Morchella sextelata Qian DL04 and application thereof

Abstract

The invention belongs to the field of edible mushrooms. In particular to a Morchella sextelata strain Guizhou DL04 which is preserved in the China Center for Type Culture Collection (CCTCC), and the preservation number of the Morchella sextelata strain is CCTCC NO: M2022900. The invention also discloses application of the strain. The invention provides a novel morchella sextelata strain, and the variety of morchella sextelata is enriched; the ascotums of the strain are light brown, the mushroom shape is good, the commodity value is high, and the strain has the advantages of being high in yield, short in cultivation period, high in arsenic stress resistance and the like.

Description

Technical Field

[0001] The invention belongs to the field of edible fungi, and in particular relates to a Morchella liumei strain and also relates to the use of the strain. Background Art

[0002] Morchella belongs to the Morchaceae family. It is named because its cap resembles a tripe. It is a precious medicinal and edible mushroom. Morchella grows mostly on the humus layer of broad-leaved forests or mixed coniferous and broad-leaved forests. It is distributed all over the world and in 28 provinces, municipalities and autonomous regions in my country. Morchella is not only delicious and unique in taste, but also rich in nutritional value, high in protein, rich in essential amino acids and vitamins, trace elements and carbohydrates, and rich in fatty acid types. Morchella fruiting bodies can also be used as medicine. According to the "Chinese Materia Medica", Morchella is flat in nature, sweet and cold in taste, non-toxic; it is beneficial to the stomach and intestines, aids digestion, eliminates phlegm and regulates qi, nourishes the kidneys, nourishes the brain and refreshes the mind; Morchella contains polysaccharides that inhibit tumors, antibacterial and antiviral active ingredients, and has the effects of enhancing the body's immunity, anti-fatigue, anti-virus, and inhibiting tumors. It has always been used as a high-end supplement for human nutrition in Europe and the United States.

[0003] Morchella sextelata is a species of the genus Morchella and is one of the main cultivated morels in my country. At present, the main problems in the cultivation of Morchella sextelata are: (1) The cultivation cycle is long, which is generally about 120 days. Morchella is a seasonally cultivated edible fungus. Fresh mushrooms are often put on the market in large quantities from February to March each year. Usually, the price of fresh mushrooms put on the market before the Spring Festival is generally higher than that after the Spring Festival, which can bring higher commercial value. However, a shorter cultivation cycle is often required to produce mushrooms before the Spring Festival. (2) In some areas in southwest my country, the arsenic content in the soil exceeds the standard, which has an adverse effect on the growth of morels and directly affects the yield of morels. Therefore, it is crucial to cultivate morel strains that are resistant to arsenic stress, have a short cultivation cycle and are high in yield for the stable development of the morel industry.

[0004] my country's vast primeval forests from south to north are rich in wild edible mushroom resources, including wild Morchella. The development and domestication of wild Morchella can not only enrich people's dining tables and meet people's needs for a high level of life, but also use its medicinal and edible properties to develop higher value-added foods, beverages and health products, which can improve people's health and well-being while increasing mushroom farmers' income and export earnings. Summary of the invention

[0005] The invention aims to provide a Morchella liliifolia strain with strong arsenic stress resistance, short cultivation period and high yield.

[0006] Another object of the present invention is to provide the use of the above-mentioned Morchella lilii strain.

[0007] The purpose of the present invention is achieved through the following technical solutions:

[0008] The invention provides a Morchella sextelata strain Guizhou DL04, which is deposited in China Center for Type Culture Collection, located at Wuhan University, Wuhan, China, with a deposit number of CCTCCNO: M2022900 and a deposit date of June 15, 2022.

[0009] The present invention also provides application of the strain Guizhou DL04 in food or health products.

[0010] The present invention also provides a food or a health product, wherein the food or the health product contains the strain Guizhou DL04 or an extract of Guizhou DL04.

[0011] The present invention also provides application of the strain Guizhou DL04 in beverages.

[0012] The present invention also provides a beverage, which contains the strain Guizhou DL04 or an extract of Guizhou DL04.

[0013] The present invention also provides the use of the strain Guizhou DL04 in preparing medicines for improving human immunity.

[0014] The present invention also provides a genetically engineered Morchella liumei, wherein the starting strain of the genetically engineered Morchella liumei is the strain Guizhou DL04.

[0015] The advantages and beneficial technical effects of the present invention are as follows: (1) The ascocarps of the six-sister morel strain Guizhou DL04 of the present invention are light brown, have a good mushroom shape, and have a high commercial value. (2) The cultivation cycle of the Guizhou DL04 strain of the present invention is short. The cultivation cycle of Guizhou DL04 from sowing to mushroom harvesting is 75 to 80 days, which is significantly shorter than the 100 to 130-day cultivation cycle of other existing six-sister morel strains. The short cultivation cycle not only reduces labor costs, but also facilitates listing before the Spring Festival, thereby obtaining higher selling prices and economic benefits. (3) The fruiting body yield of the Guizhou DL04 strain of the present invention is high. The average agricultural cultivation yield of Guizhou DL04 of the present invention is 600.3kg / 667m 2 , much higher than other main cultivated morels 330~357kg / 667m 2 (4) The strain Guizhou DL04 of the present invention has a strong ability to resist arsenic stress. Under different arsenic concentrations, its solid seed mycelium growth rate and liquid seed mycelium biomass are higher than other varieties, and its ability to resist arsenic stress is significantly higher than other main cultivated strains. (5) The breeding process of the strain Guizhou DL04 of the present invention is multi-spore self-pollination. Compared with the strains separated by traditional tissues, the genetic material is more complete and the strain transmission characteristics are more stable.

[0016] Biological preservation: The present invention's Morchella sextelata strain Guizhou DL04 is a wild Morchella collected by the inventor in Bijie City, Guizhou Province, and then cultivated through adaptive cultivation and multi-spore self-pollination screening. The strain has been deposited in the China Center for Type Culture Collection on June 15, 2022; the deposit address is: Wuhan University, Wuhan, China; its deposit number is CCTCC NO: M2022900. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 .Photo of the fruiting body of the strain Guizhou DL04 of the present invention.

[0018] Figure 2 . Phylogenetic tree diagram of the strain Guizhou DL04 of the present invention.

[0019] Figure 3 ISSR fingerprints of the strain Guizhou DL04 of the present invention and other different Morchella lilii; wherein M is a DNA molecular weight standard; 1 is Guizhou DL04; 2 is Guizhou Morchella No. 1; 3 is Lefeng No. 2; and 4 is Faxing No. 1. DETAILED DESCRIPTION

[0020] The present invention is further described below by way of examples, but the present invention is not limited thereto. Unless otherwise specified, the following experimental methods are all conventional experimental methods, and the biochemical reagents used are all conventional biochemical reagents.

[0021] Example 1 Collection, separation and domestication process of strain Guizhou DL04 of the present invention

[0022] (1) Collection and separation process of the strain of the present invention

[0023] In April 2017, the inventors found a wild Morchella fruiting body in Qianxi area, Bijie City, Guizhou Province. The mycelium (strain) was obtained by separating the fruiting body tissue, and then it was identified as Morchella extelata by morphological characteristics, ITS-PCR detection, phylogenetic tree construction and ISSR fingerprint map comparison, and then by gene fragment size and sequence. The strains after tissue separation were cultivated and fruited, and then the fruiting bodies with good flower shapes were separated and inoculated on PDA medium for cultivation. The fruiting test was carried out at the experimental base of Guizhou Academy of Agricultural Sciences. After fruiting, the ascospores were collected and the strain was domesticated and bred by multi-spore self-pollination.

[0024] (2) Strain selection process

[0025] Genomic DNA was extracted according to the instructions of the DNA extraction kit (Beijing Kangwei Century Company). Two sets of primer combinations P8-FF / P8-5R and P10-2F / P10-2R were used for PCR amplification to detect the mating type genes MAT1-1 and MAT1-2 of the monosporic strain. The primer sequences are as follows:

[0026] P8-5F: 5'-TTACCTTACTGGACTGGTTCGTGAG-3';

[0027] P8-5R: 5'-TGGAATGTCTGTGATTGAGGCTGTG-3'.

[0028] P10-2F: 5'-GGCCAGAACAGATGCTCGAAGAAGC-3';

[0029] P10-2R: 5'-GTGGCAACTCCCAAAGCATGATCAA-3'.

[0030] The PCR amplification reaction system includes: a total volume of 20 μL: 1 μL of 20-50 ng / μL DNA template, 2 μL of 10×Buffer (with Mg2+), 0.5 μL of 2.5 mM dNTP, 0.2 μL of 5 U / μL DNA polymerase, 0.5 μL of each 0.2 μM primer, and double distilled water to 20 μL. The PCR amplification reaction conditions include: pre-denaturation at 94°C for 5 min; 94°C for 30 s, 63°C for 30 s, 72°C for 3 min, 30 cycles; and extension at 72°C for 10 min.

[0031] The products after PCR amplification were detected by electrophoresis. The mating type of the monospore strain with MAT1-1 but no MAT1-2 gene band was MAT1-1. Conversely, the mating type of the monospore strain with MAT1-2 but no MAT1-1 gene band was MAT1-2. Double mating type strains were selected, and after several generations of cultivation, the strains were compared with the growth rate, yield and arsenic stress, and the strains with stable genetic traits, fast mycelial growth rate, high yield, and the ability to maintain a relatively fast growth rate under arsenic stress were screened out. The strain was named: Guizhou DL04.

[0032] Example 2 Classification and Identification Test of Strain Guizhou DL04 of the Present Invention

[0033] (1) Morphological identification of Guizhou DL04:

[0034] The strain Guizhou DL04 of the present invention: the ascocarp is light brown, the fruiting body is 5 to 15 cm high, the ascocarp is 3 to 10 cm long, 2 to 5 cm thick, conical, blunt at the top, and connected to the stipe at the lower edge. The ascocarp has developed longitudinal ridges, shallow transverse ridges, and short villi all over the ridges. The transverse and longitudinal ridges cross to form pits. The ridges are relatively flat when young and tender, and become sharp when mature; the stipe is 2 to 6 cm long and 2.5 to 4 cm thick, the stipe is milky white and swollen at the base, and there are white villi at the root of the stipe. The ascus is columnar, and the mature ascus contains eight spores, which are arranged in a single longitudinal arrangement. According to the description and photos of the corresponding morphological characteristics of the six-sister morel on page 64 of "Morchella Biology and Cultivation Technology" (Liu Wei, Zhang Ya, etc., Jilin Science and Technology Press, 2017), Guizhou DL04 is consistent with the morphological characteristics of the six-sister morel, indicating that the strain Guizhou DL04 of the present invention belongs to the six-sister morel species (Morchella sextelata) in the genus Morchella.

[0035] (2) Molecular biological classification and identification of the strain Guizhou DL04 of the present invention

[0036] The genomic DNA of strain Qian DL04 was extracted using a new plant genomic DNA extraction kit CW0531 (Beijing Kangwei Century Company), and PCR amplification was performed using universal primers ITS1 and ITS4. The primer sequences are as follows:

[0037] ITS1: 5'-TCCGTAGGTGAACCTGCGG-3';

[0038] ITS4: 5'-TCCTCCGCTTATTGATATGC-3'.

[0039] The ITS-PCR amplification reaction system is as follows: total volume 20 μL: 1 μL of 20-50 ng / μL DNA template, 10× Buffer (with Mg 2+ )2μL, 2.5mM dNTP 0.5μL, 5U / μl DNA polymerase 0.2μL, 0.2μM primers 0.5μL each, add double distilled water to 20μL. The ITS-PCR reaction conditions are: pre-denaturation at 94℃ for 5min; 94℃ for 1min, 60℃ for 1min, 72℃ for 75s, 30 cycles; 72℃ extension for 10min. A DNA molecule fragment with a fragment length of 712bp was amplified and sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The nucleotide sequence of the DNA fragment is shown in SEQ ID NO: 1. After BLAST comparison, it was found that the ITS sequence of strain Guizhou DL04 had the highest similarity with the ITS sequence of Morchella sextelata, with a similarity of up to 99.86%. The phylogenetic tree was constructed (see Figure 2). From the above results, it can be seen that the strain Guizhou DL04 of the present invention belongs to the species Morchella sextelata of the genus Morchella in classification; and is different from any other Morchella sextelata strains and is a new Morchella sextelata strain.

[0040] Example 3 ISSR comparative identification test of the strain Guizhou DL04 of the present invention and other Morchella liumei

[0041] (I) Test strains: 1. The strain of the present invention, Guizhou DL04; 2. Guizhou Morchella No. 1 (the six-sister Morchella strain approved by Guizhou Province in 2022); 3. Lefeng No. 2 (the six-sister Morchella strain approved by Guizhou Province in 2023); 4. Faxing No. 1 (the six-sister Morchella strain promoted for cultivation in Qiandongnan area of ​​Guizhou Province).

[0042] (II) Test methods:

[0043] The new plant genomic DNA extraction kit CW0531 (Beijing Kangwei Century Company) was used to extract the genomic DNA of Qian DL04, Qian Morchella No. 1, Lefeng No. 2 and Faxing No. 1, respectively. According to the agricultural industry standard of the People's Republic of China NY / T 1730-2009 "ISSR method for authenticity identification of edible fungi", 20 ISSR primers (see Table 1) were selected for PCR amplification. The primer sequences are as follows:

[0044] Table 1 ISSR random primer sequence list

[0045] Primer name Primer sequence 5'-3' Primer name Primer sequence 5'-3' P1 TGCACACACACACAC P11 GAGAGAGAGAGAGAGAAC P2 GTGACACACACACAC P12 AGAGAGAGAGAGAGAGAGGC P3 GTGACGACTCTCTCTCTCT P13 TCTCTCTCTCTCTCTCCG P4 GGATGCAACACACACACAC P14 ACACACACACACACACG P5 CGTGTGTGTGTGTGT P15 GTGTGTGTGTGTGTGTTA P6 AGTGTGTGTGTGTGT P16 TGTGTGTGTGTGTGTGGA P7 CCAGTGGTGGTGGTG P17 ACACACACACACACAC P8 GGAGTGGTGGTGGTG P18 ACACACACACACACACACC P9 AGAGAGAGAGAGAGAGAGG P19 ACACACACACACACACACCT P10 GAGAGAGAGAG AGAGAC P20 ACACACACACACACACACCTG

[0046] The ISSR-PCR amplification reaction system is as follows: the total volume of the PCR reaction is 20 μL, containing 1×PCR reaction buffer, 0.2 mmol / L dNTP, 1U Taq DNA polymerase, 0.4 pmol / L primer, 20ng-50ng template DNA, and sterilized double distilled water to 20 μL. The ISSR-PCR reaction conditions are as follows: pre-denaturation at 94°C for 4 min; denaturation at 94°C for 30 s, annealing at a temperature 5°C lower than the primer Tm value for 45 s, 72°C for 2 min, for a total of 35 cycles; 72°C for 7 min, and storage at 4°C.

[0047] Results (see Figure 3 ) From the ISSR pattern amplified with P14 as primer, it can be seen that the specific bands of the strain Qian DL04 of the present invention and other Morchella sextelata strains Qian Morchella 1, Lefeng 2 and Faxing 1 are obviously different, indicating that the strain Qian DL04 of the present invention is a new Morchella sextelata strain.

[0048] Example 4 Cultivation test of strain Guizhou DL04 of the present invention

[0049] (1) Stock culture: Inoculate the 5 mm diameter Guizhou DL04 strain (this strain has been deposited in China Center for Type Culture Collection, Wuhan University, Wuhan, China, with a deposit number of CCTCC NO: M2022900) in the center of the stock culture medium plate with a sterilized and cooled inoculation hook, and culture at 20° C. and relative air humidity of 60-75%. After about 3 days, the mycelium will cover the plate. Continue to culture under light-proof conditions for 7 days, at which time a large number of sclerotia will form on the plate, thereby obtaining the Guizhou DL04 stock culture; the preparation method of the stock culture medium: peel 200 g of potatoes and cut them into cubes of about 1.5 cm, put them into 800 mL of RO water and boil them for 20 min, filter the extract through 3 layers of gauze, add 20 g of glucose, 18 g of agar, 1 g of potassium dihydrogen phosphate, and 0.5 g of magnesium sulfate, mix well, make up to 1000 mL with RO water, sterilize at 121° C. for 20 min, pour into a 9 cm diameter plate and set aside.

[0050] (2) Stock culture: Use the sterilized and cooled strains to scoop out 5 pieces of Qian DL04 mother strains with a diameter of 5 mm obtained in step (1), inoculate them on the stock culture medium, and culture them at 18°C, relative air humidity of 60-75%, and in dark conditions. The bag is full in about 7 days, and the culture is continued for about 14 days until the mycelium is ripe and the mycelium fills the bag. At this time, a large number of sclerotia are formed in the bag, and the Qian DL04 stock is obtained; the components and weight percentages of the stock culture medium are: 80% wheat, 13% humus, 5% rice husk, 1% gypsum, 1% calcium carbonate, and the water content of the culture medium is 60-65%. Mix the components, stir them evenly, put them into a polypropylene plastic bag (16cm×35cm×0.005cm), tie them, and sterilize them at 121°C for 2 hours for use.

[0051] (3) Cultivation of cultivars: Using a sterilized and cooled cultivar shovel, the original seed of Guizhou DL04 obtained in step (2) is scooped out at a mass ratio of 1:30 and inoculated into a cultivar culture medium for cultivation. The culture is carried out at 18° C., relative air humidity of 60-75%, and light-proof conditions for 20 days until the mycelium fills the flask and a large number of sclerotia are formed in the flask, thereby obtaining Guizhou DL04 cultivars. The cultivation medium is the same as the original seed culture medium in step (2).

[0052] (4) Furrowing, sowing and film covering: select arable land in a greenhouse with a pH of 6-6.5 and fine soil, remove weeds and plow the soil, and open furrows before sowing. The width of the furrow is 80-100 cm, and a 50 cm walkway is left between the furrows. The soil moisture content is 40-45%. Break the Guizhou DL04 cultivar obtained in step (3) into small particles and evenly spread them on the furrow surface. Sow 400 bags of cultivar per mu of arable land, and immediately cover the furrow with a layer of soil 2-3 cm thick.

[0053] (5) Mycelium culture and placement of nutrient bags: After sowing, the maximum temperature in the greenhouse is controlled at 15-20°C, the relative humidity of the air is 60-70%, the soil moisture content is 45%, and the light intensity is 50-100 lux. After 5 days, the mycelium will cover the surface of the ridge to form a white "fungus frost". The nutrient bags are placed. Each nutrient bag is cut with two cuts parallel to the long side of the nutrient bag with a clean knife. The cut surface is placed close to the soil on the ridge surface. 2,000 nutrient bags are evenly placed per mu of land. After the nutrient bags are placed, they are covered with black polypropylene film with air holes. The nutrient bags are placed in the field for about 45 days, and the black polypropylene film is removed. The preparation method of the nutrient bag is as follows: 90% wheat, 9% rice husk, and 1% quicklime are mixed evenly according to the weight percentage ratio, and the water content is 60-65%, and stirred evenly. The cultivation bag uses a polypropylene plastic bag (12cm×24cm×0.005cm). The mixed nutrients are put into the bag, tied with a polypropylene rope, sterilized at 121°C for 1 hour, and then cooled to room temperature.

[0054] (6) Primordial differentiation: After removing the mulch film in step (5), water is sprayed to make the soil moisture content reach 50-55%. During the fruiting body growth stage, the maximum temperature in the greenhouse is controlled between 10-20°C and the minimum temperature is not less than 3°C. The relative humidity of the air is 75-85%, and the light intensity is 200-300 lux. The greenhouse is naturally ventilated to induce primordium formation. A large number of primordia are formed about 5 days after spraying water. After the primordia are formed, continue to cultivate to form young mushrooms of about 1-2 cm.

[0055] (7) Management and harvesting of mushrooms: The maximum temperature in the greenhouse is controlled at 10-20℃, the relative humidity is 70-80%, the soil moisture content is 40-45%, the light intensity is 500-1000lux, the greenhouse is naturally ventilated, and the high temperature is cooled by spraying, ventilation of the greenhouse side windows, and covering the roof with reflective film. It takes about 20-25 days from the occurrence of primordium to the maturity of the fruiting body. When the fruiting body grows to 5-8cm in height, the ridges and pits of the cap are clear, and the ascocarp part has basically unfolded, it is mature and should be harvested in time.

[0056] Results (see Figure 1 ) The ascocarps of the six-sister morel strain Guizhou DL04 of the present invention are light brown, with good mushroom shape and high commercial value. As can be seen from Table 2, the period from sowing to mushroom harvesting of the strain Guizhou DL04 of the present invention is 75 to 80 days, while the cultivation period of the existing six-sister morel main cultivated varieties Guizhou Morel No. 1, Lefeng No. 2, and Faxing No. 1 is 100 to 130 days. The cultivation period of the strain Guizhou DL04 of the present invention is 20 to 50 days shorter than that of other strains. At the same time, the average agricultural cultivation yield of Guizhou DL04 of the present invention is 600.3kg / 667m 2 The yield of other main cultivated Morchella liumei strains is 330~357kg / 667m 2The above results show that the strain Guizhou DL02 of the present invention has a shorter cultivation period and higher yield than other main cultivated Morchella liumei.

[0057] Table 2 Comparative test results of the cultivation cycle and yield of the strain Guizhou DL02 of the present invention and other Morchella lilii strains

[0058] Guizhou DL04 Guizhou Morel No. 1 Lefeng No.2 Fa Xing No. 1 Cultivation period (d) 75～80 100～110 110～130 100～110 <![CDATA[Yield (kg / 667m 2 )]]> 600.3 330.46 346.2 357.6

[0059] Example 5 Arsenic stress resistance test of the solid strain of the present invention Guizhou DL04

[0060] (I) Test strains: 1. The strain of the present invention, Guizhou DL04; 2. Guizhou Morchella No. 1 (the six-sister Morchella strain approved by Guizhou Province in 2022); 3. Lefeng No. 2 (the six-sister Morchella strain approved by Guizhou Province in 2023); 4. Faxing No. 1 (the six-sister Morchella strain promoted for cultivation in Qiandongnan area of ​​Guizhou Province).

[0061] (II) Test methods

[0062] (1) Arsenic standard solution of different concentrations was added to PDA medium. The final arsenic concentrations in the medium were 2, 4, 6, 8, and 10 mg / L, respectively. PDA medium without arsenic was used as the blank control (CK). There were 26 treatments in total, and the pH of all mediums was adjusted to 7. Three replicates were set at different concentrations, and the Morchella edulis blocks were inoculated and cultured in an incubator at 23°C. The mycelial growth in different culture media was recorded.

[0063] (2) After inoculation on solid culture medium, when any treatment fills the plate, the culture can be stopped, the growth time is recorded, the plate is photographed, the colony diameter of each treatment is measured by the cross-hatch method, and the average daily growth rate of hyphae is calculated by measuring the hyphae length on the plate.

[0064] The results (see Table 3) showed that the solid mycelial growth rate of the strain Qian DL04 of the present invention under different concentrations of arsenic stress was higher than that of other varieties, indicating that the strain Qian DL04 of the present invention has a higher arsenic stress resistance ability than other main cultivated varieties.

[0065] Table 3 Comparative test results of mycelial growth rate of solid strain Guizhou DL04 of the present invention at different arsenic concentrations

[0066]

[0067] Example 6 Arsenic stress resistance test of the liquid strain of the present invention Guizhou DL04

[0068] (I) Test strains: 1. The strain of the present invention, Guizhou DL04; 2. Guizhou Morchella No. 1 (the six-sister Morchella strain approved by Guizhou Province in 2022); 3. Lefeng No. 2 (the six-sister Morchella strain approved by Guizhou Province in 2023); 4. Faxing No. 1 (the six-sister Morchella strain promoted for cultivation in Qiandongnan area of ​​Guizhou Province)

[0069] (II) Test methods:

[0070] (1) Liquid arsenic stress: Different concentrations of arsenic standard solution were added to PDB liquid culture medium. The final arsenic concentrations in the culture medium were 2, 4, 6, 8, and 10 mg / L, respectively. The culture medium without arsenic was used as the blank control (CK). The pH of all culture media was adjusted to 7. Each bottle of culture medium was inoculated with a Morchella strain for culture. Six Morchella blocks with a diameter of 5 mm were inoculated and cultured in a shaking incubator at 23°C, 150 r / min, and protected from light for 5 days. Three replicates were set for each treatment. The mycelial growth in different culture media was recorded.

[0071] (2) Determination of mycelial biomass under arsenic stress in liquid culture: Filter the mycelial pellets in the liquid culture medium with a 100-mesh filter, and repeatedly rinse the mycelial pellets with RO water. Then, place the mycelium in an oven at 45°C and dry it to constant weight, and weigh the mass of the dry mycelium.

[0072] The results (see Table 4) showed that the liquid mycelial biomass of the strain Qian DL04 of the present invention was higher than that of other strains under different concentrations of arsenic stress, indicating that the strain Qian DL04 of the present invention has a higher arsenic stress resistance than other main cultivated strains.

[0073] Table 3 Comparative test results of mycelial biomass of the present invention's strain Qian DL04 liquid inoculation at different arsenic concentrations

[0074]

Claims

1. A Morchella sextelata strain Guizhou DL04, which is deposited in China Center for Type Culture Collection with a deposit number of CCTCC NO: M2022900.

2. Use of the strain Guizhou DL04 according to claim 1 in food or health products.

3. A food or health product, characterized in that: The food or health product contains the strain Qian DL04 or the extract of Qian DL04 according to claim 1.

4. Use of the strain Guizhou DL04 according to claim 1 in beverages.

5. A beverage, characterized in that The beverage contains the strain Guizhou DL04 or an extract of Guizhou DL04 according to claim 1.

6. Use of the strain Guizhou DL04 according to claim 1 in preparing drugs for improving human immunity.

7. A genetically engineered Morchella liumei, characterized in that: The starting strain of the genetically engineered Morchella lilii is the strain Guizhou DL04 described in claim 1.

Images