Application of miR-205-z in early warning and / or treatment of altitude sickness

Abstract

The invention provides an application of miR-205-z in early warning and / or treatment of altitude sickness. The expression level of miR-205-z in a rat, a pulmonary artery and a pulmonary artery endothelial cell in a simulated plateau environment is increased, and proliferation and migration of HPAECs can be remarkably inhibited and apoptosis of the HPAECs can be promoted by inhibiting the expression level of miR-205-z. Therefore, the miR-205-z can be used as a diagnosis or treatment target of the altitude sickness.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to the application of miR-205-z in products for early warning and / or treatment of altitude sickness. Background Art

[0002] Developing renewable energy such as hydropower, wind power, and solar energy in high-altitude areas is an important measure to take the path of green development. A large number of workers have flocked to the plateau area. Due to its natural conditions such as lack of oxygen and low pressure, if they are not prevented, it is very easy to cause altitude sickness, which seriously endangers the physical and mental health of construction workers. Plateau hypoxia can cause a series of clinical syndromes in the human body within a few hours to a few days, including headaches, nausea, loss of appetite, fatigue, dizziness, and sleep disorders.

[0003] Altitude sickness is a disease caused by a series of physiological and pathological changes and compensatory adaptation changes caused by acute or chronic exposure to the hypoxic environment of the plateau. Among them, acute altitude sickness develops rapidly and is likely to develop into life-threatening diseases such as high-altitude pulmonary edema and high-altitude cerebral edema if not properly treated. Chronic altitude sickness, if not taken seriously, will cause damage to the patient's various systems.

[0004] MiR-205-z is a microRNA located on chromosome 1 with a total length of 24 bp. Currently, there is no report in the prior art that miR-205-z is related to altitude sickness and that miR-205-z is used to warn and prevent altitude sickness. In view of this, the present invention is proposed. Summary of the invention

[0005] The first aspect of the present invention provides the use of miR-205-z in the preparation of products for early warning and / or treatment of altitude sickness.

[0006] Preferably, miR-205-z is used as a marker in the preparation of products for early warning and / or diagnosis of altitude sickness.

[0007] Preferably, the miR-205-z inhibitor is used in the preparation of a product for treating and / or preventing altitude sickness.

[0008] The miR-205-z is located on chromosome 1 and has a total length of 24 bp.

[0009] The nucleotide sequence of miR-205-z is 5'-TCCTTCATTCCACCGGAGTCTGAA-3' (SEQ ID NO: 1).

[0010] The miR-205-z is miR-205-z in the pulmonary artery or cells thereof.

[0011] Preferably, the cells are pulmonary artery endothelial cells.

[0012] The product for early warning and / or diagnosis of altitude sickness includes a reagent for detecting the expression level of miR-205-z.

[0013] Preferably, the detection of miR-205-z can adopt polymerase chain reaction (PCR), Southern blot hybridization, Northern blot hybridization, dot hybridization, fluorescence in situ hybridization (FISH), DNA microarray, high-throughput sequencing platform, chip detection, etc., especially PCR method, such as real-time fluorescence quantitative PCR method, constant temperature amplification technology (rolling circle nucleic acid amplification, loop-mediated isothermal amplification, chain replacement amplification, etc.).

[0014] The detection of miR-205-z includes detecting the expression level of miR-205-z in the pulmonary artery or its cells, preferably including extracting RNA in the pulmonary artery or its cells, reverse transcribing it into cDNA, and then performing PCR.

[0015] wherein the pulmonary artery or cells are derived from a subject.

[0016] Preferably, the reagents for detecting the expression level of miR-205-z include reagents required for reverse transcription, reagents required for PCR, reagents required for sequencing, reagents required for mass spectrometry and / or buffer.

[0017] Preferably, the reagents for detecting the expression level of miR-205-z include but are not limited to primers, probes, and the like.

[0018] The product for warning and / or diagnosing altitude sickness may be a diagnostic kit, a sequencing platform or a chip, etc.

[0019] The early warning and / or diagnosis of altitude sickness comprises detecting the expression level of miR-205-z in the pulmonary artery or cells thereof.

[0020] Preferably, compared with a non-altitude disease patient or a threshold value, the expression level is significantly increased, indicating that the patient is a patient with altitude disease or has a high probability of suffering from altitude disease.

[0021] The product for treating and / or preventing altitude sickness includes a miR-205-z inhibitor.

[0022] In some embodiments, the miR-205-z inhibitor is siRNA, and its sequence is: 5'-UUCAGACUCCGGUGGAAUGAAGGA-3' (SEQ ID NO: 2).

[0023] The miR-205-z inhibitor is an agent that reduces the expression level of miR-205-z or an agent that reduces the function of miR-205-z.

[0024] Preferably, the miR-205-z inhibitor is a small molecule compound, nucleic acid, protein, polypeptide, antibody, traditional Chinese medicine or its extract, interfering RNA or a reagent required for knocking out miR-205-z.

[0025] In some specific embodiments, the miR-205-z inhibitor is selected from an agent that knocks out or knocks down miR-205-z, preferably an interfering RNA.

[0026] The interfering RNA includes but is not limited to one or a combination of two or more of siRNA, dsRNA, shRNA, aiRNA or miRNA, preferably siRNA.

[0027] The method for treating and / or preventing altitude sickness is a medicine.

[0028] The drug comprises a miR-205-z inhibitor and pharmaceutically acceptable excipients.

[0029] Preferably, the pharmaceutically acceptable excipients include, but are not limited to, one or more of excipients, diluents, wetting agents, fillers, binders, lubricants, disintegrants, antioxidants, buffers, suspending agents, solubilizers, thickeners, stabilizers, flavoring agents and preservatives.

[0030] The drug can be administered by any suitable route, such as enteral administration (e.g. oral) or parenteral administration (e.g. intravenous, intramuscular, subcutaneous, intradermal, intraorgan, intranasal, intraocular, instillation, intracerebral, intrathecal, transdermal, intrarectal, etc.).

[0031] The drug can be in any suitable dosage form, such as a dosage form for gastrointestinal administration or a dosage form for parenteral administration, preferably including but not limited to tablets, pills, powders, granules, capsules, lozenges, syrups, liquids, emulsions, microemulsions, suspensions, injections, sprays, aerosols, powder sprays, lotions, ointments, plasters, pastes, patches, eye drops, nasal drops, sublingual tablets, suppositories, effervescent tablets, pills, gels, etc.

[0032] The various dosage forms of the drug can be prepared according to conventional production methods in the pharmaceutical field.

[0033] The drug may contain the miR-205-z inhibitor in a weight ratio of 0.01-99.5% (specifically, 0.01%, 0.1%, 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 99.5%).

[0034] The treatment and / or prevention of altitude sickness comprises reducing the expression level of miR-205-z in the pulmonary artery or cells thereof.

[0035] Preferably, a miR-205-z inhibitor or a cell or drug that reduces the expression level of miR-205-z is administered to a subject in need thereof.

[0036] The altitude sickness is an altitude sickness produced in a plateau environment.

[0037] Preferably, the plateau environment is at an altitude of more than 2000m, more than 3000m, more than 4000m, more than 5000m or more than 5500m. Preferably, the plateau environment is at an altitude of 2000-8000m, more preferably, the plateau environment is at an altitude of 4000-6500m.

[0038] The plateau environment has low pressure and low oxygen conditions.

[0039] The altitude sickness may be acute altitude sickness or chronic altitude sickness.

[0040] The acute mountain sickness includes, but is not limited to, high altitude coma, high altitude cerebral edema, high altitude pulmonary edema, high altitude retinal hemorrhage, or a mixed disease in which abnormal brain and lung symptoms coexist.

[0041] The chronic altitude sickness includes, but is not limited to, altitude heart disease, altitude polycythemia, altitude hypertension, altitude hypotension, altitude heart disease, and a mixed disease in which altitude polycythemia coexists.

[0042] In some embodiments, the altitude sickness is pulmonary hypertension.

[0043] In some embodiments, the altitude sickness is altitude heart disease.

[0044] In some embodiments, the altitude sickness is pulmonary hypertension, ventricular hypertrophy (preferably right ventricular hypertrophy) or heart failure.

[0045] The heart failure mentioned herein refers to heart failure with reduced ejection fraction (HFrEF, LVEF<40%).

[0046] In a second aspect, cells, tissues or organs with reduced expression levels of miR-205-z are provided.

[0047] The cells are pulmonary artery endothelial cells.

[0048] The tissue is lung tissue.

[0049] The organ is the lung.

[0050] The expression level of miR-205-z in the cell, tissue or organ is reduced, preferably knocked out or knocked down.

[0051] In a third aspect, a method for constructing cells, tissues or organs that reduce the expression level of miR-205-z is provided.

[0052] The construction method comprises knocking out or knocking down miR-205-z in cells, tissues or organs.

[0053] Preferably, the miR-205-z inhibitor is introduced into a cell, tissue or organ.

[0054] In some embodiments, siRNA targeting miR-205-z is introduced into a cell, tissue or organ.

[0055] In a fourth aspect, a diagnostic kit is provided.

[0056] The diagnostic kit includes a reagent for detecting miR-205-z.

[0057] The diagnostic kit can diagnose or warn of altitude sickness.

[0058] In a fifth aspect, a method for warning and / or diagnosing altitude sickness is provided.

[0059] The method comprises detecting miR-205-z, preferably detecting the expression level of miR-205-z. Further preferably, detecting miR-205-z in the pulmonary artery or cells thereof.

[0060] The detection method can adopt polymerase chain reaction (PCR), Southern blot hybridization, Northern blot hybridization, dot hybridization, fluorescence in situ hybridization (FISH), DNA microarray, high-throughput sequencing platform, chip detection, etc., especially PCR method, such as real-time fluorescence quantitative PCR method, constant temperature amplification technology (rolling circle nucleic acid amplification, loop-mediated isothermal amplification, chain displacement amplification, etc.).

[0061] In some embodiments, the method comprises extracting RNA from the pulmonary artery or cells thereof, reverse transcribing the RNA into cDNA, and then performing PCR.

[0062] The method comprises performing diagnosis using the diagnostic kit.

[0063] Preferably, compared with a non-altitude disease patient or a threshold value, the expression level is significantly increased, indicating that the patient is a patient with altitude disease or has a high probability of suffering from altitude disease.

[0064] In a sixth aspect, a miR-205-z inhibitor is provided.

[0065] The miR-205-z inhibitor is a small molecule compound, nucleic acid, protein, polypeptide, antibody, traditional Chinese medicine or its extract, interfering RNA or a reagent required for knocking out miR-205-z.

[0066] Preferably, the miR-205-z inhibitor is siRNA, and the sequence of the siRNA is shown in SEQ ID NO:2.

[0067] In a seventh aspect, a drug for treating and / or preventing altitude sickness is provided.

[0068] The drug includes a miR-205-z inhibitor.

[0069] Preferably, a pharmaceutically acceptable excipient is also included.

[0070] The drug is for human use or veterinary use.

[0071] In an eighth aspect, a method for treating and / or preventing altitude sickness is provided.

[0072] The method comprises administering the miR-205-z inhibitor or the cell or the drug that reduces the expression level of miR-205-z to a subject in need thereof.

[0073] The method comprises introducing a miR-205-z inhibitor or a cell or drug that reduces the expression level of miR-205-z into a subject.

[0074] In some embodiments, an inhibitor (preferably interfering RNA) targeting miR-205-z is administered to a subject in need thereof.

[0075] The administration method can be enteral administration (e.g. oral) or parenteral administration (e.g. intravenous, intramuscular, subcutaneous, intradermal, intraorgan, intranasal, intraocular, instillation, intracerebral, intrathecal, transdermal, intrarectal, etc.) routes.

[0076] Ninthly, a method for altitude tolerance is provided.

[0077] The method comprises administering the miR-205-z inhibitor or the cell or the drug that reduces the expression level of miR-205-z to a subject in need thereof.

[0078] The method comprises introducing a miR-205-z inhibitor or a cell or drug that reduces the expression level of miR-205-z into a subject.

[0079] In some embodiments, an inhibitor (preferably interfering RNA) targeting miR-205-z is administered to a subject in need thereof.

[0080] The administration method can be enteral administration (e.g. oral) or parenteral administration (e.g. intravenous, intramuscular, subcutaneous, intradermal, intraorgan, intranasal, intraocular, instillation, intracerebral, intrathecal, transdermal, intrarectal, etc.) routes.

[0081] The term "diagnosis" as used herein refers to finding out whether a patient has had a disease or condition in the past or at the time of diagnosis, or to finding out the progression of a disease.

[0082] The "early warning" mentioned in the present invention refers to finding out whether the patient is likely to get sick or have symptoms in the future, or finding out the possible future progression of the disease.

[0083] As used herein, "treating" means slowing, interrupting, preventing, controlling, stopping, alleviating, or reversing the progression or severity of a sign, symptom, disorder, condition, or disease after the disease has begun to develop, but does not necessarily involve the complete elimination of all disease-related signs, symptoms, conditions, or disorders.

[0084] The term "prevention" as used herein refers to a method implemented to prevent or delay the occurrence of a disease, disorder or symptom in an organism.

[0085] The "effective amount" of the present invention refers to the amount or dosage of the inhibitor or drug of the present invention that provides the desired treatment or prevention after single or multiple doses are administered to a subject.

[0086] The "subject" described in the present invention can be a human or non-human mammal, or a cell, tissue or organ of a human or non-human mammal, and the non-human mammal can be a wild animal, a zoo animal, an economic animal, a pet, an experimental animal, etc. Preferably, the non-human mammal includes but is not limited to pigs, cattle, sheep, horses, donkeys, foxes, raccoon dogs, minks, camels, dogs, cats, rabbits, mice (such as rats, mice, guinea pigs, hamsters, gerbils, chinchillas, squirrels) or monkeys, etc. BRIEF DESCRIPTION OF THE DRAWINGS

[0087] The embodiments of the present invention are described in detail below with reference to the accompanying drawings, wherein:

[0088] Figure 1 : Model construction results, where A is the result of red blood cell (RBCs) counting, B is the result of hemoglobin (HGB) concentration, C is the result of hematocrit (HCT), D is the result of mean pulmonary artery pressure (mPAP), E is the result of right ventricular systolic pressure (RVSP), F is the result of right ventricular hypertrophy index (RVHI), ns means the difference is not significant, * means p<0.05, ** means p<0.01, *** means p<0.001.

[0089] Figure 2: The results of immunofluorescence and immunohistochemical staining were used to evaluate the thickness of arterial media, the degree of vascular muscularization and the cell proliferation rate.

[0090] Figure 3 : Relative expression level of miR-205-z in rat pulmonary artery under a simulated high altitude environment of 5500 meters, *** represents p<0.001.

[0091] Figure 4 : HPAECs showed significant proliferation after culture under low-pressure and low-oxygen conditions, among which Nor was the normobaric and normoxic group, Hyp was the low-pressure and low-oxygen group (model group), and β-actin was the internal reference.

[0092] Figure 5 : Relative expression level of miR-205-z in HPAECs under simulated high-altitude hypobaric and hypoxic environment, *** represents p < 0.001.

[0093] Figure 6 : Effects of knocking down miR-205-z on the proliferation of HPAECs by simulating the low-pressure and low-oxygen environment at high altitude, where A is the WB result; B is the statistical result, β-actin is the internal reference, Nor is the normobaric and normoxic group, Hyp+NC is the negative control low-pressure and low-oxygen group, Hyp+miR-205inhibitor is the low-pressure and low-oxygen group with the addition of miR-205-z inhibitor, * represents p<0.05, ** represents p<0.01.

[0094] Fig. 7A : Effect of knocking down miR-205-z on apoptosis of HPAECs, where β-actin was the internal reference, Nor was the normobaric and normoxic group, Hyp+NC was the negative control hypobaric and hypoxic group, and Hyp+miR-205inhibitor was the hypobaric and hypoxic group with the addition of miR-205-z inhibitor.

[0095] Figure 7B : Effect of knocking down miR-205-z on the relative expression of Caspase 3, where Nor is the normobaric and normoxic group, Hyp+NC is the negative control hypobaric and hypoxic group, and Hyp+miR-205inhibitor is the hypobaric and hypoxic group with the addition of miR-205-z inhibitor, * represents p<0.05.

[0096] Figure 7C : Effect of knocking down miR-205-z on the relative expression of Caspase 9, where Nor is the normobaric and normoxic group, Hyp+NC is the negative control hypobaric and hypoxic group, and Hyp+miR-205inhibitor is the hypobaric and hypoxic group with the addition of miR-205-z inhibitor, ** represents p<0.01, *** represents p<0.001.

[0097] Figure 8 : Photographs (A) and migration index (B) of HPAECs migration after knockdown of miR-205-z, where Nor is the normobaric and normoxic group, Hyp+NC is the negative control hypobaric and hypoxic group, and Hyp+miR-205inhibitor is the hypobaric and hypoxic group with the addition of miR-205-z inhibitor, *** represents p<0.001. DETAILED DESCRIPTION

[0098] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, not all. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention.

[0099] Animals used in the examples: SD rats, about 250 g, male, clean grade, purchased from Beijing Weitonglihua Experimental Animal Co., Ltd., license number: SCXK (Beijing) 2016-0006.

[0100] Cells used in the examples: pulmonary artery endothelial cells (HPAECs), human cells, purchased from Shanghai Guandao Biotechnology Co., Ltd.

[0101] In the embodiment, the hypobaric oxygen chamber is used for feeding: feeding with complete nutritional feed, the room temperature is 22-25° C., and the humidity is 30%-50%.

[0102] The instruments used in the examples are: small animal hypobaric oxygen chamber (Binglun Hyperbaric Oxygen Chamber Co., Ltd.); small animal ventilator (kent scientific); multifunctional physiological instrument (Millar); small animal ultrasound (Visual Sonics Inc); personalized cell precision control system (Avatar); Q-PCR instrument (Bio-Rad).

[0103] In the embodiment, the pulmonary artery of the animal was extracted: 3% sodium pentobarbital, 0.2 ml / 100 g, was intraperitoneally injected into the rat to anesthetize it, and ultrasonic detection was performed. The rat was then fixed on the operating table in a supine position, the trachea was cut, the ventilator was connected, the chest was opened, the heart was exposed, the catheter was inserted into the right ventricle, and the right heart catheter was tested. The rat was killed, the heart was taken out, the atrial tissue and attached fat were removed, the left and right ventricles were separated, the lung tissue was taken, the water was absorbed by filter paper, and the weights were respectively weighed, and the pulmonary artery was separated.

[0104] Statistical methods: All data were expressed as x±s, and the inter-group comparisons were performed using one-way analysis of variance. p<0.05 was considered statistically significant, and SPSS19.0 software package was used for statistical analysis.

[0105] Example 1: Marker screening

[0106] Through KEGG enrichment analysis, we selected mRNAs differentially expressed in HIF-1, PI3K-Akt, Wnt and other signaling pathways, performed lncRNA-mRNA co-expression analysis based on the data, predicted miRNA-lncRNA and miRNA-mRNA relationship pairs according to the database, constructed a ceRNA network, and screened the differential miRNA-MiR-205-z.

[0107] Example 2: Animal experiment on miR-205-z expression level

[0108] 1. Experimental design

[0109] Twenty rats were randomly divided into two groups, with 10 rats in each group. One group was placed in an experimental cabin with the pressure adjusted to 380 mmHg to simulate the plateau environment of 5,500 meters above sea level (model group). At the same time, the rats were kept in a 12:12 hour day and night alternation. A different group of rats was placed in the same room under normal pressure and normoxic environment and raised for 28 days (control group).

[0110] The results are as follows Figure 1-2 As shown, rats in the model group developed symptoms of pulmonary hypertension, including increased hemoglobin, increased pulmonary circulation-right heart pressure, right ventricular hypertrophy, and arteriolar vascular remodeling. The details are as follows:

[0111] The red blood cells (RBCs) were counted and the hemoglobin (HGB) concentration was tested by routine blood tests. The RBCs count, HGB concentration and HCT value of rats increased with the extension of low pressure and hypoxia time. The RBCs count began to increase significantly on the 14th day (p<0.001), and the HGB and HCT values ​​increased significantly on the third day. Figure 1 AC.

[0112] RVSP and mPAP were measured by hemodynamics. Figure 1 As shown in DE, the RVSP and mPAP of rats raised in a low-pressure and low-oxygen environment increased over time, and the mPAP on the 28th day was 32.1976±1.2643 mmHg (greater than 20 mHg), indicating that the pulmonary hypertension model was successfully established.

[0113] Furthermore, the degree of right ventricular hypertrophy was evaluated by measuring the right ventricular hypertrophy index (RVHI) by cardiac weighing. Figure 1 F, The RVHI of rats increased with the extension of hypobaric and hypoxic time, and significant differences began to appear on the 7th day.

[0114] In addition, immunofluorescence and immunohistochemical staining were used to evaluate the arterial media thickness (MWT), vascular muscularization, and cell proliferation rate. Compared with day 0, the MWT, vascular muscularization, and cell proliferation rate of rats fed in a hypobaric and hypoxic environment for 21 days were significantly increased (P<0.001). Figure 2 shown.

[0115] 2. Expression level

[0116] Aspirate the animal tissue block, wash the tissue twice with ice-cold PBS, extract RNA according to the requirements of the RNA extraction kit, and measure the concentration. According to the requirements of the RNA reverse transcription kit, reverse transcribe the RNA into cDNA and store it at -80℃. After diluting the cDNA 10 times, establish a 20ul system according to the requirements of the Q-PCR kit, set up the standard reaction mode and dissolution curve, and run the program.

[0117] The results are as follows Figure 3 As shown, the expression of miR-205-z in the pulmonary artery of the model group rats was significantly upregulated after being raised in a low-pressure and low-oxygen environment for 28 days, and the difference was significant.

[0118] Example 3: Cell experiment on miR-205-z expression level

[0119] 1. Experimental design

[0120] Pulmonary artery endothelial cells were cultured in DMEM medium containing 10% fetal bovine serum and randomly divided into two groups. One group was placed in an individualized cell precision control system to adjust the oxygen concentration to 1% and the oxygen partial pressure to 0.6PSI to simulate the low-pressure and low-oxygen environment of the plateau (model group), and a different group of cells was placed in a normal-pressure and normoxic CO2 cell culture incubator and cultured for 24 hours (control group).

[0121] 2. Detection method

[0122] Aspirate the cell culture medium, wash the cells twice with ice-cold PBS, extract RNA according to the requirements of the RNA extraction kit, and measure the concentration. According to the requirements of the RNA reverse transcription kit, reverse transcribe the RNA into cDNA and store it at -80°C. After diluting the cDNA 10 times, establish a 20ul system according to the requirements of the Q-PCR kit, set up the standard reaction mode and dissolution curve, and run the program.

[0123] 3. Results

[0124] After HPAEC cells were treated with hypotension and hypoxia for 24 hours, PCNA protein expression increased significantly, indicating that HPAEC cells proliferated significantly, that is, pulmonary hypertension occurred. Figure 4 shown.

[0125] The differential expression results are as follows Figure 5 As shown, after HPAECs cells were cultured in a low-pressure and low-oxygen environment for 24 hours, the expression of miR-205-z in the HPAECs cells of the model group was significantly upregulated, and the difference was significant.

[0126] Example 4: Effects of knocking down miR-205-z on HPAECs

[0127] 1. Experimental design

[0128] 1) Design an inhibitor to specifically knock down the expression level of miR-205-z

[0129] The miR-205-z inhibitor is siRNA, and its sequence is: 5'-UUCAGACUCCGGUGGAAUGAAGGA-3' (SEQ ID NO: 2).

[0130] 2) Pulmonary artery endothelial cells (HPAECs) were cultured in DMEM medium containing 10% fetal bovine serum and randomly divided into three groups. The first group (Nor: normobaric and normoxic group) was cultured in a normobaric and normoxic CO2 cell culture incubator as a control; the second group (Hyp+NC: negative control group) was transfected with irrelevant sequences in HPAECs cells for 48 hours, and then placed in an individualized cell precision control system to adjust the oxygen concentration to 1% and the oxygen partial pressure to 0.6PSI to simulate the low-pressure and low-oxygen environment of the plateau, and cultured for 24 hours. The negative control sequence was: CAGUACUUUUUGUGUAGUACAAA (SEQ ID NO: 3); the third group (Hyp+miR-205inhibitor) was transfected with the designed specific miR-205-z inhibitor (SEQ ID NO: 2) in HPAECs cells for 48 hours, and then placed in an individualized cell precision control system to adjust the oxygen concentration to 1% and the oxygen partial pressure to 0.6PSI to simulate the low-pressure and low-oxygen environment of the plateau, and cultured for 24 hours.

[0131] 2. Detection method

[0132] 1) Proliferation detection of the expression level of cell cycle-related protein PCNA;

[0133] 2) Migration detection method

[0134] After each group of HPAECs cells were cultured, the tip of the pipette was used to draw lines perpendicular to the cell plate, the cells were washed 3 times with PBS, and cell culture medium was added. Samples were taken at 0 and 24 h, and photos were taken. After opening the pictures with Image J software, the cell migration area was calculated.

[0135] 3) Apoptosis detection: the expression levels of Caspase3 and Caspase9.

[0136] 3. Results

[0137] like Figure 6-8 As shown, Figure 6 It showed that knocking down miR-205-z significantly inhibited the proliferation of HPAECs; Fig. 7A -C results showed that knockdown of miR-205-z promoted the apoptosis of HPAECs; Figure 8 The results showed that knockdown of miR-205-z significantly inhibited HPAECs cell migration.

[0138] The preferred embodiments of the present invention are described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the technical concept of the present invention, a variety of simple modifications can be made to the technical solution of the present invention, and these simple modifications all belong to the protection scope of the present invention.

[0139] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present invention will not further describe various possible combinations.

Claims

1. Application of miR-205-z in the preparation of products for early warning and / or treatment of altitude sickness.

2. The use according to claim 1, characterized in that: The nucleotide sequence of miR-205-z is 5'-TCCTTCATTCCACCG GAGTCTGAA-3' (SEQ ID NO: 1).

3. The use according to claim 1, characterized in that: The miR-205-z is miR-205-z in the pulmonary artery or its cells; Preferably, the cells are pulmonary artery endothelial cells.

4. The use according to claim 1, characterized in that: The product for treating altitude sickness includes a miR-205-z inhibitor, and the product for warning of altitude sickness includes a reagent for detecting the expression level of miR-205-z.

5. The use according to claim 4, characterized in that: The reagents for detecting the expression level of miR-205-z include reagents required for reverse transcription, reagents required for PCR, reagents required for sequencing, reagents required for mass spectrometry and / or buffer.

6. The use according to claim 4, characterized in that: The miR-205-z inhibitor is selected from agents for knocking out or knocking down miR-205-z, preferably interfering RNA, and more preferably, the sequence of the siRNA is as shown in SEQ ID NO:

2.

7. The use according to claim 1, characterized in that: The altitude sickness is an altitude sickness produced in a plateau environment, and the plateau environment is an altitude higher than 2000m. Preferably, the plateau environment is an altitude of 2000-8000m, and more preferably, the plateau environment is an altitude of 4000-6500m, with low pressure and low oxygen conditions.

8. The use according to any one of claims 1 to 7, characterized in that: The altitude sickness is pulmonary hypertension, ventricular hypertrophy or heart failure.

9. The use according to any one of claims 1 to 8, characterized in that: The early warning of altitude sickness includes detecting the expression level of miR-205-z in the pulmonary artery or its cells; the treatment of altitude sickness includes reducing the expression level of miR-205-z in the pulmonary artery or its cells; Preferably, the warning of altitude sickness includes a significant increase in expression level compared with non-altitude sickness or a threshold value, indicating that the patient is an altitude sickness patient or has a high probability of suffering from altitude sickness; Preferably, the treatment of altitude sickness comprises administering a miR-205-z inhibitor or cells that reduce the expression level of miR-205-z to a subject in need thereof.

10. A miR-205-z inhibitor, characterized in that The miR-205-z inhibitor is siRNA, and the sequence of the siRNA is shown in SEQ ID NO:2.

Images