Genome editing system and editing method of sweet clover based on hairy root genetic transformation system

Abstract

The invention relates to a genome editing system and method for melilotus albiflora based on a hairy root genetic transformation system, and belongs to the technical field of plant genetic engineering. According to the invention, an editing carrier system of the MaPDS gene is constructed according to two target sites on the MaPDS gene of the sweet clover, and the editing system is CRISPR2.0-MtLAP1-KO-MaPDS; according to the editing system, sweet clover hypocotyl is used as an explant material, hairy roots are obtained through an agrobacterium rhizogenes-mediated hypocotyl explant infection method, and meanwhile, the hairy roots are obtained on the basis of the principle that anthocyanin is over-expressed and accumulated based on an MtLAP1 transcription factor for color development. Positive hairy roots are obtained through visual, rapid and efficient screening, and efficient editing of the MaPDS gene of the red positive hairy roots is achieved. The method provided by the invention can effectively reduce the occurrence of solid roots in the inducing process of the sweet clover hairy roots, prevent agrobacterium pollution, reduce the detection workload and realize efficient gene editing of target genes.

Description

Technical Field

[0001] The present invention belongs to the field of plant tissue culture technology and plant transgenic technology, and particularly relates to a genome editing system and editing method of Melilotus officinalis based on a hairy root genetic transformation system. Background Art

[0002] Melilotus albus Desr. is an annual or biennial diploid herb of the genus Melilotus in the Leguminosae family. It is drought-tolerant, salt-tolerant, and has strong nitrogen-fixing capabilities, making it very suitable for crop rotation. It is also one of the important forage crops for improving and utilizing saline-alkali land. Currently, the main method for breeding new varieties of Melilotus is traditional cyclic breeding, but this method has a long cycle, is time-consuming and labor-intensive, and has great difficulty in improving a single trait. Therefore, there is an urgent need to develop advanced biotechnologies such as genome editing (CRISPR / Cas9) and gene aggregation to shorten the breeding cycle of new varieties of Melilotus albus. However, there are currently no relevant patent reports on related technologies such as genome editing of Melilotus albus.

[0003] Genetic transformation technology is an important tool for studying gene function in plants and cultivating new crop varieties. Using Agrobacterium tumefaciens as a medium, the transformation method of transferring target genes into plants via the T-DNA of the Ti plasmid has the advantages of simplicity, high efficiency, and strong reproducibility, making it widely used in plant genetic transformation. Furthermore, Agrobacterium rhizogenes can stably integrate the root-inducing gene locus rol into the host plant genome via the T-DNA of the Ri plasmid, producing hairy roots. Due to its short transformation cycle, the hairy root production method using Agrobacterium rhizogenes is often used to rapidly verify gene function in plant metabolic pathways and to screen gene editing components (promoters, CRISPR / Cas genes, sgRNAs) in genome editing systems. However, the efficiency and positive rate of hairy root induction vary significantly among forage crops, influenced by factors such as the state of the explant and the type of Agrobacterium rhizogenes. For example, using mature leaves as explants for hairy root induction often results in low induction efficiency (<15%) and a long cycle (>60 days). Using the rhizome junction as an explant for hairy root induction can easily lead to confusion between seedlings and hairy roots, Agrobacterium contamination, and other issues, resulting in false positives and increasing the detection workload. Currently, hairy root induction systems for Melilotus alba are generally plagued by low induction efficiency, long induction times, and severe Agrobacterium contamination. Furthermore, there is a lack of efficient and mature editing systems and methods for Melilotus alba. Summary of the Invention

[0004] The present invention aims to provide a genome editing system and editing method for Melilotus alba based on a hairy root genetic transformation system. The gene editing system constructed using two target sites of the MaPDS gene can efficiently edit the MaPDS gene in the hairy roots of Melilotus alba. Agrobacterium rhizogenes carrying the editing vector is used to infect the hypocotyls of Melilotus alba, and Melilotus alba explants can be efficiently and rapidly induced to produce hairy roots, and visual screening of positive hairy roots can be achieved. The method can effectively prevent the occurrence of seedling roots, reduce the workload of hairy root detection, and thus achieve higher gene editing efficiency.

[0005] In order to achieve the above-mentioned purpose, the present invention adopts the following technical solutions:

[0006] The invention relates to an application of two target sites of Melilotus officinalis, wherein the application is to construct an editing system of the Melilotus officinalis MaPDS gene by using the two target sites, wherein the two target sites are 5'-AAGGTTGTTATTGCTGGTGC-3' (SEQ ID NO. 3) and 5'-TGGTCACAAGCCTATATTGC-3' (SEQ ID NO. 4).

[0007] A genome editing system for sweet sweet clover, the editing system being CRISPR_2.0-MtLAP1-KO-MaPDS, wherein MtLAP1 is the LAP1 gene of Medicago truncatula, KO-MaPDS indicates that the editing system targets the MaPDS gene of sweet sweet clover, and the nucleotide sequence of the editing system is shown in SEQ ID NO.1.

[0008] Since the editing system carries the MtLAP1 gene, overexpression of the gene will cause anthocyanin accumulation in hairy roots, resulting in color development and visibility to the naked eye. Therefore, positive hairy roots can be visually screened, reducing the workload of hairy root detection.

[0009] The present invention also provides a method for efficiently editing the MaPDS gene in the hairy roots of sweet clover using the editing system, the method comprising the following steps:

[0010] Step 1: Take the hypocotyls of 3-5 day old sterile seedlings of Melilotus officinalis and use a sterile needle to create wounds on the hypocotyls to serve as explants for inducing hairy roots of Melilotus officinalis.

[0011] Step 2: Thaw Agrobacterium rhizogenes LBA9402 competent cells on ice, add CRISPR_2.0-MtLAP1-KO-MaPDS plasmid DNA, let stand on ice for 30 minutes, and freeze in liquid nitrogen for 2-3 minutes. Incubate in a 37°C water bath for 3 minutes, add antibiotic-free LB medium, and incubate at 28°C at 200 rpm for 2 hours. Spread the culture onto solid LB medium containing kanamycin and rifampicin and incubate inverted at 28°C. After single colonies grow, identify them by PCR and save the positive colonies.

[0012] Step 3: Inoculate the bacterial suspension of the positive strain obtained in step 2 into the liquid LB basal medium containing kanamycin and rifampicin resistance, and culture at 28°C ~ 200rpm; when the bacterial suspension concentration OD 600 When the value reaches 0.6-0.8, centrifuge to enrich the bacteria; resuspend the bacteria in sterile SH liquid medium to OD 600 The value is about 0.3-0.4, which is used as the infection solution for inducing hairy roots of sweet clover;

[0013] The SH liquid medium is SH basic medium + a final concentration of 15g·L -1 Sucrose + 100 μmol·L -1 acetosyringone, pH 5.95;

[0014] Step 4: Place the hypocotyl explants prepared in the first step into the infection solution for inducing hairy roots of Melilotus officinalis, vacuum for 5 minutes, incubate with shaking for 30 minutes, and then place them on sterile filter paper to dry; after co-cultivation on the co-cultivation medium for 2 days, transfer them to the hairy root induction medium to induce hairy root formation; replace the induction medium every 15 days.

[0015] The co-cultivation medium is SH basic medium + 30g·L -1 Sucrose +7.8g·L -1 Agar + 4 mg L -1 2,4-D+0.5mg L -1 6-BA + 100 μmol·L -1 acetosyringone, pH 5.95;

[0016] The hairy root induction medium is 1 / 2MS basic medium + 15g·L -1 Sucrose +7.8g·L -1 Agar + 400 mg L -1 Timentin + 1mg·L -1 Glufosinate+0.1mg·L -1 IBA, pH 5.95;

[0017] Step 5: Select the purple-red hairy roots of sweet clover by visual observation, extract DNA using the CTAB method, and perform PCR amplification and sequencing.

[0018] The beneficial effects of the present invention compared with the prior art are as follows:

[0019] The present invention selects two target sites of the MaPDS gene of sweet clover to construct a gene editing system, and successfully achieves editing of the target gene, with the editing efficiency of one target site reaching about 40%; the present invention confirms for the first time a vector system suitable for gene editing of sweet clover, and the constructed editing vector system is based on the principle of "color development" of accumulated anthocyanins by overexpression of the MtLAP1 transcription factor, which can visually, quickly and efficiently obtain positive hairy roots and achieve efficient editing of red positive hairy roots, prevent Agrobacterium contamination, and reduce the workload of hairy root target gene detection.

[0020] The present invention utilizes the editing system to obtain a MaPDS-edited hairy root system, providing a hairy root genome editing system for Melilotus officinalis, and facilitating the verification of unknown gene functions in Melilotus officinalis.

[0021] The invention uses the sterile hypocotyl of sweet clover as the explant to induce hairy roots, which has a high hairy root induction rate (>30%) and a short time (30-45 days), effectively reduces the occurrence of seedling roots, reduces the workload of root system detection, and improves detection efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 Schematic diagram of the CRISPR_2.0-MtLAP1-KO-MaPDS backbone of the sweet clover hairy root vector;

[0023] Figure 2 Diagram of the process of inducing anthocyanin-accumulating hairy roots in the hypocotyls of Melilotus alba with Agrobacterium rhizogenes LBA9402; (A) Sterilization and germination of Melilotus alba seeds; (B) Placing Melilotus alba hypocotyls in the infection solution; (C) Infection and co-cultivation of Melilotus alba hypocotyls; (D) Induction of hairy roots in Melilotus alba hypocotyls;

[0024] Figure 3 Electrophoresis diagrams of DNA molecular identification of the hairy roots of Melilotus alba; (A) Agarose gel electrophoresis diagram of the rolB gene in the hairy roots of Melilotus alba; (B) Agarose gel electrophoresis diagram of the Vir G gene in the hairy roots of Melilotus alba; (C) Agarose gel electrophoresis diagram of the Cas 9 gene in the hairy roots of Melilotus alba;

[0025] Figure 4 Statistical histogram of hairy root induction in hypocotyls of Melilotus officinalis;

[0026] Figure 5 Statistical histogram of editing types of hairy root target site 1;

[0027] Figure 6 Diagram of the MaPDS gene editing status in Sweet Clover. DETAILED DESCRIPTION

[0028] The present invention is further described in detail below with reference to the accompanying drawings and examples.

[0029] Example 1: Selection of explants and induction of hairy roots in sweet clover

[0030] 1) Explant Selection: Gently prick the hypocotyl of 3-5 day-old sterile sweet clover seedlings with a needle to create a wound, and set aside for later use.

[0031] 2) Induction of explant hairy roots: refer to the method of Example 4.

[0032] 3) Statistics of explant induction rate and positive rate (statistical data of Example 4): The induction process of hypocotyl of sterile seedlings of sweet clover is as follows: Figure 2 The test results are shown in Figure 3 As shown, the induction rate of hairy roots in the hypocotyls of sterile seedlings of Melilotus alba was 39.8%, the positive rate was 72.8%, and the induction period was 30-45 days. Based on the above, the hypocotyls of Melilotus alba were selected as the explants for subsequent gene editing and induction of hairy roots.

[0033] Example 2: Target site selection of sweet clover hairy roots

[0034] 1) Target site selection: Through literature research, we found the Arabidopsis thaliana AtPDS gene number AT4G14210 and the soybean GmPDS gene numbers GlyMa.18G003900 and GlyMa.11G253000. We retrieved the CDS sequences of the Arabidopsis and soybean PDS genes from the Phytozome website and used Blast to align the MaPDS gene sequence of the sweet clover in the sweet clover database. The MaPDS gene sequence of the sweet clover was obtained, as shown in SEQ ID NO. 2.

[0035] Target sites were selected according to the following principles:

[0036] ①GC content should be between 40% and 60%;

[0037] ② Avoid ending with TTC or TTT, or containing only T and C in the last nucleotide, more than two Ts, or at least one TT and one T or C.

[0038] ③ The sequence should not contain TTTT. Otherwise, transcription cannot be performed using the U6 / U3 promoter because it terminates transcription.

[0039] ④ GGG / CCC should be avoided as much as possible in the PAM area;

[0040] ⑤ Avoid missing the target as much as possible;

[0041] ⑥ The hairpin structure formed by the target site itself should be ≤4.

[0042] Example 3: Construction of the Sweetclover MaPDS gene editing vector and Agrobacterium transformation

[0043] 1) Select CRISPR_2.0-pRGEB31R vector as the backbone, use XhoI restriction enzyme to digest CRISPR_2.0-pRGEB31R vector, and recover and purify the linearized vector, which is recorded as CRISPR_2.0-pRGEB31R-XhoI;

[0044] 2) Using Medicago truncatula cDNA as a template and primers MtLAP1-in2.0-F and MtLAP1-in2.0-R as primers, amplify the MtLAP1 fragment, and recover the fragment, which is recorded as the amplified product MtLAP1 DNA fragment (see Table 1 for the specific sequence);

[0045] Table 1 Template sequences required for vector construction

[0046]

[0047] 3) PCR reaction system for amplifying the product MtLAP1: Medicago truncatula cDNA 5 μL, 2× Phanta Max MasterMix 25 μL, MtLAP1-in2.0-F 2.5 μL, MtLAP1-in2.0-R 2.5 μL, and ddH2O to 50 μL;

[0048] 4) Reaction procedure for the amplified product MtLAP1: 95°C for 3 min; 32 cycles of 95°C for 15 s, 55°C for 15 s, and 72°C for 40 s; extension at 72°C for 5 min, and storage at 4°C;

[0049] 5) seamlessly ligating the linearized vector CRISPR_2.0-pRGEB31R-XhoI obtained in 1) and the gel-recovered MtLAP1 DNA fragment obtained in 2);

[0050] 6) Seamless ligation reaction system: CRISPR_2.0-pRGEB31R-XhoI 300ng, MtLAP1 amplified fragment 50ng, 5×CE II Buffer 2μL, Exnase II 1μL, ddH2O to 10μL; seamless cloning reaction procedure: 37°C, 40min;

[0051] 7) The ligation product obtained in 6) was transformed into a DH5a competent cell, and the bacterial culture was identified by PCR using primers MtLAP1-in2.0-F and MtLAP1-in2.0-R. Positive clones were selected for second-generation Sanger sequencing. The sequencing results were compared to obtain the gene editing visualization vector CRISPR_2.0-MtLAP1, which was designated CRISPR_2.0-MtLAP1.

[0052] The reaction system for PCR identification in 7) is as follows: 1 μL bacterial solution, 10 μL 2×Taq Max Master Mix, 1 μL MtLAP1-in2.0-F, and 1 μL MtLAP1-in2.0-R; ddH2O is added to 20 μL.

[0053] The reaction procedure of the PCR identification in step 7) is as follows: 95°C for 5 min; 95°C for 30 s, 55°C for 30 s, 72°C for 1 min, 29 cycles; extension at 72°C for 5 min, and storage at 4°C;

[0054] 8) Based on the obtained MaPDS gene sequence of Melilotus officinalis and the CRISPR (Protospacer-adjacent Motif (PAM) is NGG) vector design principles, the two target sites selected were: 5'-AAGGTTGTTATTGCTGGTGC-3' and 5'-TGGTCACAAGCCTATATTGC-3';

[0055] 9) After selecting the target site, using the pGTR vector containing the tRNA and sgRNA sequences (key sequences are shown in Table 2) as a template, and using (MaPDS-2.0-F1, MaPDS-2.0-R1), (MaPDS-2.0-F2, MaPDS-2.0-R2), (MaPDS-2.0-F3, MaPDS-2.0-R3) as primers (Table 2), fragment 1, fragment 2, and fragment 3 were amplified using a high-fidelity enzyme. The obtained products were recorded as PDS-2.0-PD1, PDS-2.0-PD2, and PDS-2.0-PD3, respectively, and recovered and purified;

[0056] Table 2 Primer sequences required for vector construction

[0057]

[0058] The reaction system for the amplified product in 9) is as follows: 1 μL of E. coli culture containing pGTR (key sequence see Table 1), 25 μL of 2×Phanta Max MasterMix, 12.5 μL of MaPDS-2.0-F, and 12.5 μL of MaPDS-2.0-R; ddH2O is added to 50 μL;

[0059] The reaction procedure for the amplified product in 9) is as follows: 95°C for 3 min; 32 cycles of 95°C for 15 s, 58°C for 30 s, and 72°C for 40 s; extension at 72°C for 5 min, and storage at 4°C;

[0060] 10) Using the restriction endonuclease Bsa I and T4 ligase, the resulting products MaPDS-2.0-PD1, MaPDS-2.0-PD2, and MaPDS-2.0-PD3 were sequentially ligated into the backbone vector CRISPR_2.0-MtLAP by Golden Gate ligation;

[0061] 10) Ligation reaction system: 1.5 μL Bsa I Buffer, 1 μL T4 Buffer, 150 ng backbone vector (CRISPR_2.0-MtLAP1) (depending on the plasmid concentration), 1.5 μL Bsa I endonuclease, 0.5 μL T4 ligase, 50 ng each of amplified products (MaPDS-2.0-PD1, MaPDS-2.0-PD2, MaPDS-2.0-PD3), diluted to 15 μL with ddH2O;

[0062] 10) Golden Gate ligation reaction program: 37°C for 5 min, 5 cycles of (37°C for 10 min, 10°C for 5 min, 20°C for 5 min), and 12 cycles of (37°C for 3 min, 10°C for 5 min, 20°C for 5 min);

[0063] 11) The ligation product was transformed into DH5a competent cells, and the bacterial solution was identified by PCR using JC2.0F and JC2.0R primers. The positive clones were subjected to Sanger second-generation sequencing. The sequencing results were compared to obtain the final vector CRISPR_2.0-MtLAP1-KO-MaPDS, as shown in the schematic diagram. Figure 1 As shown;

[0064] 11) PCR identification reaction system: 1 μL bacterial solution, 10 μL 2× Taq Max Master Mix, 1 μL JC2.0F, 1 μL JC2.0R, and ddH2O to 20 μL;

[0065] 11) PCR identification reaction program: 95°C for 5 min; 95°C for 30 s, 55°C for 30 s, 72°C for 1 min, 29 cycles; extension at 72°C for 5 min, storage at 4°C;

[0066] 12) Add 200-300 ng of the constructed CRISPR_2.0-MtLAP1-KO-MaPDS plasmid to LBA9402 rhizogenes competent cells (50 μL), ice bath for 30 minutes, and quickly freeze the competent cells with the plasmid in liquid nitrogen for 2-3 minutes. Then place them in a 37°C water bath for 3 minutes, then ice bath for 3 minutes, add 400 μL of antibiotic-free LB medium, and incubate at 28°C ~ 200 rpm ~ 2 hours. Place in a high-speed centrifuge and centrifuge at 3000g for 10 minutes. Remove 200 μL of supernatant and resuspend the precipitated bacteria in the remaining 200 μL LB. Apply the resuspended bacterial liquid to a solid LB culture dish with kanamycin and rifampicin antibiotics, and culture it upside down at 28°C. After waiting for 2 days for the growth of a single clone, pick a single clone and incubate it in 400 mL LB (kanamycin + rifampicin antibiotics) in a 28°C shaker overnight. Subsequently, primers JC2.0F and JC2.0R were used to identify positive bacteria. The primer sequences are shown in Table 2.

[0067] Example 4: Induction of hairy roots of sweet clover

[0068] 1) The hypocotyls of 3-5 day-old sterile seedlings of Melilotus officinalis (Lanxi No. 2, used with permission from Professor Zhang Jiyu's team at Lanzhou University) were gently pierced with a sterile needle to create wounds, which served as explants for inducing hairy roots in Melilotus officinalis.

[0069] 2) The positive strain prepared in Example 3 was inoculated into the LB basal medium containing the corresponding resistance of Agrobacterium, and cultured at 28°C and 200 rpm. 600 When the value is between 0.6 and 0.8, the cells are centrifuged at 3000 g to collect the cells. Sterile SH liquid medium containing acetosyringone (SH basic medium + 15 g L -1 Sucrose + 100 μmol·L -1 Acetosyringone, pH 5.95) resuspended the bacterial solution to OD 600 To 0.3-0.4, as the infection solution for inducing hairy roots of sweet clover.

[0070] 3) Place the prepared explants in the infection solution for inducing hairy roots of Melilotus officinalis, vacuum for 5 minutes, shake and incubate for 30 minutes, and then place on sterile filter paper to dry. The time should not be too long to prevent the hypocotyl from losing water and wilting. -1 Sucrose + 4 mg·L -1 2,4-D + 0.5 mg L -1 6-BA + 100 μmol·L -1Acetosyringone, pH 5.95) for 2 days and then transferred to hairy root induction medium (1 / 2MS basal medium + 15g·L -1 Sucrose +7.8g·L -1 Agar + 400 mg L -1 Timentin + 1mg·L -1 Glufosinate+0.1mg·L -1 Hairy roots were induced on IBA (pH 5.95), and the hairy roots grew to a detectable state in 30-45 days.

[0071] Example 5: Statistics of MaPDS gene editing in sweet clover hairy roots

[0072] 1) Hairy Root DNA Extraction: Fresh sweet clover hairy roots from Example 4 were minced and placed in a 1.5 mL centrifuge tube. 1 mL of 2× CTAB extract was added, ground, and thoroughly mixed. The tube was incubated at 65°C for 30 min, with gentle inversion every 10 min. After cooling to room temperature, 100 μL of chloroform was added and vortexed for 15 s. The tube was centrifuged at 12,000 g for 10 min at room temperature. The supernatant was transferred to a new 1.5 mL centrifuge tube. An equal volume of isopropanol was added and vortexed. The tube was precipitated at -20°C for 30 min, and centrifuged at 12,000 g for 10 min at room temperature. The precipitate was then washed with 1 mL of 70% ethanol and centrifuged at 7500 g for 5 min. The supernatant was discarded. This washing procedure was repeated once, and the DNA was air-dried. Deionized water was added to dissolve the DNA, and the DNA concentration and ratio were determined using an ultramicrometer.

[0073] 2) PCR reaction: The PCR primer sequences for the rolB gene, vir G gene, and Cas9 gene are shown in Table 3:

[0074] Table 3 Primers for hairy root identification

[0075]

[0076] The total PCR reaction system in 2) was 20 μL, and 1 μL of upstream and downstream primers of rolB gene, vir G gene and Cas9 gene were added respectively (final concentration 20 pmol·L –1), 2 μL (approximately 200 ng) of template DNA, 10 μL of 2× MIX Buffer, and 6 μL of deionized water to a 20 μL reaction volume. PCR reaction conditions: 95°C pre-denaturation for 5 min; 29 cycles of 95°C denaturation for 30 s, 54°C annealing for 30 s, and 72°C extension for 45 s; 72°C extension for 10 min, followed by PCR product removal and constant temperature storage at 4°C. 10 μL each of the PCR amplification products of the rolB gene, vir G gene, and Cas9 gene was subjected to 1% agarose gel electrophoresis and photographed. 5 μL of a 2000 bp LadderMaker was used as a molecular weight standard.

[0077] 3) Gel electrophoresis imaging showed that the PCR product sizes of rol B gene, vir G gene and Cas9 gene were 194 bp, 529 bp and 547 bp respectively. Figure 4 In line with expectations.

[0078] 4) MaPDS target site editing detection: Amplification of upstream and downstream fragments of the target site: Use primers MaPDS-JC-F1: 5'-CTGCTTATTTGTCTTCCACC-3' (SEQ ID NO.5), MaPDS-JC-R2: 5'-CAAATGAGATTAAATTAGTC-3' (SEQ ID NO.6) to amplify and detect the target site, and the PCR fragment size is 996bp. The amplified DNA fragment containing the target site PCR stock solution is sent to the company for Sanger sequencing. For samples with double peaks of sequencing, the PCR product is gel-recovered and connected to the T vector and transformed into Escherichia coli DH5a. PCR detection is performed using universal primers M13F and M13R. 50 positive clones are selected for further sequencing to determine their editing methods. Among them, the editing type of target site 1 is as follows Figure 5 The gene fragments with specific editing methods for target sites are shown in Figure 6 As shown, the editing efficiency of target site 1 is 39.5%, and the editing efficiency of target site 2 is 0.02%.

[0079] This invention establishes an efficient genome editing system and method based on the visualized hairy root genetic transformation system of Melilotus alba. This system effectively reduces the occurrence of seedling roots, reduces Agrobacterium contamination, enables rapid and efficient screening of positive hairy roots, reduces the workload of hairy root testing, and shortens the research cycle. It provides technical support for genetic breeding and gene function analysis of Melilotus alba, a plant of the genus Melilotus in the Leguminosae family.

[0080] Nucleotide sequence of the editing system CRISPR_2.0-MtLAP1-KO-MaPDS (SEQ ID NO.1):

[0081] aagcttgataatttatttgaaaattcataagaaaagcaaacgttacatgaattgatgaaacaatacaaagac

[0082] agataaagccacgcacatttaggatattggccgagattactgaatattgagtaagatcacggaatttctga

[0083] caggagcatgtcttcaattcagcccaaatggcagttgaaatactcaaaccgccccatatgcaggagcgg

[0084] atcattcattgtttgtttggttgcctttgccaacatgggagtccaagattctgcagtcaaatctcggtgacgg

[0085] gcaggaccggacggggcggtaccggcaggctgaagtccagctgccagaaacccacgtcatgccagt

[0086] tcccgtgcttgaagccggccgcccgcagcatgccgcggggggcatatccgagcgcctcgtgcatgcg

[0087] cacgctcgggtcgttgggcagcccgatgacagcgaccacgctcttgaagccctgtgcctccagggactt

[0088] cagcaggtgggtgtagagcgtggagcccagtcccgtccgctggtggcggggggagacgtacacggt

[0089] cgactcggccgtccagtcgtaggcgttgcgtgccttccaggggcccgcgtaggcgatgccggcgacct

[0090] cgccgtccacctcggcgacgagccagggatagcgctcccgcagacggacgaggtcgtccgtccactc

[0091] ctgcggttcctgcggctcggtacggaagttgaccgtgcttgtctcgatgtagtggttgacgatggtgcaga

[0092] ccgccggcatgtccgcctcggtggcacggcggatgtcggccgggcgtcgttctgggctcatcgattcg

[0093] atttggtgtatcgagattggttatgaaattcagatgctagtgtaatgtattggtaatttgggaagatataatag

[0094] gaagcaaggctatttatccatttctgaaaaggcgaaatggcgtcaccgcgagcgtcacgcgcattccgtt

[0095] cttgctgtaaagcgttgtttggtacacttttgactagcgaggcttggcgtgtcagcgtatctattcaaaagtc

[0096] gttaatggctgcggatcaagaaaaagttggaatagaaacagaatacccgcgaaattcaggcccggttgc

[0097] catgtcctacacgccgaaataaacgaccaaattagtagaaaaataaaaactgactcggatacttacgtca

[0098] cgtcttgcgcactgatttgaaaaatctcagccatggctgcaggtcgacgagtcagtaataaacggcgtca

[0099] aagtggttgcagccggcacacacgagtcgtgtttatcaactcaaagcacaaatacttttcctcaacctaaa

[0100] aataaggcaattagccaaaaacaactttgcgtgtaaacaacgctcaatacacgtgtcattttattattagcta

[0101] ttgcttcaccgccttagctttctcgtgacctagtcgtcctcgtcttttcttcttcttcttctataaaacaataccca

[0102] aagagctcttcttcttcacaattcagatttcaatttctcaaaatcttaaaaactttctctcaattctctctaccgtg

[0103] atcaaggtaaatttctgtgttccttattctctcaaaatcttcgattttgttttcgttcgatcccaatttcgtatatgtt

[0104] ctttggtttagattctgttaatcttagatcgaagacgattttctgggtttgatcgttagatatcatcttaattctcg

[0105] attagggtttcatagatatcatccgatttgttcaaataatttgagttttgtcgaataattactcttcgatttgtgatt

[0106] tctatctagatctggtgttagtttctagtttgtgcgatcgaatttgtcgattaatctgagtttttctgattaacagc

[0107] catggactataaggaccacgacggagactacaaggatcatgatattgattacaaagacgatgacgataa

[0108] gatggccccaaagaagaagcggaaggtcggtatccacggagtcccagcagccgacaagaagtacag

[0109] catcggcctggacatcggcaccaactctgtgggctgggccgtgatcaccgacgagtacaaggtgccca

[0110] gcaagaaattcaaggtgctgggcaacaccgaccggcacagcatcaagaagaacctgatcggagccct

[0111] gctggttcgacagcggcgaaacagccgaggccacccggctgaagagaaaccgccaagaagatacac

[0112] cagacggagaaccggatctgctatctgcaagagatcttcagcaacgagatggccaaggtggacgaca

[0113] gcttcttccacagaactgggaagagtccttcctgggaagagagaagagaagcacgagcggcaccccacatct

[0114] tcggcaacatcgtggacgaggtggcctaccacgagaagtccccaccatctaccacctgagaaaaaa

[0115] ctggtggacagcaccgacaaggccgacctgcggctgatctatctggccctggcccacatgatcaagttc

[0116] cggggccacttcctgatcgagggcgacctgaaccccgacaacagcgacgtggacaagctgttcatcca

[0117] gctggtgcagacctacaaccagctgttcgaggaaaaccccatcaacgccagcggcgtggacgccaag

[0118] gccatcctgtctgccagagactgagcaagagcagacggctggaaaatctgatcgcccagctgcccggcga

[0119] gaagagaatggcctgttcggaaacctgattgccctgagcctgggcctgacccccaacttcaagagcaa

[0120] cttcgacctggccgaggatgccaaactgcagctgagcaaggacacctacgacgacgacctggacaac

[0121] ctgctggcccagatcggcgaccagtacgccgacctgtttctggccgccaagaacctgtccgacgccatc

[0122] ctgctgagcgacatcctgagagtgaacaccgagatcaccaaggcccccctgagcgcctctatgatcaa

[0123] gagatacgacgagcaccaccaggacctgaccctgctgaaagctctcgtgcggcagcagctgcctgag

[0124] aagtacaaagagattttttcgaccagagcaagaacggctacgccggctacattgacggcggagccag

[0125] ccaggaagagttctacaagttcatcaagcccatcctggaaaagatggacggcaccgaggaactgctcgt

[0126] gaagctgaacagagaggacctgctgcggaagcagcggaccttcgacaacggcagcatcccccacca

[0127] gatccacctgggagagctgcacgccattctgcggcggcaggagaatttttacccattcctgaaggacaa

[0128] ccgggaaaagatcgagaagatcctgaccttccgcatcccctactacgtgggccctctggccaggggaa

[0129] acagcagattcgcctggatgaccagaaagagcgaggaaaccatcaccccctggaacttcgaggaagt

[0130] ggtggacaagggcgcttccgcccagagcttcatcgagcggatgaccaacttcgataagaacctgccca

[0131] acgagaaggtgctgcccaagcacagcctgctgtacgagtacttcaccgtgtataacgagctgaccaaag

[0132] tgaaatacgtgaccgagggaatgagaaagcccgccttcctgagcggcgagcagaaaaaggccatcgt

[0133] ggacctgctgttcaagaccaaccggaaagtgaccgtgaagcagctgaaagaggactacttcaagaaaa

[0134] tcgagtgcttcgactccgtggaaatctccggcgtggaagatcggttcaacgcctccctgggcacatacca

[0135] cgatctgctgaaaattatcaaggacaaggacttcctggacaatgaggaaaacgaggacattctggaaga

[0136] tatcgtgctgaccctgacactgtttgaggacagagagatgatcgaggaacggctgaaaacctatgccca

[0137] cctgttcgacgacaaagtgatgaagcagctgaagcggcggagatacaccggctggggcaggctgagc

[0138] cggaagctgatcaacggcatccgggacaagcagtccggcaagacaatcctggatttcctgaagtccga

[0139] cggcttcgccaacagaaacttcatgcagctgatccacgacgacagcctgacctttaaagaggacatcca

[0140] gaaagcccaggtgtccggccagggcgatagcctgcacgagcacattgccaatctggccggcagcccc

[0141] gccattaagaagggcatcctgcagacagtgaaggtggtggacgagctcgtgaaagtgatgggccggc

[0142] acaagcccgagaacatcgtgatcgaaatggccagagagaaccagaccacccagaagggacagaaga

[0143] acagccgcgagagaatgaagcggatcgaagagggcatcaaagagctgggcagccagatcctgaaag

[0144] aacaccccgtggaaaacacccagctgcagaacgagaagctgtacctgtactacctgcagaatgggcg

[0145] ggatatgtacgtggaccaggaactggacatcaaccggctgtccgactacgatgtggaccatatcgtgcc

[0146] tcagagctttctgaaggacgactccatcgacaacaaggtgctgaccagaagcgacaagaaccggggc

[0147] aagagcgacaacgtgccctccgaagaggtcgtgaagaagatgaagaactactggcggcagctgctga

[0148] acgccaagctgattacccagagaaagttcgacaatctgaccaaggccgagagaggcggcctgagcga

[0149] actggataaggccggcttcatcaagagacagctggtggaaacccggcagatcacaaagcacgtggca

[0150] cagatcctggactcccggatgaacactaagtacgacgagaatgacaagctgatccgggaagtgaaagt

[0151] gatcaccctgaagtccaagctggtgtccgatttccggaaggatttccagttttacaaagtgcgcgagatca

[0152] acaactaccaccacgcccacgacgcctacctgaacgccgtcgtgggaaccgccctgatcaaaaagtac

[0153] cctaagctggaaagcgagttcgtgtacggcgactacaaggtgtacgacgtgcggaagatgatcgccaa

[0154] gagcgagcaggaaatcggcaaggctaccgccaagtacttcttctacagcaacatcatgaactttttcaag

[0155] accgagattaccctggccaacggcgagatccggaagcggcctctgatcgagacaaacggcgaaacc

[0156] ggggagatcgtgtgggataagggccgggattttgccaccgtgcggaaagtgctgagcatgccccaagt

[0157] gaatatcgtgaaaaagaccgaggtgcagacaggcggcttcagcaaagagtctatcctgcccaagagga

[0158] acagcgataagctgatcgccagaaagaaggactgggaccctaagaagtacggcggcttcgacagccc

[0159] caccgtggcctattctgtgctggtggtggccaaagtggaaaagggcaagtccaagaaactgaagagtgt

[0160] gaaagagctgctggggatcaccatcatggaaagaagcagcttcgagaagaatcccatcgactttctgga

[0161] agccaagggctacaaagaagtgaaaaaggacctgatcatcaagctgcctaagtactccctgttcgagct

[0162] ggaaaacggccggaagagaatgctggcctctgccggcgaactgcagaagggaaacgaactggccct

[0163] gccctccaaatatgtgaacttcctgtacctggccagccactatgagaagctgaagggctcccccgagga

[0164] taatgagcagaaacagctgtttgtggaacagcacaagcactacctggacgagatcatcgagcagatcag

[0165] cgagttctccaagagagtgatcctggccgacgctaatctggacaaagtgctgtccgcctacaacaagca

[0166] ccgggataagcccatcagagagcaggccgagaatatcatccacctgtttaccctgaccaatctgggagc

[0167] ccctgccgccttcaagtactttgacaccaccatcgaccggaagaggtacaccagcaccaaagaggtgct

[0168] ggacgccaccctgatccaccagagcatcaccggcctgtacgagacacggatcgacctgtctcagctgg

[0169] gaggcgacaaaaggccggcggccacgaaaaaggccggccaggcaaaaaagaaaaagtaagaattc

[0170] aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaatcgaacaaagcacc

[0171] agtggtctagtggtagaatagtaccctgccacggtacagacccgggttcgattcccggctggtgcatggt

[0172] cacaagcctatattgcgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaa

[0173] aagtggcaccgagtcggtgcaacaaagcaccagtggtctagtggtagaatagtaccctgccacggtac

[0174] agacccgggttcgattcccggctggtgcaaaggttgttattgctggtgcgttttagagctagaaatagcaa

[0175] gttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgctttttttatatgaagatga

[0176] agatgaaatatttggtgtgtcaaataaaaagcttgtgtgcttaagtttgtgtttttttcttggcttgttgtgttatg

[0177] aatttgtggctttttctaatattaaatgaatgtaagatcacattataatgaataaacaaatgtttctataatccatt

[0178] gtgaatgttttgttggatctcttctgcagcatataactactgtatgtgctatggtatggactatggaatatgatt

[0179] aaagataaggaattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaactta

[0180] atcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgccctt

[0181] cccaacagttgcgcagcctgaatggcgaatgctagagcagcttgagcttggatcagattgtcgtttcccg

[0182] ccttcagtttaaactatcagtgtttgacaggatatattggcgggtaaacctaagagaaaagagcgtttatta

[0183] gaataacggatatttaaaagggcgtgaaaaggtttatccgttcgtccatttgtatgtgcatgccaaccacag

[0184] ggttcccctcgggatcaaagtactttgatccaacccctccgctgctatagtgcagtcggcttctgacgttca

[0185] gtgcagccgtcttctgaaaacgacatgtcgcacaagtcctaagttacgcgacaggctgccgccctgccc

[0186] ttttcctggcgttttcttgtcgcgtgttttagtcgcataaagtagaatacttgcgactagaaccggagacatta

[0187] cgccatgaacaagagcgccgccgctggcctgctgggctatgcccgcgtcagcaccgacgaccagga

[0188] cttgaccaaccaacgggccgaactgcacgcggccggctgcaccaagctgttttccgagaagatcaccg

[0189] gcaccaggcgcgaccgcccggagctggccaggatgcttgaccacctacgccctggcgacgttgtgac

[0190] agtgaccaggctagaccgcctggcccgcagcacccgcgacctactggacattgccgagcgcatccag

[0191] gaggccggcgcgggcctgcgtagcctggcagagccgtgggccgacaccaccacgccggccggcc

[0192] gcatggtgttgaccgtgttcgccggcattgccgagttcgagcgttccctaatcatcgaccgcacccggag

[0193] cgggcgcgaggccgccaaggcccgaggcgtgaagtttggcccccgcctaccctcaccccggcaca

[0194] gatcgcgcacgcccgcgagctgatcgaccaggaagggccgcaccgtgaaagaggcggctgcactgct

[0195] tggcgtgcatcgctcgaccctgtaccgcgcacttgagcgcagcgaggaagtgacgcccaccgaggcc

[0196] aggcggcgcggtgccttccgtgaggacgcattgaccgaggccgacgccctggcggccgccgagaat

[0197] gaacgccaaaggaacaagcatgaaacgcaccaggacgggccaggacgaaccgtttttcattaccga

[0198] agagatcgaggcggagatgatcgcggccgggtacgtgttcgagccgcccgcgcacgtctcaaccgtg

[0199] cggctgcatgaaatcctggccggtttgtctgatgccaagctggcggcctggccggccagcttggccgct

[0200] gaaaccgagcgccgccgtctaaaaggtgatgtgtatttgagtaaaacagcttgcgtcatgcggtc

[0201] gctgcgtatatgatgcgatgagtaataaaaaataacgcaaggggaacgcatgaaggttatcgctgtact

[0202] taaccagaaaggcgggtcaggcaagacgaccatcgcaacccatctagcccgcgccctgcaactcgcc

[0203] ggggccgatgttctgttagtcgattccgatccccagggcagtgcccgcgattgggcggccgtgcggga

[0204] agatcaaccgctaaccgttgtcggcatcgaccgcccgacgattgaccgcgacgtgaaggccatcggcc

[0205] ggcgcgacttcgtagtgatcgacggagcgccccaggcggcggacttggctgtgtccgcgatcaaggc

[0206] agccgacttcgtgctgattccggtgcagccaagcccttacgacatatgggccaccgccgacctggtgga

[0207] gctggttaagcagcgcattgaggtcacggatggaaggctacaagcggcctttgtcgtgtcgcgggcgat

[0208] caaaggcacgcgcatcggcggtgaggttgccgaggcgctggccgggtacgagctgcccattcttgagt

[0209] cccgtatcacgcagcgcgtgagctacccaggcactgccgccgccggcacaaccgttcttgaatcagaa

[0210] cccgagggcgacgctgcccgcgaggtccaggcgctggccgctgaaattaaatcaaaactcatttgagtt

[0211] aatgaggtaaagagaaaatgagcaaaagcacaaacacgctaagtgccggccgtccgagcgcacgca

[0212] gcagcaaggctgcaacgttggccagcctggcagacacgccagccatgaagcgggtcaactttcagttg

[0213] ccggcggaggatcacaccaagctgaagatgtacgcggtacgccaaggcaagaccattaccgagctgc

[0214] tatctgaatacatcgcgcagctaccagagtaaatgagcaaatgaataaatgagtagatgaattttagcggc

[0215] taaaggaggcggcatggaaaatcaagaacaaccaggcaccgacgccgtggaatgccccatgtgtgga

[0216] ggaacgggcggttggccaggcgtaagcggctgggttgtctgccggccctgcaatggcactggaaccc

[0217] ccaagcccgaggaatcggcgtgacggtcgcaaaccatccggcccggtacaaatcggcgcggcgctg

[0218] ggtgatgacctggtggagaagttgaaggccgcgcaggccgcccagcggcaacgcatcgaggcagaa

[0219] gcacgccccggtgaatcgtggcaagcggccgctgatcgaatccgcaaagaatcccggcaaccgccg

[0220] gcagccggtgcgccgtcgattaggaagccgcccaagggcgacgagcaaccagattttttcgttccgat

[0221] gctctatgacgtgggcacccgcgatagtcgcagcatcatggacgtggccgttttccgtctgtcgaagcgt

[0222] gaccgacgagctggcgaggtgatccgctacgagcttccagacgggcacgtagaggtttccgcagggc

[0223] cggccggcatggccagtgtgtgggattacgacctggtactgatggcggtttcccatctaaccgaatccat

[0224] gaaccgataccgggaagggaagggagacaagcccggccgcgtgttccgtccacacgttgcggacgt

[0225] actcaagttctgccggcgagccgatggcggaaagcagaaagacgacctggtagaaacctgcattcggt

[0226] taaacaccacgcacgttgccatgcagcgtacgaagaaggccaagaacggccgcctggtgacggtatc

[0227] cgagggtgaagccttgattagccgctacaagatcgtaaagagcgaaaccgggcggccggagtacatc

[0228] gagatcgagctagctgattggatgtaccgcgagatcacagaaggcaagaacccggacgtgctgacggt

[0229] tcaccccgattactttttgatcgatcccggcatcggccgttttctctaccgcctggcacgccgcgccgcag

[0230] gcaaggcagaagccagatggttgttcaagacgatctacgaacgcagtggcagcgccggagagttcaa

[0231] gaagttctgtttcaccgtgcgcaagctgatcgggtcaaatgacctgccggagtacgatttgaaggagga

[0232] ggcggggcaggctggcccgatcctagtcatgcgctaccgcaacctgatcgagggcgaagcatccgcc

[0233] ggttcctaatgtacggagcagatgctagggcaaattgccctagcaggggaaaaaggtcgaaaagcact

[0234] ctttcctgtggatagcacgtacattgggaacccaaagccgtacattgggaaccggaacccgtacattggg

[0235] aacccaaagccgtacattgggaaccggtcacacatgtaagtgactgatataaaagagaaaaaaggcga

[0236] tttttccgcctaaaactctttaaaacttattaaaactcttaaaacccgcctggcctgtgcataactgtctggcc

[0237] agcgcacagccgaagagctgcaaaaagcgcctacccttcggtcgctgcgctccctacgccccgccgct

[0238] tcgcgtcggcctatcgcggccgctggccgctcaaaaatggctggcctacggccaggcaatctaccagg

[0239] gcgcggacaagccgcgccgtcgccactcgaccgccggcgcccacatcaaggcaccctgcctcgcgc

[0240] gtttcggtgatgacggtgaaaacctctgacacatgcagctcccggagacggtcacagcttgtctgtaagc

[0241] ggatgccgggagcagacaagcccgtcagggcgcgtcagcgggtgttggcgggtgtcggggcgcag

[0242] ccatgacccagtcacgtagcgatagcggagtgtatactggcttaactatgcggcatcagagcagattgta

[0243] ctgagagtgcaccatatgcggtgtgaaataccgcacagatgcgtaaggagaaaataccgcatcaggcg

[0244] ctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcact

[0245] caaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaagg

[0246] ccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctga

[0247] cgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccag

[0248] gcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgc

[0249] ctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgtt

[0250] cgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactat

[0251] cgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagc

[0252] agagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaagg

[0253] acagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggc

[0254] aaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggat

[0255] ctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattt

[0256] tggtcatgcattctaggtactaaaacaattcatccagtaaaatataatattttattttctcccaatcaggcttgat

[0257] ccccagtaagtcaaaaaatagctcgacatactgttcttccccgatatcctccctgatcgaccggacgcag

[0258] aaggcaatgtcataccacttgtccgccctgccgcttctcccaagatcaataaagccacttactttgccatctt

[0259] tcacaaagatgttgctgtctcccaggtcgccgtgggaaaagacaagttcctcttcgggcttttccgtcttta

[0260] aaaaatcatacagctcgcgcggatctttaaatggagtgtcttcttcccagttttcgcaatccacatcggcca

[0261] gatcgttattcagtaagtaatccaattcggctaagcggctgtctaagctattcgtatagggacaatccgatat

[0262] gtcgatggagtgaaagagcctgatgcactccgcatacagctcgataatcttttcagggctttgttcatcttc

[0263] atactcttccgagcaaaggacgccatcggcctcactcatgagcagattgctccagccatcatgccgttca

[0264] aagtgcaggacctttggaacaggcagctttccttccagccatagcatcatgtccttttcccgttccacatcat

[0265] aggtggtccctttataccggctgtccgtcatttttaaatataggttttcattttctcccaccagcttatatacctta

[0266] gcaggagacattccttccgtatcttttacgcagcggtatttttcgatcagttttttcaattccggtgatattctca

[0267] ttttagccatttattatttccttcctcttttctacagtatttaaagataccccaagaagctaattataacaagacg

[0268] aactccaattcactgttccttgcattctaaaaccttaaataccagaaaacagctttttcaaagttgttttcaaag

[0269] ttggcgtataacatagtatcgacggagccgattttgaaaccgcggtgatcacaggcagcaacgctctgtc

[0270] atcgttacaatcaacatgctaccctccgcgagatcatccgtgtttcaaacccggcagcttagttgccgttctt

[0271] ccgaatagcatcggtaacatgagcaaagtctgccgccttacaacggctctcccgctgacgccgtcccgg

[0272] actgatgggctgcctgtatcgagtggtgattttgtgccgagctgccggtcggggagctgttggctggctg

[0273] gtggcaggatatattgtggtgtaaacaaattgacgcttagacaacttaataacacattgcggacgtttttaat

[0274] gtactgaattaacgccgaattaattcgggggatctggattttagtactggattttggttttaggaattagaaat

[0275] tttattgatagaagtattttacaaatacaaatacatactaagggtttcttatatgctcaacacatgagcgaaac

[0276] cctataggaaccctaattcccttatctgggaactactcacacattattatggagaaactcgagtcaaggtag

[0277] atcccaaagagaattcaaatcacaaaggttgaaatcccaaaaggagtcatcatcaacatttggaaactcc

[0278] attaagttctcctcttgtaatgaagagcatgacccaattttctcactgtctacatgttctcccaagttccacaaa

[0279] ctgtcacaccacatttcacatggtattggggcattacctagatctggttttgaagtagaagcacactctctac

[0280] caatttgatttgaagccatattctctgagtaatcaagatctctaggaatactatttttccccttcaaccaatttga

[0281] atgacttgacaaagttataggacgaggtttaataacttcatgagctttcatggtttccttaggtttatcgttttct

[0282] ttctcttcttccttttctgaaaccactttctttgccaaatttgtgtgccaatagttcttcacatcattagctgttcta

[0283] cccggaagccttccagcaatcaatgaccatctatttcctagtagtttgtgtaaccttaggatcaaatcttcttc

[0284] atcctcagaaaatcttcctctgttgatgttggggcttaagtaatttaaccacctcaatctacaactttttctgcat

[0285] ctattcaatccagatctctgaggaactaaattccattttccttcaccgtacgtgttaatgcaagccttgagtag

[0286] ctcatcttccttgtaagtccatgcgccttttctcacacctccggtattctccatctcgagagagatagatttgta

[0287] gagagagactggtgatttcagcgtgtcctctccaaatgaaatgaacttccttatatagaggaaggtcttgc

[0288] gaaggatagtgggattgtgcgtcatcccttacgtcagtggagatatcacatcaatccacttgctttgaagac

[0289] gtggttggaacgtcttctttttccacgatgctcctcgtgggtgggggtccatctttgggaccactgtcggca

[0290] gaggcatcttgaacgatagcctttcctttatcgcaatgatggcatttgtaggtgccaccttccttttctactgtc

[0291] cttttgatgaagtgacagatagctgggcaatggaatccgaggaggtttcccgatattaccctttgttgaaaa

[0292] gtctcaatagccctttggtcttctgagactgtatctttgatattcttggagtagacgagagtgtcgtgctccac

[0293] catgttatcacatcaatccacttgctttgaagacgtggttggaacgtcttctttttccacgatgctcctcgtgg

[0294] gtgggggtccatctttgggaccactgtcggcagaggcatcttgaacgatagcctttcctttatcgcaatgat

[0295] ggcatttgtaggtgccaccttccttttctactgtccttttgatgaagtgacagatagctgggcaatggaatcc

[0296] gaggaggtttcccgatattaccctttgttgaaaagtctcaatagccctttggtcttctgagactgtatctttgat

[0297] attcttggagtagacgagagtgtcgtgctccaccatgttggcaagctgctctagccaatacgcaaaccgc

[0298] ctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggca

[0299] gtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccgg

[0300] ctcgtatgttgtgtggaattgtgagcggataacaatttcacacaggaaacagctatgaccatgattacgcc White sweet clover MaPDS gene sequence (SEQ ID NO.2):

[0301] atggctctttcttgccctatattttcaccaaacttgaattggcaaattgggccaaaaaccatatcaaaatcaa

[0302] gctcttctatgaactcatacaccacaatttcgttatcattttctagtagcatgtcaatgggtcttaacttgaggtt

[0303] caatcttgcttcagcttcaactcgtgcttctaagagtaacaggtttaggaaccatggttctcctttgaaggttg

[0304] tttgcattgattatccacgccctgagcttgataatactgttaatttcattgaagctgcttatttgtcttccaccttt

[0305] cgtgcttctcctcgtcctattaaacctttgaaggttgttattgctggtgcaggtaacaattatccatcttgttttat

[0306] ggttcaagattgtaactttgctactgaatttgttgtttttgttgattttgttctattgggtgtttttgaattaggagtt

[0307] atttttactggtccattagttgattaattgacttgagttttgtcttctaatgatcatagaaactatgaagcaccga

[0308] cacaaatacataacacgacactcgacaccagtagtaatttgtaaaaaatgacataattgaatgtaatcaca

[0309] agagtggtgtcatgtcggacacggacacgtgttggacacccaggccttcaatcagaattgtcgatgctgc

[0310] ataggtggaaagtgagaatgggataggattgtcaattatattatgagcttcttgcttggtatcttaggcagat

[0311] atattctttatgcctgaaaggaatttgtagttcctttcttatgtgtaagttgttttataagctatcgtggagtgttta

[0312] tagaaaaaagctgaaaatagcttatgaacatgttataagttgttttcattagctctgccaaacagtctcccaat

[0313] tgtttatgttagtagtagataaggctagacatatctgaaggcattatcacataatgtgagatccagtgccaat

[0314] tagaaaaaaattacggaatttattgtagcattttcaatttttaaaatttaaaattaaaatgaaggtacaccatattaac

[0315] atgttggatatttaagcgaaaatcgattgtgatatttgtgtatgagttttggccgctttctttctcttttggattgat

[0316] ttgttcttcaatttatcacaggactggctggtttgtcaactgcaaaatatttggcagatgctggtcacaagcct

[0317] atattgctgggaggcaagagacgttctaggtggaaaggttttccgactaatttaatctcatttgtcaataagctt

[0318] ctttttgtgcttcttgtattgatcattttagcttgctgtttagttaaatatgaaacctgttcttatttgactgttccta

[0319] actaatttaattcaagttcttgatgaattatttctggctctttggagtggtaatgttgaacttcatcatcaagtt

[0320] tttttaaagattcaacagtacgtgcaagttattattataattcaattttaaatgttttcatactattttcttttttcta

[0321] aggttgctgcgtggaaagatgaagagggagattggtatgagaccggcctacatatattttgttagttcatta

[0322] caatgtctagcttaacttttataatacacatttgtcaatttaataatacatctttagtaaaaccttttttccatcgct

[0323] aagagagataaaaaagtaaaactggagttatgaattctcctaaagctttgaagacaccacaggaga

[0324] aaaaaagtagtagagaaaaaatgacataaaaaccattctttgaccttttcctagtgtatgctctcggtag

[0325] ttttggtctttgacgcaatcccaactaccaagtccaatgccttttgccttcatgactcagacatctaattaaga

[0326] accaaatttcagataaaagaaggcatgggttaacctgtgctctgtccaagcttcaatctcaaaggactttt

[0327] gcatgagtgggaaatttgttcttaacactgcatgtggaccagttagcccttggcacatgtattgaactatttt

[0328] gatattctttttagtttgccattctaataataataatttactggaactcaatgctagtatttaatcaatatggtcatt

[0329] tttattatttgaatccttgtttataactatcctgacttaacgttttctttttccgaagctttggggcttaccctaat

[0330] gtgcagaacctatttggagagctcagtattaatgatcggttacaatggaagggcattcgatgatctttgct

[0331] atgccaagcaagcctggagagtttagtcgatttgattttcccgaagtccttccatctccgttaaatggtaaga

[0332] tgtaagactttacatatgtagttgcatattcgtataactacctgaagttgaaagtttctttaatgcacatgaagt

[0333] gtataatacatatagtatctggcaattttcattccaatgtgatggccagtgccacaaaaacctgagttcag

[0334] attaaggaataacccttggaagttggaagatttaacacagcatgccagttaaaatttgtttttgaatatattttg

[0335] atgtattttgaagctattctggtagtcttttagtataaatgaagaaaaaggaatagattgatatgatatgccatt

[0336] taaattttttagtataaataaattgctctatggtatgatcaagatattaaaacttactagatctctttttcatatattc

[0337] taacacatttgataatcattgaaaccagatgtgataaattggttccattttatgtgaagtgaaatcacaaatgg

[0338] ggatcaagggttttgttgtttaaaagggattccgatattctttgacgctcttattttatttctttttctttcgtcacta

[0339] atctggtttgcggggctgctatatacttttctcttttaaaaaggaccaacttattttcttacttaatattagcaaat

[0340] gtttacaagttgcatgctgtgaatgtgataacaggaatatgggcaatcttgaggaataatgagatgctgac

[0341] ctggccagagaaaatcaaatttgcaattggacttcttccagctatgcttggtggacaggcgtatgtcgagg

[0342] ctcaagatggtgtttctgtaaaagaatggatgaaaaagcaggtatggcagttgtcttgattccgtaactgtg

[0343] gcagttcattaatatatttatattccttggctatatcaccagtcaaggtcatggcctgttgtgacttaaaaatttc

[0344] aaagggaaatcttgtcagtttgtaaatggagtggagtcttaaccatcttagtgatactgatgataagtattca

[0345] atctgaaatgggttgatttaggatggatttccagtgacttgatgatgataataaggagtcctttaatcattgaa

[0346] aatcaaattatctcagatgaacctctgtgttaatttattttcatgctacttatagttatcaactcgaaaacaaact

[0347] atgatattatatttgtattaaataatgcactaaaactccggtgttgtttttttctcaaaaaaaaataataaattgtta

[0348] gaaatctggggggctaactcatccttacaaaaccggcttgtgaggtgaaggattgcccccacttataaagtc

[0349] attgtcaggccatcacttatccgatgtgggactatttaacataaattaaagcactaaaagatctttttgtaaag

[0350] aaagagtttacttacttccaagtgtgggtgaatattaaattgtgtactttgttttatctcctaactatggcagtcc

[0351] taataactttcactactgggaaataaagaaaggatatctgtagtttttgatgttatattaaattattactttgaga

[0352] ataaatgttctctaccttctgttgaattcacctgaacatattgcattcttctcatggtgtacacgttgcaaatagt

[0353] ttgagaatagattatcaaaaagaaaaaatatatatagttttagaataacacattgtttattccatattatagggc

[0354] attcctgaacgggtaactgatgaagtattcatagcaatgtcgaaggctctaaacttcatcaaccctgatgaa

[0355] cttcaatgcaatgtattttgattgctttaaaccgatttcttcaggtgcgatcatttcattttcttaaacattattctg

[0356] cctatgtaaatgtttgtttaacaaggccattccattcatattacttttgaacataatccgatttgcaataaactca

[0357] ttccatccagggtttatgaaacataggatcaagtgcttcttcttctcaactaattattatattattgaattcttcaa

[0358] taggagaagcatggttctaaaatggcctttttagatggaaatccccctgaaagactttgtatgccaattgttg

[0359] atcatattcggtccttgggtggtgaagtccatcttaattcacgcattaaaaatattgagctaaacgatgatag

[0360] cacagtgaagagctttttactaactaatgggaaggtgattgaaggggatgcttatgtgtctgcagcaccag

[0361] gtatgtttaaaagacttccacactattaattaattgttcatcgaactcttggtctccatttcttacatttttgagga

[0362] tttccgccccttaaacagtggatattctgaagcttcttcttcctgagaactggaaaggggttccatatttcca

[0363] gagattggagaaattagttggagttccagtcataaatgttcacatatggtaagtaatggcttttgatgtcgaa

[0364] aactaagtccatgcaaaagttatactccaattttttgttaaatattgtggtcattattatttttttctttctaccaaat

[0365] atataaactctcatgtttactgaaaaatttggaatagaaatctgtgccagttgtagatatcttaaattttactaat

[0366] gacaaaatgcgtaagttatattcttctttgactggttgtaatagttttggttaatgaaaaaaatatatgtaaaaat

[0367] aaggtaattgtggaaaaacctatttcaatatgtaaactaatcgctggcactaactgatgcagtaatatacttc

[0368] tgttattgttaaaagaaaattctcattatactgacgtatcttctccaaattcagattaacaactaaattagtttgta

[0369] atatttgtcagtgaggattacattatcagctccaccagagtgctgacatactatttatgtttcaaatttgcaggt

[0370] ttgacagaaaattgaagaacacatatgatcaccttctctttagcaaggttttcctcacactttgaaacacttgt

[0371] gatgcctagatagggatgaaaagatagtggatttttacttgtgtggtgtgtgtagcaaatgtatgatggtttta

[0372] gctgtgaagatcacttcctttttgttgtttgaaacggacatctttctttctttgcattcatgatatcacttgtgaatt

[0373] ataaatacatcttttcatcaactcacatctacaatttctatttcgcttcatgcagaagtccccttctgagtgtata

[0374] tgccgacatgtcagtaacttgtaaggtaaaagccgccactcaaatgtattgattagcactgatgtatttcctc

[0375] tatccatgccaaagttgtggccttaatggtctctagggtaacatacacatgtatatgtttgtattcaattgagat

[0376] acctgcatgaatttgagatagtgctttctggataaacagtaaactccgcacaaattatttcagttttttgtaatc

[0377] tgtgaccgaatttcttctgcatataactatttgtttggttacaactgaactttgtaatgctgtttggtaactgtgttt

[0378] cactatcttatgtaggaatactataacccaaaccagtctatgttggagctggtttttgcaccagccgaagaa

[0379] tggatttcacgtagtgatgaggatattattggtgccacaatgtctgaacttgccaaactcttccctgatgaaa

[0380] tttctgcagaccaaagcaaagcaaaaatcatcaagtaccacgttgttaaaactccaaggtttgagtcccac

[0381] tgagttggattatttcttttaacatcttttaccaaacatatgctgtaattatgacattttattttgtcttctgagtcct

[0382] aatgtaactgacatccttgtttcaggtcggtttacaaaactgttccaaattgtgaaccatgtcgtcccataca

[0383] aagatctcctatagaaggtttctatttagctggagattacacaaaacaaaaatatttagcttccatggaaggt

[0384] gctgttctttctgggaagctttgtgcacaggctattgtacaggattcggagctacttactgctcggggccag

[0385] aaaagaatagctcaagcaagtactgtttaa。

Claims

1. The application of two target sites of the MaPDS target gene of Melilotus officinalis, characterized in that: The application is to construct an editing vector system of the Melilotus officinalis MaPDS gene according to the two target sites, and the two target sites are shown in SEQ ID NO.3-4.

2. A genome editing system for Melilotus officinalis, characterized in that: The editing system is CRISPR_2.0-MtLAP1-KO-MaPDS, wherein MtLAP1 is the LAP1 gene of Medicago truncatula, and KO-MaPDS indicates that the editing system targets the MaPDS gene of Melilotus officinalis. The nucleotide sequence of the editing system is shown in SEQ ID NO.

1.

3. A method for efficiently editing the MaPDS gene in the hairy roots of Melilotus officinalis using the editing system, characterized in that: The method comprises the following steps: Step 1: Take the hypocotyl of a 3-5 day old sterile seedling of Melilotus officinalis, and use a sterile needle to make a wound on the hypocotyl as an explant for inducing hairy roots of Melilotus officinalis; Step 2: Thaw the competent cells of Agrobacterium rhizogenes LBA9402 on ice, add CRISPR_2.0-MtLAP1-KO-MaPDS plasmid DNA, let stand on ice for 30 minutes, freeze in liquid nitrogen for 2-3 minutes; incubate in a 37°C water bath for 3 minutes, add LB medium without antibiotics, 28°C ~ 200rpm ~ 2h; spread on solid LB medium containing kanamycin and rifampicin, invert and culture at 28°C; identify single clones by PCR, and save positive colonies; Step 3: The bacterial suspension of the positive colonies obtained in step 2 was inoculated into a liquid LB basal medium containing kanamycin and rifampicin resistance and cultured at 28°C ~ 200rpm; when the bacterial suspension concentration OD 600 When the value reaches 0.6-0.8, centrifuge to enrich the bacteria; resuspend the bacteria in sterile SH liquid medium to OD 600 The value is about 0.3-0.4, which is used as the infection solution for inducing hairy roots of Clerodendrum leucoderma; The SH liquid medium is SH basic medium + a final concentration of 15 g·L -1 Sucrose + 100 μmol·L -1 acetosyringone, pH 5.95; Step 4: Place the hypocotyl explants prepared in the first step into the infection solution for inducing hairy roots of Melilotus officinalis, evacuate for 5 minutes, incubate with shaking for 30 minutes, and then place on sterile filter paper to dry; after co-cultivation on the co-cultivation medium for 2 days, transfer to the hairy root induction medium to induce hairy roots; replace the induction medium every 15 days. The co-culture medium is SH basic medium + 30g·L -1 Sucrose +7.8g·L -1 Agar + 4 mg L -1 2,4-D+0.5mg·L -1 6-BA+100μmol·L -1 acetosyringone, pH 5.95; The hairy root induction medium is 1 / 2MS basic medium + 15g·L -1 Sucrose +7.8g·L -1 Agar + 400 mg L -1 Timentin + 1mg·L -1 Glufosinate+0.1mg·L -1 IBA, pH 5.95; Step 5: Select the purple-red Clerodendrum leucoderma hairy roots by visual observation, extract DNA using the CTAB method, and perform PCR amplification and sequencing.

Images