A monoclonal antibody against porcine delta coronavirus S2 subunit, its hybridoma cell line and application

Abstract

The present invention discloses a monoclonal antibody against the S2 subunit of porcine delta coronavirus, its hybridoma cell line and application, and belongs to the field of biological detection technology. The hybridoma cell line has been deposited in the China Center for Type Culture Collection with a deposit number of CCTCC NO: C2024223. The hybridoma cell line can stably secrete a monoclonal antibody against the S2 subunit of porcine delta coronavirus. The heavy chain of the antibody is of IgG2a type and the light chain is of Kappa type. Its antigenic epitope is 52-NSRC-55, which is highly conserved in PDCoV strains. The antibody can specifically recognize PDCoV and has no cross-reaction with other common porcine enteroviruses. It can be used in laboratory and clinical testing. The present invention provides research tools and materials for studying the fusion process of PDCoV with host cells and developing PDCoV diagnostic reagents.

Description

Technical Field

[0001] The present invention relates to the field of biological detection technology, and in particular to a monoclonal antibody against porcine delta coronavirus S2 subunit, a hybridoma cell line thereof, and applications thereof. Background Art

[0002] Porcine deltacoronavirus (PDCoV) is a novel enteropathogenic coronavirus of swine that can cause diarrhea, vomiting, dehydration, and even death in piglets. PDCoV is primarily transmitted through the fecal-oral route, with contaminated feed and fomites being potential sources of infection. Unlike other porcine viruses, PDCoV has the potential for cross-species transmission. Evidence suggests that PDCoV can cross species barriers and infect non-porcine hosts. PDCoV can infect calves, chickens, turkeys, and mice, and there have even been reports of human PDCoV infection. These findings highlight the virus's significant potential for interspecies transmission and the risks it poses to human and animal health. As there are currently no effective vaccines or antiviral drugs against PDCoV, effective disease prevention and control in the early stages of infection, as well as the development of rapid and accurate diagnostic tests, are crucial for controlling the spread of PDCoV.

[0003] The PDCoV genome is approximately 25kb and encodes the following proteins: ORF1a / b, spike protein (S), envelope protein (E), membrane protein (M), nonstructural protein 6 (NS6), nucleocapsid protein (N), nonstructural protein 7 (NS7), and nonstructural protein 7a (NS7a). The S protein is a trimeric type 1 glycoprotein on the surface of the coronavirus. During infection, host proteases cleave the S protein into S1 and S2 subunits. The S1 subunit includes the C-terminal domain (CTD) and the N-terminal domain (NTD), which mediate receptor recognition and binding. The S2 subunit mediates virus-cell membrane fusion. The S protein is a key mediator of viral entry and the main target of neutralizing antibodies. It includes S1-NTD (aa 50-286), S1-CTD (aa 278-616), and S2 (aa 601-1087), which have been shown to induce neutralizing antibody responses. Monoclonal antibodies (mAbs) can recognize and bind to specific antigens on the surface of pathogens such as viruses. They are not likely to cross-react with other proteins and are highly specific.

[0004] To date, monoclonal antibodies against several PDCoV proteins, including N, S1, NS6, and NS7, have been reported and their B cell epitopes identified, whereas monoclonal antibodies against the PDCoV S2 subunit have not yet been reported. Summary of the Invention

[0005] The present invention aims to provide a monoclonal antibody against the S2 subunit of porcine delta coronavirus, a hybridoma cell line thereof, and its application to address the problems of the above-mentioned prior art. The hybridoma cell line obtained by the present invention can stably secrete a monoclonal antibody against the S2 subunit of porcine delta coronavirus. The antibody can specifically recognize PDCoV and has no cross-reaction with other common porcine enteroviruses. It can be used for laboratory and clinical detection.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The present invention provides a hybridoma cell line PDCoVS2-11E5 that secretes a monoclonal antibody against the S2 subunit of porcine delta coronavirus, which has been deposited in the China Center for Type Culture Collection with a deposit number of CCTCC NO: C2024223 and a deposit date of August 14, 2024.

[0008] The present invention also provides a monoclonal antibody 11E5 against the porcine delta coronavirus S2 subunit prepared by the hybridoma cell line PDCoV S2-11E5.

[0009] The present invention also provides a method for preparing the monoclonal antibody 11E5, comprising secreting and proliferating the hybridoma cell line PDCoV-S2-11E5 in the peritoneal cavity of a mouse, separating and purifying the ascites, and obtaining the monoclonal antibody 11E5.

[0010] The present invention also provides a use of the hybridoma cell line PDCoV S2-11E5 or the monoclonal antibody 11E5 in preparing a product for detecting porcine delta coronavirus.

[0011] The present invention also provides a use of the hybridoma cell line PDCoV S2-11E5 or the monoclonal antibody 11E5 in preparing a drug for preventing and treating porcine delta coronavirus infection.

[0012] The present invention also provides an antigenic epitope peptide specifically recognized by the monoclonal antibody 11E5, the amino acid sequence of which is shown in SEQ ID NO.51.

[0013] The present invention also provides the use of the antigen epitope peptide in preparing a vaccine for preventing porcine delta coronavirus infection.

[0014] The present invention discloses the following technical effects:

[0015] The present invention uses Escherichia coli to express and purify recombinant PDCoV S2 subunit protein, and obtains a hybridoma cell line that secretes anti-PDCoV S2 subunit mAb by immunizing mice. A monoclonal antibody 11E5 (mAb) against the PDCoV S2 subunit was prepared. 11E5 was detected using an antibody subtyping kit, and its heavy chain was identified as IgG2a and its light chain as kappa. Western blotting identified its antigenic epitope as 52-NSRC-55, which is highly conserved among PDCoV strains.

[0016] The monoclonal antibody 11E5, developed in the present invention, specifically targets the PDCoV S2 subunit and exhibits excellent specificity and reactivity. It specifically recognizes PDCoV and exhibits no cross-reactivity with other common porcine enteroviruses, making it suitable for both laboratory and clinical testing. The identified epitope provides fundamental information for further characterizing the antigenic structure of the PDCoV S2 subunit, providing research tools and materials for studying the fusion process between PDCoV and host cells and developing diagnostic reagents for PDCoV. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 The expression and identification results of PDCoV S2 recombinant protein, wherein A is the PDCoV S2-PCR identification result, M is DL8000 DNA marker, lane 1 is pET-32a-PDCoV S2 recombinant protein expression plasmid, and lane 2 is pET-32a empty vector; B is the SDS-PAGE identification diagram of the bacterial solution after induced expression of pET-32a-PDCoV S2 recombinant protein expression plasmid, M is protein molecular mass marker, lane 1 is the PDCoVS2 recombinant protein band after SDS-PAGE of the bacterial solution supernatant collected after ultrasonic lysis, and lane 2 is the PDCoV S2 protein band after SDS-PAGE of the bacterial solution precipitate collected after ultrasonic lysis; C is the SDS-PAGE identification of the purified PDCoV S2 recombinant protein, M is the protein molecular mass marker, lane 1 is the SDS-PAGE band of the purified PDCoV S2 recombinant protein; D is the purified PDCoV Western blot results of S2 recombinant protein, M is the protein molecular mass marker, lane 1 is pET-32a-PDCoV S2 recombinant protein, lane 2 is pET-32a empty vector;

[0018] Figure 2The identification results of the monoclonal antibody 11E5 against the PDCoV S2 recombinant protein are shown in Figure 1; A is the IFA identification result of PDCoV S2-11E5; B is the ELISA identification result of PDCoV S2-11E5; C is the SDS-PAGE identification result after purification of the monoclonal antibody 11E5, M is the protein molecular weight marker, and lane 1 is the purified pET-32a-PDCoV S2 recombinant protein; D is the subtype identification result of the PDCoV S2-11E5 antibody;

[0019] Figure 3 Figures 2 and 3 show the working concentration results of PDCoV S2-11E5 antibody IFA, ELISA, and Western Blot. A shows the working concentration of PDCoV S2-11E5 by IFA, B shows the working concentration of PDCoV S2-11E5 by ELISA, and C shows the working concentration of PDCoV S2-11E5 by Western Blot.

[0020] Figure 4 The specific reactivity test results of antibody 11E5; A is the test result of the indirect ELISA test method; B is the test result of the immunoblotting method, M is the protein molecular weight marker, lane 1 is PDCoV, lane 2 is TGEV, lane 3 is PEDV, lane 4 is PSV, and lane 5 is PAstV5; C is the test result of the specific IFA test method;

[0021] Figure 5Figure 1 is a flow chart showing the hydrophilicity and epitope identification of antibody 11E5; A is the truncation process of the PDCoV S2 protein gene; B is 11E5 recognizing the S2-1 protein, M is a protein molecular mass marker, S2-1 is the PDCoV truncation S2-1, S2-2 is the PDCoV truncation S2-2, and S2-3 is the PDCoV truncation S2-3; C is 11E5 recognizing the S2-A-2 protein, M is a protein molecular mass marker, lane 1 is the PDCoV truncation S2-A-1, lane 2 is the PDCoV truncation S2-A-2, lane 3 is the PDCoV truncation S2-A-3, lane 4 is the PDCoV truncation S2-A-4, and lane 5 is the PDCoV truncation S2-A-5; D is 11E5 recognizing the S2-C-1 and S2-C-2 proteins, M is a protein molecular mass marker, lane 1 is the PDCoV truncation S2-A-1, lane 2 is the PDCoV truncation S2-A-2, lane 3 is the PDCoV truncation S2-A-3, lane 4 is the PDCoV truncation S2-A-4, and lane 5 is the PDCoV truncation S2-A-5. Lane 2 is PDCoV truncation S2-C-2, lane 3 is PDCoV truncation S2-C-3, lane 4 is PDCoV truncation S2-C-4, lane 5 is PDCoV truncation S2-C-5, lane 6 is PDCoV truncation S2-C-6; lane 7 is PDCoV truncation S2-C-7, lane 8 is PDCoV truncation S2-C-8, lane 9 is PDCoV truncation Short form S2-C-9; E is 11E5 recognition S2-E-3 protein, M is protein molecular mass marker, lane 1 is PDCoV truncation S2-E-1, lane 2 is PDCoV truncation S2-E-2, lane 3 is PDCoV truncation S2-E-3, lane 4 is PDCoV truncation S2-E-4, lane 5 is PDCoV truncation S2-E-5, lane 6 is PDCoV truncation S2-E-6;

[0022] Figure 6 The results of affinity test between antibody 11E5 and PDCoV S2 antigen;

[0023] Figure 7 Figure 3 is the analysis result of the conservation and spatial structure of the S2 antigen epitope recognized by antibody 11E5; A is the phylogenetic analysis result based on the S gene of PDCoV HNZK-02 strain and 18 PDCoV reference strains in GenBank; B is the comparison result of the S2 antigen epitope recognized by antibody 11E5 with other strains; C is the spatial structure of the S2 antigen epitope recognized by antibody 11E5 on the PDCoV S2 protein. DETAILED DESCRIPTION

[0024] The PDCoV HNZK-02 strain (GenBanK accession number MH708124), TGEV HN-2012 strain (GenBanK accession number OP434397), PEDV HN-2021 strain (GenBanK accession number OR707084), PSV HNHB-01 strain (GenBanK accession number MN939541), and PAstV5 HNPDS-01 strain (GenBanK accession number OQ781001) used in the examples of the present invention were all deposited by the Animal Molecular Pathogenesis Laboratory of Henan Agricultural University. pET-32a(+) plasmid, LLC-PK1 cells, and SP2 / 0 cells were all deposited by the Animal Molecular Pathogenesis Laboratory of Henan Agricultural University; BALB / c mice were purchased from the Henan Provincial Experimental Animal Center; and the mouse monoclonal antibody subtype identification kit was purchased from Wuhan Sanying Biotechnology Co., Ltd.

[0025] Example

[0026] 1. Select the dominant region of PDCoV S2 antigen

[0027] DNA Star software was used to analyze the antigenicity of PDCoV S2, and the S2 antigenic dominant region 1-608aa was selected.

[0028] 2. Construction and identification of pET-32a-PDCoV S2 recombinant vector

[0029] Total RNA from the PDCoV HNZK-02 strain was extracted using the Trizol method and transcribed into cDNA using a reverse transcription kit. Based on the PDCoV HNZK-02 strain sequence published in GenBank, primers were designed for amplification, and PCR amplification was performed using the PDCoV cDNA as a template.

[0030] PCR amplification primer F: GCCATGGCTGATATCGGATCCTCCACATTACAGAATACTCGACCATC (SEQ ID NO. 1); R: TTGTCGACGGAGCTCGAATTCCTACCATTCCTTAAACTTAAAGGACG (SEQ ID NO. 2).

[0031] Reaction procedure: 95°C for 5 min; 34 cycles of 95°C for 1 min, 58°C for 30 s, and 72°C for 1 min; and 72°C for 10 min.

[0032] Reaction system (20 μL in total): Green Taq Mix 10 μL, ddH2O 7 μL, primers 0.5 μL each, cDNA 2 μL.

[0033] The amplified gene fragment and pET-32a(+) vector were digested with nuclease endonucleases HindⅢ and XhoⅠ, ligated with T4 DNA Ligase, and transformed into Escherichia coli BL-21. Single colonies were picked for bacterial liquid PCR identification (the results are shown in Figure 1 The strains with positive identification results (pET-32a-PDCoV S2) were sent to Shangya Biotechnology Co., Ltd. for sequencing, and the strains with correct sequences were retained for subsequent experiments.

[0034] 3. Expression and purification of recombinant PDCoV S2 protein

[0035] The frozen pET-32a-PDCoV S2 expression strain was inoculated into liquid LB medium with ampicillin resistance and shaken at 37°C. When it grew to the logarithmic phase (OD = 0.6), IPTG with a final concentration of 0.1 mmol / L was added to induce the expression of PDCoV S2 recombinant protein. The protein was treated with an ultrasonic disruptor for 40 minutes and the PDCoV S2 protein purification experiment was performed (the results are shown in Figure 2). Figure 1 The purified protein solution was concentrated by ultrafiltration tube, the protein concentration was determined, and the solution was stored in a -80℃ refrigerator (the results were shown in FIG. Figure 1 (as shown in C)

[0036] in, Figure 1 The expression and identification results of PDCoV S2 recombinant protein; A is the PDCoV S2-PCR identification result, M is DL8000 DNA marker, lane 1 is the pET-32a-PDCoV S2 recombinant protein expression plasmid, and lane 2 is the pET-32a empty vector; B is the SDS-PAGE identification of the bacterial solution after induced expression of the pET-32a-PDCoV S2 recombinant protein expression plasmid, M is the protein molecular mass marker, lane 1 is the PDCoVS2 recombinant protein band after SDS-PAGE of the bacterial solution supernatant collected after ultrasonic lysis, and lane 2 is the PDCoV S2 recombinant protein band after SDS-PAGE of the bacterial solution precipitate collected after ultrasonic lysis; C is the SDS-PAGE identification of the purified PDCoV S2 recombinant protein, M is the protein molecular mass marker, and lane 1 is the SDS-PAGE band of the purified PDCoV S2 recombinant protein; D is the Western blotting of the purified PDCoV S2 recombinant protein Blot result diagram, M is the protein molecular mass marker, lane 1 is the pET-32a-PDCoV S2 recombinant protein, and lane 2 is the pET-32a empty vector.

[0037] 4. Screening of positive hybridoma cell lines

[0038] Four BALB / c mice were immunized three times with purified PDCoV S2 recombinant protein, with a two-week interval between immunizations. The first immunization was administered at a dose of 100 μg per mouse, emulsified with an equal volume of Freund's complete adjuvant suspension and the protein solution. The second and third immunizations were administered subcutaneously. Three days before fusion, a booster immunization of 50 μg per mouse was administered without adjuvant via intraperitoneal injection. When serum titers reached a high level, splenocytes from the mouse with the highest serum titer were fused with myeloma cells (SP2 / 0). After culture in HAT selective medium, the cells were tested by indirect ELISA using ELISA plates coated with recombinant PDCoV S2 protein. Positive hybridoma cell lines were screened, subcloned to single cells by limiting dilution, and then expanded in culture. A hybridoma cell line that stably secretes monoclonal antibodies was obtained, designated PDCoV S2-11E5, and stored frozen in liquid nitrogen.

[0039] The hybridoma cell line PDCoV S2-11E5 has been deposited in the China Center for Type Culture Collection. The deposit information is as follows:

[0040] The deposit date is August 14, 2024;

[0041] Deposit number: CCTCC NO: C2024223;

[0042] Deposit name: Hybridoma cell line PDCoV-S2-11E5;

[0043] Depository: China Center for Type Culture Collection;

[0044] Specific address: Wuhan University, No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province.

[0045] 5. Preparation and purification of monoclonal antibody ascites

[0046] Healthy BALB / c mice were selected and injected intraperitoneally with 500 μL of liquid paraffin one week before cell injection. Hybridoma cells were injected into the mouse peritoneal cavity. After the mouse abdomen swelled, ascites was aspirated, excess fat tissue was removed by centrifugation, and the ascites was stored in a -40°C refrigerator. Monoclonal antibodies in the ascites were purified using ammonium octanoate-ammonium sulfate precipitation. The purified antibodies were verified by SDS-PAGE. The results are shown below. Figure 2 As shown in C.

[0047] 6. Labeling of Antibody 11E5

[0048] The HRP conjugation kit (periodate method, product number D601047) purchased from Shanghai Bioengineering Co., Ltd. was used for labeling according to the operating steps in the kit instructions to obtain the HRP-labeled 11E5 antibody.

[0049] 7. Identification of Monoclonal Antibodies

[0050] 7.1 IFA Identification of Monoclonal Antibodies

[0051] PDCoVHNZK-02, PAstV5 HNPDS-01, TGEVHN-2012, PEDVCV777, and PSV HNHB-01 were inoculated on LLC-PK1 and fixed with anhydrous ethanol at 4°C for 8 hours. In the PDCoV group and cell control group, PDCoV monoclonal antibody 11E5 (1:500 dilution) was used as the primary antibody, and FITC-goat anti-mouse IgG (1:500 dilution) was used as the secondary antibody; in the positive control group, mouse monoclonal antibody of the corresponding strain (1:500 dilution) was used as the primary antibody, and FITC-goat anti-mouse IgG (1:500 dilution) was used as the secondary antibody. After incubation with antibodies and washing with PBST, a mounting medium containing DAPI was added, and the cells were observed and photographed using an inverted fluorescence microscope. The results are shown in Figure 2. Figure 2 As shown in A.

[0052] 7.2 Identification of Monoclonal Antibodies by Indirect ELISA

[0053] The indirect ELISA method was used to identify the PDCoV S2-11E5 antibody. The expressed PDCoV S2 protein (coating at 4°C for 12h) and PDCoV virus (coating at 37°C for 4h) were coated and blocked with 2.5% BSA at 37°C for 2h. The PDCoV S2-2E9 antibody was used as the positive plate for the protein plate and the virus plate, and the negative mouse serum and blank culture medium MEM were used as the negative plate. The plates were incubated at 37°C for 1h, and then incubated with HRP-goat anti-mouse at 37°C for 1h. 100 μL of the color development solution was added to each well and incubated at 37°C for 10min. The stop solution was added and the OD was read on a microplate reader. 450nm Value, the result is Figure 2 As shown in B.

[0054] 7.3 Monoclonal Antibody Subtype Identification

[0055] The monoclonal antibody 11E5 subtype was identified according to the steps in the Wuhan Mitaka Mouse Monoclonal Antibody Subtype Identification Kit (Cat. No. PK20002). The steps are as follows: Dilute the purified antibody to 50 ng / mL with PBST and add 50 μL / well to the ELISA plate. Add 1× goat anti-mouse IgM+IgG-HRP to the ELISA plate at 50 μL / well. Incubate at room temperature for 1 hour, wash the plate 3 times with 1× PBST, prepare the developer according to the ratio of A solution: B solution = 1:100, add 100 μL to each well and color at room temperature in the dark for 15 minutes, add 100 μL of stop solution to each well, and read the OD value on a microplate reader. 450nm The well with the highest OD value corresponds to the corresponding subtype. The results are as follows Figure 2 As shown in D, the heavy chain subtype of monoclonal antibody 11E5 is IgG2a, and the light chain subtype is Kappa.

[0056] 7.4 IFA, indirect ELISA and WB working concentration determination

[0057] Using the indirect ELISA method, PDCoV S2 protein was coated on the ELISA plate and incubated at 4 ° C for 12 h, blocked with 2.5% BSA, and PDCoV S2-11E5 was diluted at a ratio of 1:1000, 1:2000, 1:4000, 1:8000, 1:16000, 1:32000, 1:64000, 1:128000, 1:256000, 1:512000, 100 μL per well, incubated at 37 ° C for 1 h, incubated with goat anti-mouse secondary antibody, 37 ° C for 1 h, added 100 μL of color development solution per well, incubated at 37 ° C for 10 min, and added stop solution to read OD on a microplate reader. 450 The working concentration of PDCoV S2-11E5 antibody was optimized. Figure 3 As shown in B.

[0058] The IFA working concentration of PDCoV S2-11E5 antibody was optimized. The specific experimental steps are shown in 7.1. The primary antibody of the experimental group was diluted serially at 1:400, 1:800, 1:1600, 1:3200, and 1:6400. The control group used negative mouse serum at a dilution of 1 / 400, and the positive group used PDCoV N-6B7 (1:400 dilution) (this antibody was prepared and preserved for this experiment, with a deposit number of CCTCC NO: C202178). The cells were incubated at 4°C for 12 h. FITC-goat anti-mouse IgG (1:500 dilution) was used as the secondary antibody and incubated at room temperature for 1 h. The mounting medium containing DAPI was then added. The cells were observed and photographed using an inverted fluorescence microscope. The results are shown in Figure 2. Figure 3 As shown in A.

[0059] The working concentration of the PDCoV S2-11E5 antibody was optimized by Western Blot technology. The specific experimental steps are as follows: LLC-PK1 cells were plated in a 12-well plate, placed in a 37°C CO2 incubator for 12 hours, and then inoculated with the PDCoV strain. At the same time, a cell control group without the strain was set up and placed in a 37°C CO2 incubator for 10-12 hours. The cell samples were collected, 6X Loading buffer was added and boiled for 10 minutes to prepare PDCoV virus-infected LLC-PK1 cell samples and LLC-PK1 control samples. After the prepared gel was subjected to SDS-PAGE electrophoresis, the proteins on the gel were transferred to a nitrocellulose membrane. The PDCoV S2-11E5 antibody was diluted with 5% skim milk at a dilution ratio of 1:2000, 1:4000, 1:8000, and 1:12000, and the membrane was incubated on a shaker at 4°C for 12 hours. The membrane was washed 5 times with TBST, and then incubated on a shaker at room temperature for 1 hour with HRP-goat anti-mouse IgG antibody (dilution 1:5000) as the secondary antibody. The membrane was washed 5 times with TBST and developed. The results are shown in Figure 2. Figure 3 As shown in C, Figure 3 C represents different dilution multiples of 11E5 antibodies (1:2000, 1:4000, 1:8000, 1:12000), lane 1 is LLC-PK1 cell samples infected with PDCoV virus, and lane 2 is LLC-PK1 cells.

[0060] 8. Evaluation of the specific reactivity of antibody 11E5

[0061] The reactivity of antibody 11E5 was detected by indirect ELISA using PDCoV S2, PDCoV, TGEV, PEDV, PSV, and PASTV5 proteins, indicating that antibody 11E5 has good specificity ( Figure 4 The reactivity of 11E5 with LLC-PK1 cells infected with PDCoV, TGEV, PEDV, PSV, and PASTV5 was analyzed by immunoblotting. Western blot showed that antibody 11E5 had good antibody specificity ( Figure 4 Specific IFA detection of mAb 11E5 in LLC-PK1 cells infected with PDCoV, TGEV, PEDV, PSV, and PASTV5 showed that antibody 11E5 had good antibody specificity ( Figure 4 C), which is consistent with the Western blot results.

[0062] 9. Identification of the hydrophilicity and recognized antigenic epitopes of monoclonal antibodies

[0063] Through a large number of experiments, the B cell epitope recognized by the antibody 11E5 was identified. The amino acid sequence of the S2 protein was analyzed using DNAStar software, and a more precise antigenic epitope was screened through continuous screening of truncations. After the first truncation, the complete S gene was divided into three overlapping fragments, which were cloned into the pET-32a(+) vector and named S2-1, S2-2, and S2-3, respectively. The generated 11E5 was used for prokaryotic expression and protein blotting identification. The results showed that 11E5 was recognized in S2-1. S2-1 was truncated into S2-A1, S2-A2, S2-A3, S2-A4, and S2-A5, and these five truncations were verified by prokaryotic expression and SDS-PAGE. The results showed that 11E5 recognized the S2-A-2 protein. The S2-A-2 fragment of 11E5 was truncated into S2-C-1, S2-C-2, S2-C-3, S2-C-4, S2-C-5, S2-C-6, S2-C-7, S2-C-8, and S2-C-9, respectively, and expressed in prokaryotes. These nine truncations were verified by SDS-PAGE. Results showed that 11E5 could recognize both S2-C-1 and S2-C-1 proteins. Western blot analysis was performed to determine the position of 11E5 at positions 51-55AA. The corresponding truncations of 11E5 were extended forward and backward to design new truncations, namely S2-E-1, S2-E-2, S2-E-3, S2-E-4, S2-E-5, and S2-E-6. These truncations were expressed in prokaryotes and verified by SDS-PAGE. The results showed that the minimum amino acid sequence of 11E5 was located at position 52-55AA ( Figure 5 The primers used in the identification process are shown in Table 1.

[0064] Table 1 Primers involved in the identification process

[0065]

[0066]

[0067] 10. Affinity Analysis of Antibody 11E5

[0068] The Biacore X100 protein interaction analysis system was used at 25°C. The protein exchange buffer for kinetic analysis was PBST (pH 7.0). The PDCoV S2 recombinant protein (1 mg / mL) was immobilized on a CM5 chip using a standard EDC / NHS coupling method. The Biacore X100 protein interaction analysis system was used to analyze the binding affinity and kinetic parameters between the PDCoV S2 recombinant protein and the antibody 11E5 by surface plasmon resonance (SPR). The results showed that the affinity of this antibody was 2.133×10-9 M( Figure 6 , as shown in Table 2).

[0069] Table 2 Affinity test of monoclonal antibody 11E5 and antigen S2 protein

[0070]

[0071] 11. Prediction of the spatial structure of antigen epitopes

[0072] To analyze the conservation of the PDCoV S2 antigenic epitope, the present invention obtained the S gene sequences of 18 PDCoV strains from different regions from NCBI (see Table 3). The neighbor joining (NJ) method in the molecular evolutionary genetics analysis (MEGA) software (version 7.0) was used, using the p-distance model and guiding 1000 repeats. The S2 epitopes identified by mAb 2E9 and mAb 11E5 were compared with different virulent strains using DNAstar MegAlign software, and it was found that the epitopes between PDCoV were conserved ( Figure 7 In order to clarify the spatial location of the epitope on the PDCoV S2 protein, the present invention predicted the three-dimensional structure of the PDCoV S2 protein on the Swiss model website (https: / / swissmodel.expasy.org) and marked its antigenic epitopes using the chimera software. The results are shown in FIG. Figure 7 As shown in BC, the amino acid sequence of the antigen epitope peptide is NSRC (SEQ ID NO.51), and the antigen epitope is an α-helix.

[0073] Table 3 Epitope sequence information of PDCoV strains collected from NCBI for comparison and identification

[0074] Strain name Collection time source Sequence accession number CH7328 2020 Guangdong.China MW816149 CH-GX-PDCoV-2081-2018 2018 MZ388474 CH-JXJGS01-2016 2016 Jiangxi,China MK625638 CHN-HeN06-2022 2022 Henan, China OP501870 CHN-HN-1601 2018 Beijing.China MG832584 CHN-JS-2018 2018 Jiangsu, China OQ551110 CHN-Sichuan-2019 2019 Sichuan, China MK993519 HeN-swine-2015 2015 Henan, China MIN942260 PDCoV-01-JS-2022 2022 Jiangsu, China OQ504186 PDCeV-CH-SDLY52-2021 2021 Shandong.China OM256446 PDCoV-KQ-Swine-2023 2023 Hubei.China OQ790128 PDCoV-RBR-1-2016-Thailand 2016 Thailand MZ802777 PDCoV-SN-Swine-2018 2018 Hubei, China OQ790129 PDCoV-USA-lowal36-2015 2015 lowal,USA KX022602 PDCoV-USA-Nebraska145-2015 2015 Nebrska,USA KX022605 PDCoV-USA-Ohio137-2014 2014 Ohio, USA KJ601780 PDCoV-WH-2023 2023 Hubei, China OR269935 PDCoV-WH-A 2023 Hubei, China OP792038

[0075] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. A hybridoma cell line PDCoV-S2-11E5 secreting monoclonal antibodies against porcine delta coronavirus S2 subunit, characterized in that: It has been deposited in the China Center for Type Culture Collection with the collection number CCTCC NO: C2024223 and the collection date of August 14, 2024.

2. A monoclonal antibody 11E5 against the S2 subunit of porcine delta coronavirus prepared by the hybridoma cell line PDCoV-S2-11E5 according to claim 1.

3. The monoclonal antibody 11E5 according to claim 2, characterized in that The heavy chain subtype of the monoclonal antibody 11E5 is IgG2a, and the light chain subtype is Kappa.

4. A method for preparing the monoclonal antibody 11E5 according to claim 2 or 3, characterized in that: The method comprises secreting and proliferating the hybridoma cell line PDCoV-S2-11E5 according to claim 1 in the peritoneal cavity of mice, separating and purifying the ascites, and obtaining the monoclonal antibody 11E5.

5. Use of the hybridoma cell line PDCoV-S2-11E5 according to claim 1 or the monoclonal antibody 11E5 according to claim 2 or 3 in the preparation of a product for detecting porcine delta coronavirus.

6. An antigenic epitope peptide specifically recognized by the monoclonal antibody 11E5 according to claim 2 or 3, characterized in that: The amino acid sequence of the antigen epitope peptide is shown in SEQ ID NO.51.

Images