.

3.

2. The application according to claim 1, wherein the application process is: LsOFP6 Application of gene expression in reducing the angle of lettuce leaves.

3. The application according to claim 2, wherein the application process is to increase the LsOFP6 Gene expression level of the substance is introduced into lettuce, the substance is LsOFP6 Gene expression cassette, recombinant vector or recombinant microorganism.

4. The use according to claim 1, wherein the application process is: knocking out or inhibiting lettuce LsOFP6 Application of gene expression in increasing the angle of lettuce leaves.

5. The use according to claim 4, wherein the knockout is performed by homologous recombination or CRISPR-Cas9 method, and the protein translated from the knocked-out gene has no original function or cannot be translated into protein.

6. The use according to claim 4, wherein the inhibition is achieved by antisense RNA technology or interfering RNA technology.

7. The use according to claim 5, wherein the knockout is performed using the CRISPR-Cas9 method, and the gRNA sequence is: TGACTCCAATGTCGTGCAA.

8. Use of a reagent for detecting the gene encoding the protein shown in SEQ ID NO. 3 in screening or breeding for the leaf angle trait of lettuce.

9. Use of the gene encoding the protein shown in SEQ ID NO. 3 in creating transgenic lettuce with large or small leaf angles.

10. The use according to claim 1, 8 or 9, wherein the lettuce LsOFP6 The gene is shown in SEQ ID NO.2.

Citation Information

Patent Citations

  • Application of OsFLA19 protein in regulation of plant leaf included angle

    CN103923916A

  • Application of lettuce LsNRL4 gene in control of lettuce leaf green depth and leaf included angle character

    CN114540371A