A genetically engineered alga for inhibiting protozoa, its construction method and application

Abstract

The present invention discloses a genetically engineered alga for inhibiting protozoa, its construction method and application. The genetically engineered alga is Phaeodactylum tricornutum into which the expression plasmid pPha-T1-eGFP-Linker-EP2 is introduced. The nucleotide sequence of the expression plasmid is as shown in SEQ ID NO:7. The construction method includes the steps of artificially synthesizing the codon-optimized EP2 coding sequence and inserting it downstream of eGFP in the expression vector to obtain the expression plasmid pPha-T1-eGFP-Linker-EP2; electrotransforming the expression plasmid into Phaeodactylum tricornutum, and spreading the transformed Phaeodactylum tricornutum cells on an f / 2 plate medium for culturing and screening positive algal strains to obtain the genetically engineered alga for inhibiting protozoa. The advantages are that it improves the efficiency and success rate of large-scale microalgae culture and has a strong inhibitory effect on Euplotes vannus and Euplotes raikovi.

Description

Technical Field

[0001] The invention belongs to the technical field of plant breeding, and in particular relates to a genetically engineered algae capable of inhibiting protozoa, a construction method thereof and an application thereof. Background Art

[0002] Compared to terrestrial higher plants, microalgae grow faster, photosynthesize more efficiently, and accumulate large quantities of high-value-added substances such as carotenoids, polyunsaturated fatty acids, bioactive polysaccharides, and bioactive polyphenols, making them highly economically viable for development. Furthermore, microalgae cultivation can be coupled with wastewater treatment and flue gas emission reduction in thermal power plants, thereby exerting significant ecological value. Therefore, the development of microalgae resources holds both enormous economic benefits and ecological significance.

[0003] Currently, with the exception of a very small number of microalgae species that can be cultivated on a large scale through heterotrophic fermentation, the vast majority of microalgae can only be produced on a large scale using open raceway ponds or closed reactors, relying on autotrophic or mixotrophic methods. In heterotrophic fermentation systems, protozoa pose a relatively minor threat to microalgae. However, in microalgae cultivation systems based on raceway ponds or photobioreactors, the threat of protozoan infestation must be overcome to achieve stable and efficient microalgae production.

[0004] Protozoa such as ciliates, amoebas, and sunworms have extensive predation-prey relationships with microalgae. Ciliates, for example, can consume tens of thousands of microalgae cells daily and reproduce extremely rapidly (a generation takes only 2–3 hours). Consequently, ciliate populations can easily surge rapidly. A subsequent ciliate outbreak can lead to a massive predation of microalgae, causing a sharp drop in algal biomass. Furthermore, ciliates can induce the adhesion and aggregation of microalgae cells, significantly reducing the light transmittance of photobioreactors and causing difficult-to-remove biofilms to form in raceway tanks. This not only impairs microalgae photosynthesis but can also cause long-term damage to microalgae cultures. Therefore, addressing the problem of protozoan infestation is crucial for promoting the development of the microalgae industry.

[0005] Existing large-scale microalgae production systems lack effective protozoa control methods. Physical methods such as filtration with small-pore (10–20 mm) membranes and high-speed centrifugation are energy-intensive and limited to laboratory use. They are also impractical for microalgae culture in volumes of water often exceeding tens of thousands of cubic meters. While chemical methods such as the addition of copper sulfate, alkaloids, and traditional Chinese medicine preparations can inhibit protozoa growth to a certain extent, they also suffer from numerous drawbacks, including poor protozoa killing efficacy, strong inhibitory effects on microalgae, high formulation costs, and residual residues in microalgae biomass that can affect microalgae quality. Consequently, developing a safe, efficient, and feasible method for controlling protozoa infestation in microalgae has become a major challenge facing the current microalgae industry.

[0006] Antimicrobial peptides are a class of naturally occurring small-molecule active peptides found widely in animals, plants, and microorganisms. Due to their ability to effectively inhibit bacterial growth and reproduction, they are widely considered to be promising alternatives to antibiotics. Enhanced Piscidin 2 (EP2), a type of antimicrobial peptide, can disrupt microbial cell membranes, exhibiting a variety of activities, including antiviral, antifungal, and antiparasitic activities. However, artificially synthesizing EP2 in bulk and adding it to microalgae production systems to inhibit protozoan growth is extremely costly. By genetically transforming microalgae with the ability to synthesize EP2, it is possible to construct strains that inhibit protozoan growth, effectively and cost-effectively addressing the problem of protozoan infestation in large-scale microalgae production. Currently, there are no published reports of genetically engineering microalgae germplasm based on the inhibitory effects of antimicrobial peptides against protozoa to address the problem of protozoan infestation in large-scale microalgae cultivation. Summary of the Invention

[0007] The technical problem to be solved by the present invention is to provide a genetically engineered algae capable of inhibiting protozoa and improving the efficiency and success rate of large-scale cultivation of microalgae, as well as a construction method and application thereof.

[0008] The technical solution adopted by the present invention to solve the above technical problems is: a genetically engineered algae for inhibiting protozoa, wherein the genetically engineered algae is Phaeodactylum tricornutum into which the expression plasmid pPha-T1-eGFP-Linker-EP2 is introduced, and the nucleotide sequence of the expression plasmid pPha-T1-eGFP-Linker-EP2 is shown in SEQ ID NO:7.

[0009] The present invention also provides a method for constructing the above-mentioned genetically engineered algae that inhibits protozoa, comprising the following steps:

[0010] Step 1: Synthesize the codon-optimized EP2 coding sequence and insert it into the downstream of eGFP in the expression vector to construct the expression plasmid pPha-T1-eGFP-Linker-EP2;

[0011] Step 2: electro-transform the expression plasmid pPha-T1-eGFP-Linker-EP2 into Phaeodactylum tricornutum, and spread the transformed Phaeodactylum tricornutum cells on f / 2 plate culture medium for culture, screen positive algae strains, and obtain genetically engineered algae that inhibit protozoa.

[0012] Furthermore, step 1 is as follows:

[0013] (1) Synthesis of double-stranded nucleotide template: EP2 double-stranded forward and reverse synthesis primers were designed based on the nucleotide coding sequence of EP2 and the flexible linker, wherein the nucleotide sequence of the EP2 double-stranded forward synthesis primer is shown in SEQ ID NO:3: 5'-GGCGGCGGTGGTAGCGGTGGCGGCGGTTCCTTCTTCCACCACATCTTCCGCGGTATCGTGCACGTGGGCAAGACGATCCACAAGCTGGTGACCGGCAACCAC-3', and the nucleotide sequence of the EP2 double-stranded reverse synthesis primer is shown in SEQ ID NO:4: 5'-GTGGTTGCCGGTCACCAGCTTGTGGATCGTCTTGCCCACGTGCACGATACCGCGGAAGATGTGGTGGAAGAAGGAACCGCCGCCACCGCTACCACCGCCGCC-3'; the EP2 double-stranded forward and reverse synthesis primers were annealed to synthesize a double-stranded nucleotide template;

[0014] (2) EP2 amplification: EP2 forward and reverse amplification primers were designed based on the Linker coding sequence and HindIII restriction endonuclease cleavage site sequence, wherein the nucleotide sequence of the EP2 forward amplification primer is shown in SEQ ID NO:5: 5'-ggtggcggcggttccaagcttGGCGGCGGTGGTAGCGGTGGC-3', and the nucleotide sequence of the EP2 reverse amplification primer is shown in SEQ ID NO:6: 5'-gatagcacgcttctgaagcttTTACCGCTACCACCGCCGCC-3'; PCR amplification was performed using the double-stranded nucleotide encoding (G4S)2-EP2 as a template to obtain the fusion-expressed EP2 amplified fragment;

[0015] (3) Ligation reaction: pPha-T1-eGFP was digested with HindIII restriction endonuclease, and the digestion product was ligated with the EP2 amplified fragment obtained in step (2) to construct the expression plasmid pPha-T1-eGFP-Linker-EP2, the nucleotide sequence of which is shown in SEQ ID NO: 7.

[0016] Furthermore, step 2 is as follows:

[0017] (1) Transformation of Phaeodactylum tricornutum: The expression plasmid pPha-T1-eGFP-Linker-EP2 was transformed into competent cells. After incubation, the cells were spread onto LB solid medium. After visible colonies were formed, the colonies were picked and transferred to LB liquid medium for shaking culture. The transformed competent cells were collected to extract the expression plasmid, and then transformed into Phaeodactylum tricornutum by electroporation.

[0018] (2) Screening of positive transformants: The transformed P. tricornutum cells were spread on a solid f / 2 plate culture medium containing bleomycin and placed under a light intensity of 50-70 µmol photons m −2 s −1 and cultured under conditions of a temperature of 20-24°C, and positive transformants were screened to obtain genetically engineered algae that inhibit protozoa.

[0019] The present invention also provides the use of the above-mentioned genetically engineered algae for inhibiting protozoa in preparing protozoa inhibitors, wherein the protozoa include Euplotes fanningii and Euplotes rabbii.

[0020] Compared with the prior art, the advantages of the present invention are

[0021] 1. The present invention utilizes the strong inhibitory effect of specific antimicrobial peptides on protozoa, and introduces the antimicrobial peptide coding sequence into microalgae through genetic engineering to make them express antimicrobial peptides, thereby establishing a microalgae strain construction system that is antiprotozoal.

[0022] 2. The improved microalgae germplasm can effectively resist the invasion of protozoa during large-scale cultivation, thereby effectively improving the efficiency and success rate of large-scale cultivation of microalgae. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 The results of screening positive transformants of Phaeodactylum tricornutum using the plate method with the help of antibiotics;

[0024] Figure 2 The sequence results are obtained after DNA from the transformed algae strain was amplified using specific primers based on the eGFP coding sequence.

[0025] Figure 3 Laser confocal images of pPha-T1-eGFP-Linker-EP2 and wild-type strains;

[0026] Figure 4 Photos of co-culture of different strains of Phaeodactylum tricornutum with Euplotes fan-shaped and Euplotes rabatidis in six-well plates;

[0027] Figure 5 Photo of Euplotes fanning feeding on Phaeodactylus triangularis;

[0028] Figure 6 The growth of Euplotes fan-shaped after being fed with different strains of P. tricornutum;

[0029] Figure 7 Photo of Euplotes laevis feeding on Phaeodactylus tricornutum;

[0030] Figure 8This shows the growth of Euplotes laevis after feeding on different strains of P. tricornutum. DETAILED DESCRIPTION

[0031] The present invention will be described in further detail below with reference to the accompanying drawings and embodiments.

[0032] Microalgae: Phaeodactylum tricornutum; basic plasmid: pPha-T1-eGFP; amplification kit: 2×Phanta FlashMaster Mix (Dye Plus) (Vazyme, P520-01); competent cells: DH5α; ligation kit: ClonExpress® II One Step Cloning Kit (Vazyme, C112-02); DNA extraction: 2×CTAB (Coolaber, SL2071); plasmid extraction kit: FastPure Plasmid Mini Kit (Vazyme, DC201-01); linker type (G4S) 2; microalgae culture medium was according to the literature (Guillard RRL, Ryther JH. Studies of marine planktonic diatoms: I. Cyclotella nana Hustedt, and Detonula confervacea (Cleve) Gran[J]. Canadian Journal of Microbiology, 1962, 8(2): 229–239), with an agar content of 1% for the f / 2 solid plate. Microalgae culture equipment was Ningbo Jiangnan Illumination Incubator GXM-508BP. Culture conditions: light intensity 60 µmol photons m −2 s −1 , temperature 22℃.

[0033] Different genetic transformation methods, different antimicrobial peptides, and different expression systems (intracellular, extracellular, secreted into the environment) of microalgae can all be used to construct the antiprotozoan algae species described in this patent. The following specific examples only list the antimicrobial peptides of Pseudomonas tricornutum ( Phaeodactylum tricornutum ) was used as research material, electroporation method was used, cytoplasm was used as the expression site of antimicrobial peptide, pPha-T1-eGFP was used as the basic plasmid, and antimicrobial peptide EP2 was used as the expression object to construct antiprotozoal genetically engineered P. tricornutum.

[0034] Specific Example 1: Constructing the expression plasmid pPha-T1-eGFP-Linker-EP2, comprising the following steps:

[0035] Step 1, synthesis of double-stranded nucleotides encoding (G4S)2-EP2: The amino acid sequence of the EP2 short peptide is shown in SEQ ID NO: 1: FFHHIFRGIVHVGKTIHKLVTGNH, the coding sequence of the EP2 short peptide is codon optimized to obtain a nucleotide sequence encoding EP2 as shown in SEQ ID NO: 2: 5'-TTCTTCCACCACATCTTCCGCGGTATCGTGCACGTGGGCAAGACGATCCACAAGCTGGTGACCGGCAACCAC-3', and EP2 double-stranded forward and reverse synthesis primers are designed based on the nucleotide coding sequence of EP2 and the nucleotide coding sequence of the flexible linker ((G4S)2), wherein the nucleotide sequence of the EP2 double-stranded forward synthesis primer is shown in SEQ ID NO: NO:3: 5'-GGCGGCGGTGGTAGCGGTGGCGGCGGTTCCTTCTTCCACCACATCTTCCGCGGTATCGTGCACGTGGGCAAGACGATCCACAAGCTGGTGACCGGCAACCAC-3', the nucleotide sequence of the EP2 double-stranded reverse synthesis primer is shown in SEQ ID NO:4: 5'-GTGGTTGCCGGTCACCAGCTTGTGGATCGTCTTGCCCACGTGCACGATACCGCGGAAGATGTGGTGGAAGAAGGAACCGCCGCCACCGCTACCACCGCCGCC-3'; the EP2 double-stranded forward and reverse synthesis primers are placed in the same reaction system and annealed to generate a double-stranded nucleotide encoding (G4S)2-EP2.

[0036] Step 2, EP2 amplification: EP2 forward and reverse amplification primers were designed based on the linker coding sequence and the HindIII restriction endonuclease cleavage site sequence, wherein the nucleotide sequence of the EP2 forward amplification primer is shown in SEQ ID NO: 5: 5'-ggtggcggcggttccaagcttGGCGGCGGTGGTAGCGGTGGC-3', and the nucleotide sequence of the EP2 reverse amplification primer is shown in SEQ ID NO: 6: 5'-gatagcacgcttctgaagcttTTACCGCTACCACCGCCGCC-3'; PCR amplification was performed using the double-stranded nucleotide encoding (G4S)2-EP2 as a template to obtain the fusion-expressed EP2 amplified fragment;

[0037] The PCR amplification system was as follows: 0.5 μL double-stranded nucleotide, 10 μL 2× PrimeSTAR Max Premix, 0.5 μL each of the forward and reverse amplification primers for the FSP gene, and 8.5 μL ddH2O;

[0038] The PCR program was as follows: 94°C for 5 min; 94°C for 30 sec, 68°C for 30 sec, 72°C for 1 min, 35 cycles, and storage at 4°C.

[0039] Verification of PCR amplification products: After amplification, PCR products were separated by agarose gel electrophoresis, followed by gel excision, recovery, and sequencing. The sequencing results were consistent with the theoretical coding sequence of EP2.

[0040] Step 3, ligation reaction: pPha-T1-eGFP was digested with HindIII restriction endonuclease, and the digestion product was ligated with the EP2 amplified fragment obtained in step 1. The reaction was incubated at 37°C for 30 min to construct the expression plasmid pPha-T1-eGFP-Linker-EP2, the nucleotide sequence of which is shown in SEQ ID NO: 7.

[0041] Specific embodiment 2: Constructing an antiprotozoan genetically engineered Phaeodactylum tricornutum, comprising the following steps:

[0042] Step 1, transformation of Phaeodactylum tricornutum: The expression plasmid pPha-T1-eGFP-Linker-EP2 constructed in Specific Example 1 was transformed into competent cells. After incubation, the cells were spread onto LB solid medium. After visible colonies were formed, the colonies were picked and transferred to LB liquid medium. The transformed competent cells were cultured in a constant temperature shaking incubator at 37°C. The transformed competent cells were collected, the pPha-T1-eGFP-Linker-EP2 plasmid was extracted, and the cells were transformed into Phaeodactylum tricornutum by electroporation. The electroporation parameters were: 500 V, 25 μF, 400 Ω;

[0043] Step 2, screening of positive transformants: The transformed P. tricornutum cells were spread on f / 2 plate medium containing 1.0% agar with a bleomycin concentration of 75 μg / mL and placed under a light intensity of 60 μmol photons m −2 s −1 After about 3 weeks, the successfully transformed strains formed algal colonies on the f / 2 plates. Figure 1 Visible algal colonies were picked and cultured in liquid f / 2 medium with a bleomycin concentration of 75 μg / mL for one week to obtain the algal liquid of P. tricornutum. DNA was extracted from the algal liquid and used as an identification template.

[0044] Step 3, identification of positive transformants: Identification primers were designed based on the eGFP coding sequence, wherein the nucleotide sequence of the eGFP coding sequence forward identification primer is shown in SEQ ID NO: 8: 5'-GACGACGGCAACTACAAGAC-3', and the nucleotide sequence of the eGFP coding sequence reverse identification primer is shown in SEQ ID NO: 9: 5'-CGAACTCCAGCAGGACCAT-3';

[0045] The PCR amplification system was as follows: 0.5 μL of Phaeodactylum tricornutum DNA, 10 μL of 2× Phanta Flash Master Mix, 0.5 μL each of the forward and reverse identification primers for the eGFP coding sequence, and 8.5 μL of ddH2O;

[0046] The PCR amplification program was as follows: 94°C for 5 min; 94°C for 30 sec, 58°C for 30 sec, and 72°C for 1 min, for 35 cycles, and stored at 4°C. PCR products were separated by agarose gel electrophoresis and then sequenced.

[0047] The results are as follows Figure 2 As shown, Sanger sequencing results showed that the amplified fragment originated from the eGFP coding region of the plasmid.

[0048] Specific Example 3: Verification of positive transformants of Phaeodactylum tricornutum.

[0049] Each strain of P. tricornutum was cultured to the logarithmic growth phase (cell density was about 5×10 6 cells / mL), and the transformation results were verified at the DNA level and protein level respectively.

[0050] 1. DNA-level verification: Identification primers were designed based on the expression plasmid pPha-T1-eGFP-Linker-EP2 sequence. The nucleotide sequence of the forward identification primer is shown in SEQ ID NO: 10: 5'-GACCACTACCAGCAGAACA-3', and the nucleotide sequence of the reverse identification primer is shown in SEQ ID NO: 11: 5'-TTATCCAGGTCCAAACAGA-3'. PCR amplification was performed using genomic DNA of Phaeodactylum tricornutum as a template.

[0051] The PCR amplification system was as follows: 0.5 μL of Phaeodactylum tricornutum genomic DNA, 10 μL of 2× Phanta Flash MasterMix, 0.5 μL each of the forward and reverse identification primers of the expression plasmid, and 8.5 μL of ddH2O;

[0052] The PCR amplification procedure was as follows: 94°C for 5 min, 94°C for 30 sec, 58°C for 30 sec, and 72°C for 1 min, for 35 cycles, and then stored at 4°C. PCR products were separated by agarose gel electrophoresis and sequenced. Sanger sequencing results were consistent with the theoretical sequence of the pPha-T1-eGFP-Linker-EP2 plasmid, indicating that the pPha-T1-eGFP-Linker-EP2 plasmid had been successfully integrated into P. tricornutum.

[0053] 2. Protein level verification: Using a laser confocal microscope, the position and intensity of the eGFP signal of each strain of Phaeodactylum tricornutum cells were detected and compared under the conditions of excitation and emission wavelengths of 488 nm and 507 nm respectively. Figure 3 As shown, the green fluorescent eGFP signal of the Phaeochromis tricornutum strain transformed with the expression plasmid pPha-T1-eGFP-Linker-EP2 was located in the cytoplasm; no eGFP signal was observed in the wild-type strain cells.

[0054] Specific Example 4: Verification of the protozoa inhibition effect based on the positive transformant strain of Phaeodactylum tricornutum.

[0055] After the positive transformant strain of P. tricornutum, the wild strain (negative control 1), and the pPha-T1-eGFP transformant (negative control 2) were cultured to the exponential phase, 300 mL of algae solution was added to each well of a 6-well plate. The cell density of each well was OD 750 =0.2); then a certain amount of Euplotes vannus and Euplotes raikovi were added to the algae solution to verify the inhibitory effect of the positive transformant strain of P. tricornutum on protozoa.

[0056] 1. Inhibitory effect of Euplotes fan-shaped: Add 20 Euplotes fan-shaped and 1.7 mL of f / 2 medium to each well of a 6-well plate; then, culture Euplotes fan-shaped and algae liquid of different strains in a constant temperature incubator with light, such as Figure 4 As shown, the culture conditions were a light intensity of 60 µmol photons m −2 s −1 , temperature 22℃; Figure 5 It can be seen that there is a clear predator-prey relationship between Euplotes fan-shaped and P. triangularis.

[0057] During the co-culture process of Euplotes fan-shaped and various strains of P. tricornutum, the proliferation of Euplotes fan-shaped in different strains of microalgae was monitored daily using a stereo microscope for 5 consecutive days. Figure 6As shown, after 5 days of feeding with the pPha-T1-eGFP-Linker-EP2 transformant, the number of Euplotes sphenoides was less than 30 cells / well; while after 5 days of feeding with the wild-type strain (negative control 1) and the pPha-T1-eGFP transformant (negative control 2), the number of Euplotes sphenoides reached approximately 120 cells / well, which was much higher than that of the pPha-T1-eGFP-Linker-EP2 transformant. This shows that the genetically engineered Phaeodactylum tricornutum constructed in Specific Example 2 exhibits a significant inhibitory effect on Euplotes sphenoides.

[0058] 2. Inhibitory effect of Euplotes laevis: 20 Euplotes laevis and 1.7 mL of f / 2 medium were added to each well of a 6-well plate. Subsequently, Euplotes laevis and algae of different strains were cultured in a constant temperature incubator under a light intensity of 60 µmol photons m −2 s −1 , temperature 22℃. Figure 7 It can be seen that there is a clear predator-prey relationship between Euplotes lagerstroemia and P. tricornutum.

[0059] During the 5 days of co-culture of Euplotes lagerstroemia and various strains of P. tricornutum, the proliferation of Euplotes lagerstroemia was monitored daily using a stereomicroscope. Figure 8 As shown, after 5 days of feeding with the pPha-T1-eGFP-Linker-EP2 transformant, the cell number of Euplotes lagerstroemia was only 21 cells / well; however, after 5 days of feeding with the wild-type strain (negative control 1) and the pPha-T1-eGFP transformant (negative control 2), the number of Euplotes lagerstroemia reached 182 cells / well and 176 cells / well, respectively, several times that of the treatment group fed with the pPha-T1-eGFP-Linker-EP2 transformant. Therefore, it can be seen that the genetically engineered Phaeodactylum tricornutum constructed in Specific Example 2 exhibits a significant inhibitory effect on Euplotes lagerstroemia.

[0060] The above description is not intended to limit the present invention, and the present invention is not limited to the above examples. Any changes, modifications, additions or substitutions made by persons of ordinary skill in the art within the spirit and scope of the present invention shall also fall within the scope of protection of the present invention.

Claims

1. A genetically engineered algae for inhibiting protozoa, characterized in that: The genetically engineered algae is a triangular shaped algae into which the expression plasmid pPha-T1-eGFP-Linker-EP2 is introduced. The nucleotide sequence of the expression plasmid pPha-T1-eGFP-Linker-EP2 is shown in SEQ ID NO:

7.

2. A method for constructing a genetically engineered algae for inhibiting protozoa according to claim 1, characterized in that The following steps are involved: Step 1, artificially synthesize the codon-optimized EP2 coding sequence and insert it into the downstream of eGFP in the expression vector to construct the expression plasmid pPha-T1-eGFP-Linker-EP2; Step 2: electro-transform the expression plasmid pPha-T1-eGFP-Linker-EP2 into P. tricornutum, and spread the transformed P. tricornutum cells on f / 2 plate culture medium for culture, screen positive algae strains, and obtain genetically engineered algae that inhibit protozoa.

3. The method for constructing a genetically engineered algae for inhibiting protozoa according to claim 2, characterized in that Step 1 is as follows: (1) Synthesizing a double-stranded nucleotide template: designing double-stranded forward and reverse synthesis primers of EP2 according to the nucleotide coding sequence of EP2 and the flexible linker, wherein the nucleotide sequence of the double-stranded forward synthesis primer of EP2 is as shown in SEQ ID NO:3: 5'-GGCGGCGGTGGTAGCGGTGGCGGCGGTTCCTTCTTCCACCACATCTTCCGCGGTATCGTGCACGTGGGCAAGACGATCCACAAGCTGGTGACCGGCAACCAC-3', and the nucleotide sequence of the double-stranded reverse synthesis primer of EP2 is as shown in SEQ ID NO:4: 5'-GTGGTTGCCGGTCACCAGCTTGTGGATCGTCTTGCCCACGTGCACGATACCGCGGAAGATGTGGTGGAAGAAGGAACCGCCGCCACCGCTACCACCGCCGCC-3'; annealing the double-stranded forward and reverse synthesis primers of EP2 to synthesize a double-stranded nucleotide template; (2) EP2 amplification: EP2 forward and reverse amplification primers were designed based on the linker coding sequence and HindIII restriction endonuclease cleavage site sequence, wherein the nucleotide sequence of the EP2 forward amplification primer is shown in SEQ ID NO:5: 5'-ggtggcggcggttccaagcttGGCGGCGGTGGTAGCGGTGGC-3', and the nucleotide sequence of the EP2 reverse amplification primer is shown in SEQ ID NO:6: 5'-gatagcacgcttctgaagcttTTACCGCTACCACCGCCGCC-3'; PCR amplification was performed using the double-stranded nucleotide encoding (G4S)2-EP2 as a template to obtain the fusion-expressed EP2 amplified fragment; (3) Ligation reaction: pPha-T1-eGFP was digested with HindIII restriction endonuclease, and the digestion product was ligated with the EP2 amplified fragment obtained in step (2) to construct the expression plasmid pPha-T1-eGFP-Linker-EP2, the nucleotide sequence of which is shown in SEQ ID NO:

7.

4. The method for constructing a genetically engineered algae for inhibiting protozoa according to claim 2, characterized in that Step 2 is as follows: (1) Transformation of Phaeodactylum triangularis: The expression plasmid pPha-T1-eGFP-Linker-EP2 was transformed into competent cells. After incubation, the cells were spread onto LB solid culture medium. When visible colonies were formed, the colonies were picked up and transferred to LB liquid culture medium for shaking culture. The transformed competent cells were collected to extract the expression plasmid, and then transformed into Phaeodactylum triangularis by electroporation. (2) Screening of positive transformants: The transformed P. tricornutum cells were spread on a solid f / 2 plate medium containing bleomycin and placed under a light intensity of 50-70 µmol photons m −2 s −1 , culture under the conditions of temperature of 20-24°C, screen the positive transformants, and obtain the genetically engineered algae that inhibit protozoa.

5. Use of the genetically engineered algae for inhibiting protozoa according to claim 1 in preparing a protozoa inhibitor, characterized in that: The protozoa are Euplotes fan-shaped and Euplotes rabbii.

Images