Wheat multi-stress resistance gene and application thereof

Abstract

The invention belongs to the field of plant breeding, and particularly relates to a wheat multi-stress resistance gene and application thereof. According to the invention, a wheat multi-stress resistance gene is obtained through big data analysis. The multi-stress resistance of wheat can be improved by controlling the gene.

Description

Technical Field

[0001] The invention belongs to the field of plant breeding, and in particular relates to a wheat multiple stress resistance gene and application thereof. Background Art

[0002] Drought, salinity, high temperature and other stresses are the main environmental factors that affect plant growth and development, which seriously affect the yield of crops. Cultivating excellent stress-tolerant crops is an effective way to solve this problem. Wheat is the staple food crop in my country and the second largest food crop in the world. Improving wheat's tolerance to abiotic stress is important for increasing wheat yields in my country and the world.

[0003] Many genes in wheat are related to stress tolerance, such as TaLEA (Yu Jianing. Cloning, analysis and functional study of genes related to drought and salt tolerance in wheat [D]. Northwest Agriculture and Forestry University, 2003), TaWHY2-6A (CN118910132A), TaERF16-B (CN118834991A), TaSnRK1 (CN118812685A), etc. More genes related to stress tolerance need to be identified to achieve the goal of improving wheat stress tolerance. Summary of the invention

[0004] The purpose of the present invention is to provide a method for improving the stress tolerance of wheat.

[0005] To achieve the above object, the present invention adopts the following technical solutions:

[0006] The present invention provides an application of a gene in regulating wheat multi-adversity resistance, characterized in that the gene includes any one of the following:

[0007] (1) A gene with a sequence shown in SEQ ID NO.1 or SEQ ID NO.2;

[0008] (2) a gene encoding the sequence shown in SEQ ID NO.3;

[0009] (3) the gene numbered TraesCS1B02G022400 in the wheat gene database;

[0010] The multiple adversities include any one of salt, alkali, drought, and high temperature or a combination thereof.

[0011] The present invention also provides an application of a biological material in regulating wheat multi-adversity resistance, characterized in that the biological material comprises any one of the following:

[0012] (1) an expression cassette containing the above gene;

[0013] (2) an expression vector containing the above gene;

[0014] (3) A host cell containing the above gene, wherein the host cell is a bacterial cell or a non-renewable plant cell.

[0015] The present invention also provides a method for improving wheat resistance to multiple adversities, characterized in that the method comprises the following steps:

[0016] (1) increasing the expression of the above gene in the wheat material to be improved;

[0017] (2) Select wheat plants with improved resistance to multiple stresses.

[0018] The multiple adversities include any one of salt, alkali, drought, and high temperature or a combination thereof.

[0019] In some embodiments, the method for increasing gene expression is to use a high-activity promoter to drive the expression of the gene of claim 1.

[0020] In some embodiments, the above-mentioned high-activity promoter is SEQ ID NO.4.

[0021] The present invention also provides application of the above method in improving the resistance of wheat to multiple adversities.

[0022] The advantages and beneficial effects of the present invention are as follows: The present invention obtains a gene for wheat multi-adversity resistance through transcriptome analysis. Manipulation of the gene can improve wheat multi-adversity resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 The expression level of TraesCS1B02G022400 gene in #7AABB and SHW3_AABBDD. The expression level is expressed in TPM (transcripts per million).

[0024] Figure 2 Figure 1. Overexpression vector diagram. Components are labeled on the diagram.

[0025] Figure 3 Results of positive DNA level detection and transcription level expression detection of transgenic plants. A: Positive detection results of 4 positive transformation strains (OE-1 to OE-4). B: Expression level detection of two of the strains, ZR27-369 and ZR27-397.

[0026] Figure 4Phenotypes of overexpression plants and receptor controls after saline-alkali stress treatment. A: Phenotype photos, taken 12 days after saline-alkali stress treatment. The 3 plants on the left of each photo are overexpression materials, and the 3 plants on the right are receptor control materials. B: Statistical data on the percentage of yellow leaves of each material after 12 days of treatment. "**" indicates a very significant difference. ZR27-OX-369 and ZR27-OX-397 are overexpression materials ZR27-369 and ZR27-397.

[0027] Figure 5 Phenotypes of overexpression plants and receptor controls after drought and heat stress treatment. A: Phenotype photos, taken 12 days after drought and heat stress treatment and 7 days after rehydration. The 3 plants on the left of the photo are the receptor control material Fielder, the 3 plants in the middle are the overexpression material ZR27-369, and the 3 plants on the right are the overexpression material ZR27-397. ZR27-OX-369 and ZR27-OX-397 are the overexpression materials ZR27-369 and ZR27-397. B: Statistical data on the degree of leaf curling of each material after 7 days of rehydration. "**" indicates a very significant difference. DETAILED DESCRIPTION

[0028] The following definitions and methods are provided to better define this application and guide those of ordinary skill in the art in the practice of this application. Unless otherwise specified, terms are understood according to the conventional usage of those of ordinary skill in the relevant field. All patent documents, academic papers, industry standards and other public publications cited herein are incorporated herein by reference in their entirety.

[0029] In the present application, the words “comprise”, “include” or variations thereof should be understood as including other elements, numbers or steps in addition to the described elements, numbers or steps.

[0030] Unless otherwise indicated, nucleic acids are written from left to right in the 5' to 3' direction; amino acid sequences are written from left to right in the amino to carboxyl direction. Amino acids may be represented herein by their commonly known three-letter symbols or by the single-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Committee. Similarly, nucleotides may be represented by commonly accepted single-letter codes. Numerical ranges include numbers that define the range. As used herein, "nucleic acid" includes deoxyribonucleotides or ribonucleotide polymers in single-stranded or double-stranded form, and unless otherwise limited, includes known analogs (e.g., peptide nucleic acids) having the basic properties of natural nucleotides, which hybridize with single-stranded nucleic acids in a manner similar to naturally occurring nucleotides. As used herein, the term "encoding" or "encoded" when used in the context of a specific nucleic acid refers to the nucleic acid containing the necessary information to direct the translation of the nucleotide sequence into a specific protein. Codons are used to represent information encoding proteins. As used herein, the "full-length sequence" of a specific polynucleotide or its encoded protein refers to the entire nucleic acid sequence or the entire amino acid sequence having a natural (non-synthetic) endogenous sequence. The full-length polynucleotide encodes the full-length, catalytically active form of the particular protein. The terms "polypeptide," "polypeptide," and "protein" are used interchangeably herein to refer to polymers of amino acid residues. The term is used for amino acid polymers in which one or more amino acid residues are artificial chemical analogs of the corresponding naturally occurring amino acids. The term is also used for naturally occurring amino acid polymers. The terms "residue" or "amino acid residue" or "amino acid" are used interchangeably herein to refer to an amino acid that is incorporated into a protein, polypeptide, or peptide (collectively, "protein"). Amino acids can be naturally occurring amino acids, and unless otherwise limited, known analogs of natural amino acids can be included that can function in a manner similar to naturally occurring amino acids.

[0031] In some embodiments, the nucleotide sequence of the present application can be changed to perform conservative amino acid substitutions. The principles and examples of conservative amino acid substitutions are further described below. In certain embodiments, the nucleotide sequence of the present application can be replaced without changing the amino acid sequence according to the disclosed monocot codon preference, for example, the codons encoding the same amino acid sequence can be replaced with codons preferred by monocot plants without changing the amino acid sequence encoded by the nucleotide sequence. In some embodiments, a portion of the nucleotide sequence in the present application is replaced with different codons encoding the same amino acid sequence, thereby not changing the amino acid sequence encoded by the nucleotide sequence while changing the nucleotide sequence. Conservative variants include those sequences that encode an amino acid sequence of one of the proteins of the embodiment due to genetic codon degeneracy. In some embodiments, a portion of the nucleotide sequence in the present application is replaced according to monocot plant preference codons. Those skilled in the art will recognize that amino acid additions and / or substitutions are generally based on the relative similarity of amino acid side chain substituents, for example, the hydrophobicity, charge, size, etc. of the substituent. Exemplary amino acid substitution groups with various aforementioned properties considered are well known to those skilled in the art and include arginine and lysine; glutamic acid and aspartic acid; serine and threonine; glutamine and asparagine; and valine, leucine and isoleucine. Guidance on appropriate amino acid substitutions that do not affect the biological activity of the target protein can be found in the model of Dayhoff et al. (1978) Atlas of Protein Sequence and Structure (Natl. Biomed. Res. Found., Washington, DC) (incorporated herein by reference). Conservative substitutions such as replacing one amino acid with another amino acid having similar properties can be performed. Identification of sequence identity includes hybridization techniques. For example, all or part of a known nucleotide sequence is used as a probe for selective hybridization with other corresponding nucleotide sequences, and the other corresponding nucleotide sequences are present in a cloned genomic DNA fragment or cDNA fragment group (i.e., a genomic library or a cDNA library) from a selected organism. The hybridization probe can be a genomic DNA fragment, a cDNA fragment, an RNA fragment or other oligonucleotide, and can be marked with a detectable group such as 32P or other detectable markers. Thus, for example, a hybridization probe can be prepared by marking a synthetic oligonucleotide based on the embodiment sequence. The method for preparing hybridization probes and constructing cDNA and genomic libraries is generally known in the art. The hybridization of the sequence can be carried out under stringent conditions. As used herein, the term "stringent conditions" or "stringent hybridization conditions" means the following conditions, i.e., under these conditions, relative to hybridization with other sequences, the probe will hybridize with its target sequence to a greater extent (e.g., at least 2 times, 5 times or 10 times of background) that can be detected.Stringent conditions are sequence-dependent and vary in different environments. By controlling the stringency of hybridization and / or controlling the washing conditions, a target sequence that is 100% complementary to the probe can be identified (homologous probe method). Alternatively, stringent conditions can be adjusted to allow some sequence mismatches to detect lower similarities (heterologous probe method). Typically, the probe length is less than about 1000 or 500 nucleotides. Typically, stringent conditions are conditions in which the salt concentration is less than about 1.5M Na ions, typically about 0.01M to 1.0M Na ion concentration (or other salts) at pH 7.0 to 8.3, and the temperature conditions are: when used for short probes (e.g., 10 to 50 nucleotides), at least about 30°C; when used for long probes (e.g., greater than 50 nucleotides), at least about 60°C. Stringent conditions can also be achieved by adding destabilizing agents such as formamide. Exemplary low stringency conditions include hybridization using 30% to 35% formamide buffer, 1M NaCl, 1% SDS (sodium dodecyl sulfate) at 37°C, and washing in 1× to 2× SSC (20×SSC=3.0MNaCl / 0.3M trisodium citrate) at 50°C to 55°C. Exemplary moderate stringency conditions include hybridization in 40% to 45% formamide, 1.0M NaCl, 1% SDS at 37°C, and washing in 0.5× to 1× SSC at 55°C to 60°C. Exemplary high stringency conditions include hybridization in 50% formamide, 1M NaCl, 1% SDS at 37°C, and a final wash in 0.1× SSC at 60°C to 65°C for at least about 20 minutes. Optionally, the wash buffer may contain about 0.1% to about 1% SDS. The duration of hybridization is typically less than about 24 hours, typically about 4 hours to about 12 hours. Specificity is usually dependent on post-hybridization washes, with the key factors being the ionic strength and temperature of the final wash solution. The Tm (thermodynamic melting point) of a DNA-DNA hybrid can be approximated by the formula of Meinkoth and Wahl (1984) Anal. Biochem. 138: 267-284: Tm = 81.5°C + 16.6 (log M) + 0.41 (% GC) - 0.61 (% formamide) - 500 / L; where M is the molar concentration of monovalent cations, % GC is the percentage of guanosine and cytosine nucleotides in the DNA, "% formamide" is the percentage of formamide in the hybridization solution, and L is the base pair length of the hybrid. The Tm is the temperature (under defined ionic strength and pH) at which 50% of the complementary target sequence hybridizes to a perfectly matched probe. Washing is usually performed at least until equilibrium is reached and a low level of hybridization background is achieved, such as for 2 hours, 1 hour, or 30 minutes. Each 1% mismatch should reduce the Tm by about 1°C; thus, the Tm, hybridization, and / or washing conditions can be adjusted to hybridize to sequences of the desired identity. For example, if sequences with ≥90% identity are desired, the Tm can be reduced by 10°C.Typically, stringent conditions are selected to be about 5°C lower than the Tm of the specific sequence and its complementary sequence at a defined ionic strength and pH. However, under very stringent conditions, hybridization and / or washing can be performed at 4°C lower than the Tm; under moderately stringent conditions, hybridization and / or washing can be performed at 6°C lower than the Tm; and under low stringency conditions, hybridization and / or washing can be performed at 11°C lower than the Tm.

[0032] Unless otherwise indicated, all numbers used in the specification and claims expressing amounts of ingredients, reaction conditions, and the like are to be understood as modified in all instances by the term "about". As used herein, the term "about", when referring to a measurable value such as an amount of mass, weight, time, volume, concentration, or percentage, is meant to encompass variations of ±20% from the specified amount in some embodiments, ±10% from the specified amount in some embodiments, ±5% from the specified amount in some embodiments, ±1% from the specified amount in some embodiments, ±0.5% from the specified amount in some embodiments, and ±0.1% from the specified amount in some embodiments, as such variations are suitable for performing the disclosed methods and / or using the disclosed compositions, nucleic acids, polypeptides, and the like. Therefore, unless indicated to the contrary, the numerical parameters listed in the specification and the appended claims are approximate values ​​that may vary depending on the desired properties sought to be obtained by the subject matter disclosed in the present application.

[0033] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. Without departing from the spirit and substance of the present invention, the modification or replacement of the inventive method, step or condition, all belong to the scope of the present application. If not otherwise specified, the embodiments are according to conventional experimental conditions, such as Sambrook et al.'s Molecular Cloning Laboratory Manual (Sambrook J & Russell DW, Molecular cloning: alaboratory manual, 2001), or according to the conditions of the manufacturer's instructions. If not otherwise specified, the chemical reagents used in the embodiments are conventional commercial reagents, and the technical means used in the embodiments are conventional means well known to those skilled in the art.

[0034] Example

[0035] Example 1 Discovery of wheat stress tolerance genes

[0036] Common wheat is an important food crop. It is a typical allohexaploid species with A, B and D genomes. The formation of common wheat has undergone two allopolyploidization processes: the first polyploidization occurred about 500,000 years ago, when two diploids of Triticum urartu (AA) and Aegilops speltoides (SS) formed an early tetraploid (AABB); the second polyploidization occurred about 8,000 years ago, which was formed by natural hybridization of a domesticated tetraploid (T. turgidum, AABB) as the female parent and wild Aegilops tauschii (DD) as the male parent, and became the common wheat of today through natural selection and artificial domestication. Wheat is an important genetic model for studying polyploid evolution and crop domestication. However, the extent and impact of this change in the evolution of wheat, especially in the evolution from tetraploid to hexaploid wheat, are still unclear. The addition of the D genome has greatly improved the adaptability and quality of wheat.

[0037] In order to study the effect of the addition of the D genome on the whole genome of wheat during the evolution from tetraploid to hexaploid wheat, the inventors first obtained tetraploid wheat #7AABB and diploid wheat #10DD, and hybridized the above two materials, and screened out the stable hexaploid synthetic wheat plant SHW3 (AABBDD) in the F2 generation. These three materials were grown to the seedling stage (three-leaf stage) under normal light conditions, and RNA was extracted from the leaves for transcriptome analysis, and the gene expression levels between hexaploid SHW3 (AABBDD) and tetraploid wheat #7AABB were compared. The results showed that compared with tetraploid wheat #7AABB, a total of 2673 up-regulated genes and 2076 down-regulated genes were identified in hexaploid SHW3 (AABBDD), and 504 genes had an expression level increase of more than 8 times and changed from non-expression to expression. Since hexaploid wheat has a wider environmental adaptability than tetraploid wheat, three genes with higher activated expression levels (expression levels increased by more than 8 times) were screened out after the D genome was added to tetraploid wheat #7AABB, namely TraesCS1B02G022400, TraesCS2D02G069100, and TraesCS3B02G056100.

[0038] Among them, the expression level of gene TraesCS1B02G022400 in hexaploid synthetic wheat SHW3 (AABBDD) increased by more than 9 times ( Figure 1 ), it is speculated that it may play a role in the process of hexaploid wheat adapting to environmental signals. The genomic sequence of this gene is shown in SEQ ID NO.1, and the encoded protein sequence is shown in SEQ ID NO.3.

[0039] Example 2 Gene Function Verification

[0040] In order to further identify the specific function of the gene, the inventors cloned the gene coding region (CDS) of the TraesCS1B02G022400 gene, and the sequence is shown in SEQ ID NO.2. After the empty vector was digested with BamHI, the CDS was constructed into the overexpression vector by homologous recombination, and the plasmid was transformed into Agrobacterium EHA105. Using the Agrobacterium-mediated young embryo wheat genetic transformation system, the gene was successfully transformed into the wheat variety Fielder. The promoter and terminator used in the overexpression vector are the commonly used maize ubiquitin promoter (SEQ ID NO.4) and nos terminator (SEQ ID NO.5) in the art (see the vector map) Figure 2 Finally, transformants were obtained, and 4 positive transformants were screened out by positive detection in the T1 generation ( Figure 3 A). RNA was extracted from leaves of two strains, ZR27-369 and ZR27-397. After reverse transcription to obtain cDNA, the expression of the TraesCS1B02G022400 gene was detected using the qRT-PCR method. It was found that the expression of the gene in the two strains ZR27-369 and ZR27-397 was significantly higher than that in the receptor control ( Figure 3 B). Among them, the specific primers for qRT-PCR detection of TraesCS1B02G022400 gene expression are: WRGP-5943, AGAATTGCTGCCCAGTCTC; WRGP-5944, AGAGCTTGTCTGACGTTGGG. The internal reference primers are: TaActin-F, CAGCAATGTATGTCGCAATC; TaActin-R, TAGCATGAGGAAGCGTGTAT.

[0041] After obtaining the overexpression material, the stress resistance of the two strains ZR27-369 and ZR27-397 was further identified. ZR27-369, ZR27-397 and the receptor control Fielder were treated with salt-alkali stress and drought-heat stress.

[0042] Salt-alkali stress treatment method: small square pots with a size of 8cm×8cm were used for soil loading. Each square pot was loaded with 100g of soil (including the weight of the pot). After ensuring that the soil fully absorbed water, sowing was carried out. Five experimental materials were sown in each square pot, and three replicates were set for each material, totaling 15 experimental materials. When wheat grew to the "two leaves and one core" stage (about 12-13 days, the growth conditions were 20-23℃, and the day and night were 12h / 12h). A 400mmol / L saline-alkali aqueous solution (the ratio of NaCl: NaHCO3: Na2CO3 was 11:4.5:0.5, and the final pH value was 9) was slowly poured on the roots of the plants. On the first day, 150mL of saline-alkali water was poured and the excess water was poured out. On the fourth day, 50mL of saline-alkali water was poured again. After 12 days of treatment, the number of yellow leaves and green leaves of each strain was counted, the proportion of yellow leaves was calculated, and photos were taken to evaluate the effect of saline-alkali stress on wheat growth.

[0043] The drought and heat stress treatment method is: use a small square pot with a size of 8cm×8cm to load the soil, and each square pot is loaded with 100g of soil (including the weight of the pot). After ensuring that the soil fully absorbs water, sowing is carried out. Five experimental materials are sown in each square pot, and three replicates are set for each material, totaling 15 experimental materials. The day before wheat grows to the "two leaves and one core" stage (about 12-13 days, growth conditions are 20-23℃, day and night 12h / 12h), watering treatment is carried out to ensure that the weight of each small pot is basically the same. After multiple precise measurements, the total weight of the small pot before treatment should be controlled within the range of 250g±4g. Subsequently, the water in the white plate is poured out and the treatment begins. The ambient temperature is adjusted to a high temperature range of 33-36℃, and no watering is continued, while simulating the drought and high temperature stress environment. After 12 days of treatment, a 7-day rehydration treatment is carried out for photographing and recording, and the degree of leaf curling of each material is counted.

[0044] After 12 days of saline-alkali stress treatment, the number of yellow leaves and green leaves of the transgenic plants was counted, and the ratio of yellow leaves was calculated to measure the resistance of the wheat material to saline-alkali stress. The results showed that the ratio of yellow leaves to green leaves in the overexpression plants was significantly lower than that in the control material Fielder (see Figure 4 ), indicating that overexpression of the TraesCS1B02G022400 gene can significantly improve wheat's salt-alkali tolerance. After 12 days of drought and heat stress and 7 days of rewatering, the curling rate of the leaves of the overexpression material was significantly lower than that of the control material Fielder (see Figure 5 ), indicating that overexpression of TraesCS1B02G022400 gene can significantly improve wheat drought and heat tolerance.

[0045] The functions of the two genes, TraesCS3B02G056100 and TraesCS2D02G069100, were identified in the same way. It was found that the resistance of TraesCS3B02G056100 to multiple adversities was comparable to that of TraesCS1B02G022400, while the resistance of TraesCS2D02G069100 to multiple adversities was weaker.

[0046] The above results show that after overexpressing the TraesCS1B02G022400 gene, the resistance of wheat to salt, alkali, drought, and heat (high temperature) adversity is significantly improved. Therefore, by increasing the expression amount of the TraesCS1B02G022400 gene, the technical effect of improving the resistance of wheat to salt, alkali, drought, and heat can be achieved. Although the present invention has been described in detail with general instructions and specific embodiments above, it is obvious to those skilled in the art that some modifications or improvements can be made to it on the basis of the present invention. Therefore, these modifications or improvements made on the basis of not departing from the spirit of the present invention all belong to the scope of protection claimed in the present invention.

Claims

1. Application of a gene in regulating wheat multi-adversity resistance, characterized in that: The gene includes any one of the following: (1) A gene with a sequence shown in SEQ ID NO.1 or SEQ ID NO.2; (2) a gene encoding the sequence shown in SEQ ID NO.3; (3) the gene numbered TraesCS1B02G022400 in the wheat gene database; The multiple adversities include any one of salt, alkali, drought, and high temperature or a combination thereof.

2. Application of a biological material in regulating wheat multi-adversity resistance, characterized in that: The biological material includes any one of the following: (1) An expression cassette containing the gene according to claim 1; (2) an expression vector containing the gene according to claim 1; (3) A host cell containing the gene according to claim 1, wherein the host cell is a bacterial cell or a non-renewable plant cell.

3. A method for improving wheat resistance to multiple adversities, characterized in that: The method comprises the following steps: (1) increasing the expression of the gene described in claim 1 in the wheat material to be improved; (2) selecting wheat plants with improved resistance to multiple stresses; The multiple adversities include any one of salt, alkali, drought, and high temperature or a combination thereof.

4. The method according to claim 3, characterized in that The method for increasing gene expression is to use a high-activity promoter to drive the expression of the gene described in claim 1.

5. The method according to claim 4, characterized in that The high-activity promoter is shown in SEQ ID NO.

4.

6. Use of the method according to any one of claims 3 to 5 in improving the resistance of wheat to multiple stresses.

Images