Gene transformation method of pythium aphanidermatum

Abstract

The invention provides an efficient and stable nori pythium gene transformation method which comprises antibiotic concentration screening, protoplast preparation, transformation system optimization, positive transformant screening and transformant phenotype and gene expression stability analysis, and the evaluation method is the nori pythium gene transformation method disclosed for the first time in China. The method provides a valuable tool for researching gene functions and pathogenic mechanisms of pythium aphanidermatum in the future.

Description

Technical Field

[0001] The invention relates to the field of microbiology and pathology of algae cultivation, and in particular to a method for gene transformation of marine oomycete pathogen Pythium porphyrae. Background Art

[0002] Oomycetes are eukaryotic microorganisms that are morphologically similar to fungi. They have highly diverse lifestyles, pathogenicity, and host ranges, and are a major threat to global food safety and ecological sustainability. Oomycetes include hundreds of notorious pathogens, many of which have been included in the global quarantine list for strict control to prevent their spread. The marine oomycete Pythium porphyrae can cause red rot of porphyra, which not only causes a 30-50% reduction in porphyra production, but also makes its products lose market competitiveness. The pathogen has strong environmental adaptability and resistance, and can survive in marine sediments, surface runoff, and crops, and can even tolerate acidic fungicides and freezing treatments. Therefore, traditional methods such as drying, pickling, and refrigeration have limited effects on the prevention and control of red rot.

[0003] Revealing the functions of interacting molecules is very important for developing targeted management strategies for oomycete diseases. In recent years, the study of P. porphyra-Porphyra interaction combining genomics and transcriptomics has deepened our understanding of the pathogenic mechanism of P. porphyra. There are a large number of typical pathogenicity-related genes in the P. porphyra genome, such as crinklers, glycoside hydrolases, elicitin, etc. In response to the infection of P. porphyra, P. yezoensis upregulates the expression of genes such as pattern recognition receptors, ROS, heat shock proteins, lipid metabolism, and ubiquitination. Although a large number of pathogen-host interaction molecules have been identified, the functions of most of these genes have not yet been identified. In order to verify the in vivo functions of these genes, it is crucial to establish genetic modification technologies for P. porphyra, such as gene silencing, overexpression or gene editing. However, these research methods rely on appropriate transformation methods to transfer exogenous plasmids into cells for stable expression.

[0004] A variety of methods have been used to establish transformation methods for Pythium to study gene functions, such as PEG / CaCal2-mediated transformation of P. aphanidermatum and P. insidiosum, electroporation-mediated transformation of P. aphanidermatum, and Agrobacterium tumefaciens-mediated transformation of P. ultimum and P. guiyangense. However, the transformation method for P. porphyria has not yet been established, which is an important reason why its molecular technology development and pathogenic mechanism research are significantly slower than those of terrestrial oomycetes.

[0005] Due to the ease of operation and simple equipment required, we chose the PEG / CaCal2 method to explore the transformation method of Pythium porphyrae. The present invention prepared high-quality protoplasts, screened the appropriate antibiotic concentration, and clarified the main effect factors and optimal system that affect the transformation. Summary of the invention

[0006] In order to solve the problem of the lack of existing methods for studying the function of Porphyra oomycete pathogenic genes, we propose a Porphyra Pythium gene transformation method, which is achieved through the following technical solutions: To achieve the above object, the present invention provides a gene transformation method of Pythium porphyrae, characterized in that the steps include: antibiotic concentration screening, protoplast preparation, transformation system optimization, positive transformant screening, transformant phenotype and gene expression stability analysis, the steps are as follows: a. Antibiotic concentration screening: Prepare Geneticin G418 plates with different concentrations, inoculate Pythium porphyra cakes, and select the lowest antibiotic concentration at which mycelium does not grow; b. Protoplast preparation: Use a composite enzyme preparation to hydrolyze the mycelium of Pythium porphyrae, and screen the mycelium age and enzymatic hydrolysis time for the preparation of high-quality protoplasts; c. The pTOR-RFP plasmid was transformed into the protoplasts of Pythium porphyrae using the PEG / CaCal2 method; d. Determine positive transformants by antibiotic screening combined with PCR; e. Determine the optimal protoplast concentration, plasmid concentration and protective agent concentration for transformation through orthogonal experiments; f. Observe the growth phenotype of the transformants using an optical microscope, observe the gene expression stability of the transformants using a fluorescence microscope, and analyze the pathogenicity phenotype of the transformants through infection experiments.

[0007] Preferably, the minimum antibiotic concentration at which mycelium does not grow is 10 μg / mL.

[0008] Preferably, the mycelium age of the high-quality protoplasts is 10 days, and the enzymatic hydrolysis time is 30 minutes.

[0009] Preferably, the conditions suitable for the PEG / CaCl2 method-mediated transformation of Pythium porphyra protoplasts are: protoplast concentration 10 7 protoplasts / mL, plasmid content 35 μg, plasmid protectant 60 μg.

[0010] Preferably, the G418 plate is an agar plate to which G418 antibiotic is added.

[0011] Preferably, the above-mentioned G418 antibiotic, also known as Geneticin, is an aminoglycoside antibiotic. Aminoglycoside drugs bind to ribosomes irreversibly and cause premature termination or mistranslation of translation by destroying their proofreading ability, thereby inhibiting protein synthesis and preventing the growth of sensitive cells.

[0012] Preferably, the agar plate is one of a V8 agar plate, a corn agar plate or a PM agar plate.

[0013] Among them: Corn agar plate, also known as CMYSWA corn flour yeast extract seawater agar plate (hereinafter referred to as CMYSWA medium): 2g corn flour, 1g yeast extract, 15g agar, 1L seawater with a salinity of 20‰.

[0014] V8 agar plate, also known as V8 vegetable juice plate: 1L of 10-fold diluted V8 beverage + 3g calcium carbonate + 15g agar.

[0015] PM agar plate: also known as pea juice mannitol plate: add 700 mL of sterilized juice to 120 g of peas, filter it with 4 layers of gauze, add distilled water to 1 L, add 91.1 g of mannitol, 1.32 g of calcium chloride dihydrate, 2 g of calcium carbonate, and 15 g of agar.

[0016] Preferably, the primer sequence of PCR in the above step d is: F (5'-ATGGCCTCCTCCGAGGACGTCATC-3'); R (5'-TTAGTGATGGTGATGGTGATGGGCG-3').

[0017] The beneficial effects of the present invention are: (1) This detection method is the first publicly available method for gene transformation of Pythium porphyrae in China and is stable and efficient; (2) Provide strong technical support for the study of gene function and the analysis of pathogenic mechanism of Pythium spp. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 The present invention is suitable for the G418 concentration screening of positive transformants of Pythium porphyrae. The photo was taken 4 days after inoculation of Pythium porphyrae. Figure 2 The present invention is suitable for the G418 concentration screening of Pythium porphyria positive transformants, the mean and standard deviation are 6 biological replicates, and the significant differences (P≤0.05) among the groups were detected by Duncan analysis in SPSS 20.0, and are represented by letters; Figure 3 The effect of the age of Pythium porphyrae and the enzymatic hydrolysis time on the protoplast yield of the present invention; Figure 4 The effect of plasmid protectant on the transformation of Pythium porphyrae by rfp mediated by PEG / CaCl2 of the present invention. +: plasmid protectant added; -: plasmid protectant not added. The mean and standard deviation are from three independent experiments. The significant differences between the groups were detected by T test analysis in Excel. ** represents P ≤ 0.01;

[0019] Figure 5The PEG / CaCl2-mediated rfp transformation of Pythium porphyrae, PCR detection of positive transformants, lane M: DL2000 marker; lane 1: rfp gene detection using genomic DNA of positive transformants as template; lane 2: rfp gene detection using cDNA of positive transformants as template; lane 3: rfp gene detection using RNA of positive transformants as template; lane 4: rfp gene detection using genomic DNA of wild-type Pythium porphyrae as template; Figure 6 The PEG / CaCl2-mediated rfp transformation of Pythium porphyrae, from top to bottom, are: positive transformant hyphae fluorescence microscope observation; positive transformant sporocyst fluorescence microscope observation; wild-type Pythium porphyra fluorescence microscope observation; Figure 7 The present invention is to analyze the growth phenotype of Pythium porphyrae transformants, observe the hyphae growth, sporangium number and rfp expression of Pythium porphyrae and transformants; Figure 8 The growth phenotype analysis of the transformants of Pythium porphyriae of the present invention, the colony diameters of Pythium porphyriae and the transformants; - represents the transformants grown in the medium without G418. + represents the transformants grown in the medium with G418. The means and standard deviations are from 6 biological replicates, and the significant differences among the groups (P<0.05) were detected by Duncan analysis in SPSS 20.0, and are represented by letters;

[0020] Fig. 9 The growth phenotype analysis of the transformants of Pythium porphyriae of the present invention, the number of Pythium porphyriae and transformed sporocysts; - represents the transformants grown in the medium without G418. + represents the transformants grown in the medium with G418. The means and standard deviations are from 6 biological replicates, and the significant differences among the groups (P<0.05) were detected by Duncan analysis in SPSS 20.0, and are represented by letters;

[0021] Fig.10 The growth phenotype analysis of the transformants of Pythium porphyriae of the present invention, the zoospore yield of Pythium porphyriae and the transformants; - represents the transformants grown in the medium without G418. + represents the transformants grown in the medium with G418. The means and standard deviations are from 6 biological replicates, and the significant differences among the groups (P<0.05) were detected by Duncan analysis in SPSS 20.0, and are represented by letters;

[0022] Fig.11 This is the toxicity phenotype analysis of the Pythium porphyrae transformants of the present invention, the apparent symptoms of Pythium porphyrae and the transformants after infecting Pythium yezoensis for 10 days, the scale length is 2 cm; - represents the transformants grown in the medium without adding G418. + represents the transformants grown in the medium with G418 added;

[0023] Fig.12The toxicity phenotype analysis of the transformants of Pythium porphyrae of the present invention, the lesion rate of Pythium porphyrae and the transformants after infecting Pythium porphyrae for 10 days; - represents the transformants grown in the medium without G418. + represents the transformants grown in the medium with G418; the mean and standard deviation are for 3 biological replicates, and the significant differences among the groups were detected by Duncan analysis in SPSS 20.0 (P<0.05), and are represented by letters;

[0024] Fig.13 The virulence phenotype analysis of the transformants of Pythium porphyrae of the present invention, the relative biomass of the pathogen after Pythium porphyrae and the transformants infected Pythium yezoensis for 10 days; - represents the transformants grown in the medium without G418. + represents the transformants grown in the medium with G418; the mean and standard deviation are for 3 biological replicates, and the significant differences among the groups were detected by Duncan analysis in SPSS 20.0 (P<0.05), and are represented by letters. DETAILED DESCRIPTION

[0025] The following examples are used to more specifically describe the present invention. It should be understood that the implementation of the present invention is not limited to the following examples, and any modifications or changes made to the present invention fall within the scope of protection of the present invention; and the methods in the following examples, unless otherwise specified, are conventional methods in the art.

[0026] Embodiment 1: Oomycetes and algae culture Pythium porphyrae NBRC No. 33253 (purchased from NITE Biological Resource Center, Department of Biotechnology, National Institute of Technology and Evaluation, Japan) was used in this experiment. Pythium porphyrae was grown in Cornmeal Yeast Extract Seawater Agar (CMYSWA) medium at 24 °C in the dark.

[0027] Porphyra yezoensis inbred line RZ was obtained from Key laboratory of Marine Genetics and Breeding, Ocean University of China. The thallus was cultured in boiling seawater supplemented with PES (Provasoli, 1968) at 10 °C and a light intensity of 62.5 μmol photons / m 2 s, photoperiod L:D=12:12, and the culture medium was replaced every three days.

[0028] Determination of the sensitivity of Pythium porphyra to geneticin (G418) CMYSWA medium with different G418 concentrations (1, 3, 5, 10, and 20 μg / mL) was prepared, and a mycelial cake with a diameter of 3 mm was inoculated in the center of the plate. CMYSWA medium without antibiotics was used as a control. Six parallels were set for each concentration. After culturing at 24 ℃ in the dark for 4 days, the colony diameter was measured with a vernier caliper.

[0029] Protoplast preparation Use a cork punch to cut 30-40 agar blocks with a diameter of about 5 mm from the marginal hyphae of P. porphyriae grown in CMYSWA. Inoculate the agar blocks into 200 mL CMYSW and incubate them in the dark at 24 ℃. In order to clarify the effect of bacterial age on the number of protoplasts prepared, use 4 layers of sterile gauze to collect hyphae grown for 1, 4, 7, 10 and 13 days for enzymatic hydrolysis. Enzymatic hydrolysis of P. porphyriae was carried out according to the method for preparing oomycete protoplasts (Dou et al., 2008; Mcleod et al., 2008). Briefly, 20 mL of enzymatic solution [0.75% (w / v) Lysing Enzyme from Tichodema harzianum (Sigma, USA), 0.4% (w / v) Cellulase from Trichoderma reesei ATCC 26921 (Sigma, USA), 0.4 M mannitol, 20 mM KCl, 20 mM MES (pH 5.7), and 10 mM CaCl2] was prepared and lysed using a 0.22 μm Millipore Express ® The samples were sterilized by filtration using a PES Membrane Filter Unit (Merck Millipore Ltd. Tullagreen, Carrigtwohill, Co. Cork, Ireland). The collected mycelia of Pythium porphyriae were washed twice with 0.8 M mannitol and placed in the enzymatic solution and incubated in the dark at 24 °C with mild shaking (60 rpm). To clarify the effect of enzymatic hydrolysis time on the amount of protoplasts produced, the amount of protoplasts produced at 5, 10, 20, 30 and 40 min of treatment was counted using a hemocytometer. The experiment was repeated 3 times, with 3 parallels set each time.

[0030] Mycelial debris was removed with two layers of sterile Miracloth (EMD Millipore Corp., Billerica MA, USA), and the released protoplasts were collected by centrifugation at 1500 rpm for 3 min at 4 °C. The protoplasts were washed twice with W5 solution (5 mM KCl, 125 mM CaCl2, 154 mM NaCl, and 177 mM glucose). After incubation on ice for 30 min, the protoplasts were centrifuged at 1500 rpm for 4 min at 4 °C and resuspended to 10 μL in MMg solution (0.4 M mannitol, 15 mM MgCl2, and 4 mM MES, pH 5.7). 6 protoplasts / mL. After 10 min of ice bath, plasmid transformation was performed.

[0031] PEG-CaCl2-mediated transformation of protoplasts of Pythium porphyra The oomycete expression plasmid pTOR was used for PEG-CaCl2-mediated transformation of Pythium porphyrae protoplasts. The red fluorescent protein coding sequence was cloned into the pTOR vector to obtain the pTOR-RFP plasmid, and the rfp gene expression was regulated by the Ham34 promoter and terminator. 35μg of pTOR-RFP plasmid was mixed with plasmid protectant (60 μg Salmon sperm DNA, 1 μg / mL heparin, and 10 mM spermidine-HCl) and incubated on ice for 15 min. The plasmid without plasmid protectant was used as a control. The plasmid was mixed with 1 mL of protoplasts and incubated on ice for 10 min. 1.74 mL of PEG solution (40% PEG4000 m / v, 0.3 M mannitol, and 0.15 M CaCl2) was slowly added in 3 portions and incubated on ice for 20 min. Slowly add 20 mL of pre-cooled peabroth containing 0.5 M mannitol (PM), and incubate the protoplasts at 24 °C in the dark for 20-24 h to allow regeneration.

[0032] Transformant screening and verification The revived transformants were collected by centrifugation at 2000 rpm for 5 min at room temperature, and 30 mL of molten PM agar (40 ℃) containing an appropriate concentration of G418 was added. The culture medium containing the revived protoplasts was divided into 3 culture dishes and cultured at 24 ℃ in the dark for 4 days. Each plate was then covered with molten 10% V8 agar containing G418 and cultured at 24 ℃ in the dark for 4 days. The grown colonies were transferred to CMYSWA plates containing appropriate G418, and the grown hyphae were observed under a fluorescence microscope Olympus BX53 microscope (Olympus Corp., Tokyo, Japan) under 543 nm excitation light. The genomic DNA of the transformants emitting red fluorescence was extracted using the HP Fungal DNA Kit (Omega Bio-Tek, Inc., Norcross, Georgia, USA), and the total RNA was extracted using the Fungal RNA Kit (Omega Bio-Tek, Inc., Norcross, Georgia, USA) according to the instructions. The concentration and purity were determined using the NanoDrop-2000 spectrophotometer (Thermo Scientific, Wilmington, DE, USA). 1 μg of total RNA was used to synthesize cDNA using the Transcriptor First Strand cDNA Synthesis Kit (Roche Diagnostics GmbH, Mannheim, Germany) according to the instructions. The rfp gene was amplified using PrimerSTAR Max DNA Polymerase (Takara Bio, Inc., Kusatsu, Japan) using the transformant genomic DNA and cDNA as templates. The wild-type Pythium porphyrae genomic DNA was used as a control. The primers were F (5'-ATGGCCTCCTCCGAGGACGTCATC-3') and R (5'-TTAGTGATGGTGATGGTGATGGGCG-3'). The PCR product was sent to Qingdao Paisono Company for sequencing verification.

[0033] Orthogonal experiment In order to explore the effects of plasmid content, protoplast concentration and plasmid protectant concentration on the number of positive transformants, the Taguchi orthogonal array method was used in this experiment. Each factor was set to 4 levels as shown in Table 1. SPSS 20.0 was used to design L16 (4 4) The orthogonal table is shown in Table 2. Experiments were conducted on 16 combinations of different factors and levels given in the orthogonal table. Three parallels were set for each group of experiments.

[0034] Table 1 Factors and levels in orthogonal experiment Parameters Level 1 Level 2 Level 3 Level 4 A, Plasmid content (μg) 5 20 35 50 B, Protoplasts concentration ( / mL) <![CDATA[10 4 ]]> <![CDATA[10 5 ]]> <![CDATA[10 6 ]]> <![CDATA[10 7 ]]> C, Plasmid protective content (μg) 30 60 90 120 Table 2 Orthogonal array design related to the number of positive transformants of Pythium porphyrae Trial A B C Blank Positive transformation number 1 1 1 1 1 0±0 2 3 3 1 3 9±2 3 4 4 1 4 32.67±2.52 4 2 2 1 2 1.67±1.53 5 2 4 3 1 19±2.65 6 4 3 2 1 13.67±1.53 7 3 2 4 1 4±2 8 1 4 4 3 13.33±2.08 9 4 1 4 2 0±0 10 1 3 3 2 8.33±2.52 11 2 3 4 4 11.67±1.53 12 2 1 2 3 3±1 13 3 1 3 4 0.67±0.58 14 3 4 2 2 40.67±0.58 15 4 2 3 3 1.33±1.53 16 1 2 2 4 1±1 <![CDATA[T1]]> 22.67 3.67 43.33 36.67 <![CDATA[T2]]> 35.33 8.00 58.33 50.67 <![CDATA[T3]]> 54.33 42.67 29.33 26.67 <![CDATA[T4]]> 47.67 105.67 29.00 46.00 <![CDATA[R (Tmax-Tmin) ]]> 31.67 102 29.33 24 Priority level <![CDATA[A3]]> <![CDATA[B4]]> <![CDATA[C2]]> Blank is designated as a dummy factor, where no real factor can be assigned. The number of positive transformations is the average of the number of positive transformations in three separate experiments, i.e., mean ± SD. Ti represents the number of positive transformations for each column i factor level (i = 1, 2, 3, 4). R (range) represents the difference between the maximum and minimum values ​​of Ti.

[0035] Growth and virulence phenotype analysis of transformants To determine the effect of pTOR-RFP transformation on the growth of Pythium porphyrae, the transformants were subcultured three times on CMYSWA plates containing G418 and without antibiotics, and the edge hyphae with a diameter of 3 mm were inoculated in the center of a new CMYSWA plate and cultured at 24°C in the dark for 5 days. The colony diameter was recorded with a vernier caliper. Six parallels were set for each group. To determine the effect of transformation on the sporangium formation of Pythium porphyrae, 10 fields of view were randomly selected under a microscope at a 10x field of view when the hyphae grew to the edge of the plate to count the number of sporangia, and six parallels were set for each group. To determine the stability of rfp gene expression in the transformants, the hyphae that had been subcultured three times were observed under 543 nm excitation light using a fluorescence microscope. To determine the effect of transformation on zoospore production of Pythium porphyrae, Pythium porphyrae was inoculated into 50% seawater glucose-glutamate medium (SGG) (Fujita and Zenitani, 1977) and cultured in the dark at 24°C and 100 rpm for 7 d. Zoospore induction of Pythium porphyrae was performed according to the method of Addepalli et al. (Addepalliand Fujita, 2002). The number of zoospores was counted using a hemocytometer, with 6 parallels set up for each group.

[0036] In order to determine the effect of pTOR-RFP transformation on the virulence of Pythium spp., we conducted an artificial infection experiment with Pythium spp. Five RZ-pure Pythium yezoensis (length 11.76 ± 1.35 cm, width 1.00 ± 0.16 cm) were placed in a 250 mL conical flask containing 200 mL of sterile PES seawater, and zoospores were added to a final concentration of 10 5 CFU / mL. The conical flask was placed at 15°C and the light intensity was 62.5 μmol photons / m 2s, and the infection was allowed to proceed under the condition of photoperiod L:D=12:12. Three parallels were set for each group. After 10 days of infection, the lesion rate and relative biomass of the pathogen were calculated according to the method established in our laboratory (CN118562936A).

[0037] Data analysis The experimental data were expressed as mean ± standard deviation. The Duncan multiple test or Student's t-test in Excel was used to analyze the data significance. P ≤ 0.05 indicated that there was a significant difference between the data.

[0038] G418 concentration suitable for screening positive transformants of Pythium porphyra refer to Figure 1 and Figure 2 Pythium porphyrae was very sensitive to G418. When the content in the culture medium was 1 μg / mL, the mycelial growth rate decreased significantly. When the concentration of G418 was increased to 10 μg / mL, the mycelial growth was completely inhibited. Therefore, 10 μg / mL can be used as an appropriate G418 concentration for screening positive transformants of Pythium porphyrae.

[0039] Optimization of the bacterial age and enzymatic hydrolysis time in the preparation of protoplasts of Pythium porphyra refer to Figure 3 In order to obtain a sufficient number of protoplasts for plasmid transformation, we screened the age of P. porphyrae and the enzymatic hydrolysis time for protoplast preparation. The results showed that with the increase of enzymatic hydrolysis time, the number of protoplasts produced by P. porphyrae of different ages gradually increased, and the protoplast yield reached a peak around 30 min of enzymatic hydrolysis. Due to the slow growth rate of P. porphyrae, hyphae with low age (1-4 d) are not enough to produce a sufficient number of protoplasts. Generally speaking, a sufficient number of protoplasts can be obtained for transformation by selecting P. porphyrae with an age of about 10 d and enzymatic hydrolysis for 30 min.

[0040] Transformation of rfp gene with Pythium porphyria refer to Figure 4 The addition of plasmid protectant is the key to the successful transformation of Pythium porphyrae. Without the addition of protectant, no positive transformants are usually produced. The protoplast transformation of Pythium porphyrae was mediated by PEG / CaCl2 method. After screening with G418 selection medium, an average of 9 positive transformants were produced.

[0041] refer to Figure 6 Obvious red fluorescence was observed under 543 nm excitation light, and the fluorescence intensity of sporangium was significantly higher than that of hyphae.

[0042] refer to Figure 5PCR verification was performed using the genomic DNA and cDNA of the positive transformant with the strongest fluorescence intensity and the fastest growth as templates. A band of about 700 bp appeared, and the similarity with the rfp gene was 100% after sequencing. The above results show that the rfp gene was successfully transferred into Pythium porphyrae and expressed in vivo.

[0043] Optimization of PEG / CaCl2-mediated transformation of protoplasts from Pythium porphyra According to L16 (4 4 ) orthogonal table (Table 2), we conducted 16 groups of experiments to analyze the effects of plasmid content, protoplast concentration and plasmid protectant concentration on the number of positive transformants of Pythium porphyrae. Range and variance analysis found that protoplast concentration was the most important factor affecting the number of positive transformants of Pythium porphyrae. 7 The level of protoplasts / mL produced the most positive transformants, with a number of 105.67 (P<0.01) (Table 2-3). Appropriate plasmid content (35 μg) and protective agent concentration (60 μg) can increase the number of positive transformants, but there is no significant difference in the number of positive transformants between the levels (P>0.05) (Table 2-3). The range data showed (Table 2) that the order of factors affecting the number of positive transformants of Pythium porphyrae was protoplast concentration (R=102)>plasmid concentration (31.67)>protectant concentration (29.33), which was consistent with the results of variance analysis (Table 3). The above results show that the conditions suitable for the PEG / CaCl2 method to mediate the transformation of Pythium porphyrae protoplasts are: protoplast concentration 10 7 protoplasts / mL, plasmid content 35 μg, plasmid protectant 60 μg.

[0044] Table 3 Analysis of variance of the number of positive transformants Source Type III sum of squares Degrees of freedom Mean square F values P values Corrected Model <![CDATA[1983.063 a ]]> 9 220.340 6.181 .019 Intercept 1620.063 1 1620.063 45.449 .001 Plasmid content 157.188 3 52.396 1.470 .314 Protoplasts concentration 1671.188 3 557.063 15.628 .003 Plasmid protectant content 154.688 3 51.563 1.447 .320 Error 213.875 6 35.646 Total 3817.000 16 Corrected Total 2196.938 15 a R squared = .903 (Adjusted R squared = .757).

[0045] Growth and virulence analysis of transformants In order to determine the effect of pTOR-RFP transformation on the growth of P. porphyrae, the transformants were subcultured three times in medium containing G418 selection and medium without antibiotics, and then inoculated on CMYSWA plates and cultured at 24 ℃ in the dark for 5 days. The results showed that the growth rate of the transformants subcultured under G418 selection pressure was significantly lower than that of the wild-type P. porphyrae and the transformants subcultured on the plate without antibiotics ( Figure 7 and Figure 8). There was no significant difference in the number of sporangia and zoospore production between the transformants and the wild type of Pythium porphyria under the microscope ( Fig. 9 and Fig.10 ). Observation under 543 nm excitation light revealed that only transformants grown under G418 selection pressure emitted red fluorescence ( Figure 7 ).

[0046] In order to determine the effect of pTOR-RFP transformation on the pathogenicity of Pythium porphyrae, infection experiments were performed using Pythium porphyrae transformants grown under G418 selection pressure, Pythium porphyrae non-antibiotic selection pressure, and wild-type Pythium porphyrae. The results showed that there was no significant difference in the lesion rate of Pythium yezoensis and the relative biomass of Pythium porphyrae among the infection groups, indicating that the virulence of the Pythium porphyrae transformants was not affected ( Figure 11-13 ).

[0047] So far, the technical solutions of the present invention have been described in conjunction with the preferred embodiments shown in the accompanying drawings. However, it is easy for those skilled in the art to understand that the protection scope of the present invention is obviously not limited to these specific embodiments. Without departing from the principle of the present invention, those skilled in the art can make equivalent changes or substitutions to the relevant technical features, and the technical solutions after these changes or substitutions will fall within the protection scope of the present invention.

[0048] Serial Number(ID): 1 Length: 24 Molecule Type: DNA Feature Position / Qualifier: - source, 1..24 > mol_type, other DNA > organism, artificial sequence Residue: atggcctcct ccgaggacgt catc 24 Serial Number(ID): 2 Length: 25 Molecule Type: DNA Feature Position / Qualifier: - source, 1..25 > mol_type, other DNA > organism, artificial sequence Residue: ttagtgatgg tgatggtgat gggcg 25.

Claims

1. A method for genetic transformation of Pythium porphyrae, characterized in that the steps include: Antibiotic concentration screening, protoplast preparation, transformation system optimization, positive transformant screening, transformant phenotype and gene expression stability analysis.

2. A method for genetic transformation of Pythium porphyrae according to claim 1, characterized in that: Here are the steps: a. Antibiotic concentration screening: Prepare Geneticin G418 plates with different concentrations, inoculate Pythium porphyra cakes, and select the lowest antibiotic concentration at which mycelium does not grow; b. Protoplast preparation: Use a composite enzyme preparation to hydrolyze the mycelium of Pythium porphyrae, and screen the mycelium age and enzymatic hydrolysis time for the preparation of high-quality protoplasts; c. The pTOR-RFP plasmid was transformed into the protoplasts of Pythium porphyrae using the PEG / CaCal2 method; d. Determine positive transformants by antibiotic screening combined with PCR; e. Determine the optimal protoplast concentration, plasmid concentration and protective agent concentration for transformation through orthogonal experiments; f. Observe the growth phenotype of the transformants using an optical microscope, observe the gene expression stability of the transformants using a fluorescence microscope, and analyze the pathogenicity phenotype of the transformants through infection experiments.

3. A method for genetic transformation of Pythium porphyrae as claimed in claim 2, characterized in that: The lowest antibiotic concentration at which mycelium did not grow was 10 μg / mL.

4. A method for genetic transformation of Pythium porphyrae as claimed in claim 2, characterized in that: The mycelium age of the high-quality protoplasts is 10 days, and the enzymatic hydrolysis time is 30 minutes.

5. A method for genetic transformation of Pythium porphyrae as claimed in claim 2, characterized in that: The conditions suitable for PEG / CaCl2-mediated transformation of Pythium porphyra protoplasts are: protoplast concentration 10 7 protoplasts / mL, plasmid content 35 μg, plasmid protectant 60 μg.

6. A method for genetic transformation of Pythium porphyrae as claimed in claim 2, characterized in that: The G418 plate is an agar plate to which G418 antibiotics are added.

7. A method for genetic transformation of Pythium porphyrae according to claim 6, characterized in that: The G418 antibiotic, also known as Geneticin, is an aminoglycoside antibiotic.

8. The method for genetic transformation of Pythium porphyrae according to claim 6, characterized in that: The agar plate is one of a V8 agar plate, a corn agar plate or a PM agar plate.

9. A method for genetic transformation of Pythium porphyrae as claimed in claim 2, characterized in that: The primer sequence of PCR in step d is: F:ATGGCCTCCTCCGAGGACGTCATC; R: TTAGTGATGGTGATGGTGATGGGCG.

Images