Dextranase fusion modifier SpyCatcher-padex as well as coding gene and application thereof

Abstract

The invention discloses a dextranase fusion modifier SpyCatcher-padex with improved enzymatic activity as well as a coding gene and application of the dextranase fusion modifier SpyCatcher-padex, and belongs to the technical field of biology. According to the dextranase fusion modifier SpyCatcher-padex provided by the invention, a dextranase padex gene (GenBank No.KF999646.1) derived from penicillium asperellum is fused with a SpyCatcher gene segment at the N end in a homologous recombination manner, so that the dextranase fusion modifier SpyCatcher-padex is obtained. The fusion modifier SpyCatcher-padex disclosed by the invention can be used for specifically hydrolyzing an alpha-1, 6 glucosidic bond, and the enzyme activity of the fusion modifier SpyCatcher-padex is 3.21 times that of unmodified padex. The dextranase fusion modifier SpyCatcher-padex obtained by the invention can be applied as a fusion modifier material capable of remarkably improving the activity of enzyme in catalytic degradation of dextran. Meanwhile, the invention can also provide technical reference for further research on dextranase in the aspects of biochemistry and molecular biology.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, relates to enzyme engineering technology, and specifically relates to a dextranase fusion modified body SpyCatcher-padex with improved enzyme activity, a coding gene and an application thereof. Background Art

[0002] Dextranase is a hydrolase that specifically breaks the α-1,6 glycosidic bond of dextran. It decomposes long-chain dextran into lower molecular weight dextran and oligosaccharides through enzymatic reactions. This enzyme is used in the food industry to control the viscosity of sugars, in the pharmaceutical industry to adjust the release characteristics of drugs, and in the preparation of biomaterials to improve the performance of materials. It is of great significance. According to its source, dextranase can be divided into different types, such as bacterial source, fungal source, etc., and each type of enzyme may differ in properties and activity. In bioengineering and molecular biology research, dextranase, as a tool enzyme, can be used to construct and modify sugar chains to achieve specific functions or characteristics.

[0003] In traditional industry, the production of low molecular weight dextran usually adopts the acid hydrolysis process, which needs to be carried out in a high energy consumption environment, which does not meet the requirements of green environmental protection. In addition, the randomness of the acid hydrolysis process will cause the molecular weight of the product to be non-concentrated and non-uniform, affecting product quality and yield.

[0004] The catalytic application of dextranase can effectively solve the above problems. The enzyme can specifically catalyze and degrade high molecular weight dextran, which is suitable for the application of biopolysaccharides in the field of medicine. The patent of publication number CN116179386A realizes the application of high-level extracellular expression dextranase through system transformation promoter, signal peptide and co-expression molecular chaperone. Publication number CN115786308B realizes the molecular transformation of wild enzyme by the method of gene mutation, and the catalytic efficiency and stability of mutant enzyme S326V are significantly improved. The research on microbial dextranase at home and abroad has achieved certain results, but still cannot meet the industrial production needs, and a more active dextranase is urgently needed. Summary of the invention

[0005] The object of the present invention is to provide a dextranase fusion modified SpyCatcher-padex with higher enzyme activity and its encoding gene and application. Specifically, the present invention is implemented by the following technical scheme:

[0006] The first object of the present invention is to provide a dextranase fusion modified body SpyCatcher-padex, which is obtained by fusing the SpyCatcher gene fragment at the N-terminus of the dextranase padex gene (GenBank No. KF999646.1) from Penicillium aculeatus through homologous recombination, and its nucleotide sequence is shown in SEQ ID NO.7.

[0007] The second object of the present invention is to provide a gene encoding the above fusion modified SpyCatcher-padex.

[0008] The third object of the present invention is to provide a recombinant expression plasmid containing a gene encoding a fusion transformant SpyCatcher-padex.

[0009] Preferably, the expression plasmid is the expression vector pPICZα-A.

[0010] The fourth object of the present invention is to provide a host expression cell containing the above recombinant expression plasmid. The host expression cell is Pichia pastoris.

[0011] The fifth object of the present invention is to provide a genetically engineered bacterium SpyCatcher-padex, which is obtained by culturing the host expression cell described above and screening for bleomycin resistance. The genetically engineered bacterium SpyCatcher-padex is classified and named Pichia pastoris, with a deposit number of CGMCC No. 32605, and is deposited in the General Microbiological Center of the China Microbiological Culture Collection Administration, with a deposit address of No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, and a deposit date of November 13, 2024.

[0012] The sixth object of the present invention is to provide a method for obtaining a gene encoding a fusion transformant SpyCatcher-padex, which comprises the following steps:

[0013] (1) The SpyCatcher gene (PDB ID: 4MLI) was synthesized according to the gene sequence provided by NCBI and synthesized by Suzhou Anshengda Biotechnology Co., Ltd. The nucleotide sequence of the gene is shown in SEQ ID NO.1;

[0014] (2) Using the SpyCatcher gene as a template, the nucleotide sequence of the gene is shown in SEQ ID NO.1, and using the sequences shown in SEQ ID NO.2 and SEQ ID NO.3 as primers to perform PCR to obtain a first PCR product;

[0015] (3) Using the dextranase padex gene of Penicillium aculeatus as a template and the sequences shown in SEQ ID NO.4 and SEQ ID NO.5 as primers, PCR was performed to obtain a second PCR product, wherein the nucleotide sequence of the dextranase padex gene of Penicillium aculeatus is shown in SEQ ID NO.6;

[0016] (4) The first and second PCR products were digested with DMT enzyme, then recovered and purified again by gel recovery, and homologous recombination was performed at a ratio of 2:1 between the first PCR product and the second PCR product. A single colony was selected to obtain the coding gene of the fusion transformant SpyCatcher-padex, the nucleotide sequence of which is shown in SEQ ID NO.7.

[0017] The present invention does not specifically limit the PCR system, and a conventional PCR system in the art can be used. For example, the PCR program of steps (2) and (3) can be: 94°C pre-denaturation for 3 min; 94°C denaturation for 5 s, 60°C annealing for 15 s, 72°C extension for 2 min, 35 cycles; 72°C extension for 5 min.

[0018] The seventh object of the present invention is that the fusion modified SpyCatcher-padex can be used in catalyzing the degradation of dextran. The fusion modified SpyCatcher-padex can specifically hydrolyze α-1,6 glycosidic bonds. Under 35°C, with dextran T70 as the enzymatic substrate, the reaction is 3h, and the molecular weight of the hydrolyzate is 6000Da, and the molecular weight distribution is concentrated. The enzyme activity is 3-4 times that of the unmodified padex. After incubation at 40°C for 1h, the enzyme activity is 98.04% of the initial activity.

[0019] The nucleotide sequences involved in the present invention are as follows:

[0020] SEQ ID NO.1

[0021] ATGGCGATGGTGGATACCCTGAGCGGCCTGAGCAGCGAACAAGGTCAGAGCGGCGATATGACCATTGAAGAGGATGATGAAACCCATATTAAATTTAGCAAACGCGATGAAGATGATGAAGAACTGGCGGGCGCGACCATGGAACTGCGCGATAGCAGCGGCGAAACCATTAGCACCTGGATTAGCGATGGCGAAGTGAAAGATTTTTATCTGTATCCGGGCAAATATACCTTTGTGGAAACCGCGGCGCCGGATGGCTATGAAGTGGCGACCGCGATTACCTTTACCGTGAACGAAGAAGGCGAAGTGACCGTGGATGGCAAAGCGACCAAAGGCGATGCGCATATT

[0022] SEQ ID NO.2

[0023] 5’--TCGAGAAAAGAGAGGCTGAAGCTGAATTCTTCGAAACGATGGCGATGGTGGATACCCTGAGC--3’

[0024] SEQ ID NO.3

[0025] 5’--GAGCCAAAGTCAACAACTTCAACATAGTAGCGCCGCTGCCGCCGCTGCCAATATGCGCATCG--3’

[0026] SEQ ID NO.4

[0027] 5’--GAATTCAGCTTCAGCCTCTCTTTTCTCGA--3’

[0028] SEQ ID NO.5

[0029] 5’--GCTACTATGTTGAAGTTGTTGACTTTGGCT--3’

[0030] SEQ ID NO.6

[0031]

[0032] SEQ ID NO.7

[0033]

[0034] At present, there is no relevant report on the research of dextranase by fusion transformation to improve enzyme catalytic activity. The present invention obtains dextranase fusion transformation SpyCatcher-padex by fusing SpyCatcher gene at the N-terminus, obtains dextranase and its fusion transformation SpyCatcher-padex protein by eukaryotic expression, and finds that the fusion transformation SpyCatcher-padex enzyme activity is significantly improved by enzyme activity detection. The dextranase fusion transformation SpyCatcher-padex obtained by the present invention can be used as a fusion transformation material application that can significantly improve the activity of enzyme-catalyzed degradation of dextran. At the same time, the present invention can also provide technical reference for further research on dextranase in biochemistry and molecular biology. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 This is a diagram of the construction of the SpyCatcher-padex plasmid in an embodiment of the present invention;

[0036] Figure 2 is the PCR diagram of the fusion transformant SpyCatcher-padex in the embodiment of the present invention;

[0037] Figure 3 is an SDS-PAGE image of the fusion transformed SpyCatcher-padex protein in an embodiment of the present invention;

[0038] Figure 4 This is a comparison chart of enzyme activity determination in the embodiments of the present invention;

[0039] Figure 5 is a temperature stability comparison diagram at 40°C in an embodiment of the present invention;

[0040] Figure 6 It is a HPLC diagram of catalytic dextran hydrolysis in an embodiment of the present invention, which is a high performance liquid chromatogram. In the diagram, the ordinate represents the peak height, that is, the content, and the abscissa represents the peak time and also represents the molecular weight, and the molecular weight has been indicated. DETAILED DESCRIPTION

[0041] The following embodiments are further descriptions of the content of the present invention as an explanation of the technical content of the present invention, but the essential content of the present invention is not limited to the following embodiments. Ordinary technicians in this field can and should know that any simple changes or replacements based on the essential spirit of the present invention should fall within the scope of protection required by the present invention.

[0042] The fusion modified body SpyCatcher-padex of the dextranase of the present invention has a nucleotide sequence as shown in SEQ ID NO.7. The fusion modified body SpyCatcher-padex of the present invention is a fusion of the SpyCatcher gene sequence at the N-terminus of the padex nucleotide sequence; the nucleotide sequence of the padex is shown in SEQ ID NO.6. The present invention does not specifically limit the method of the fusion, and homologous recombination is preferred. The padex gene of the present invention is derived from Penicillium aculeatus. The method for constructing the fusion modified body SpyCatcher-padex of the dextranase of the present invention, the enzyme activity detection and application are described in detail below.

[0043] Example 1

[0044] (1) Construct pPICZα-A-SpyCatcher-padex plasmid, such as Figure 1 As shown, the SpyCatcher-padex dextranase gene SpyCatcher-padex was obtained by gene PCR and homologous recombination. The SpyCatcher gene was used as a template and the SpyCatcher gene was synthesized according to the gene sequence provided by NCBI (PDB ID: 4MLI). It was synthesized by Suzhou Anshengda Biotechnology Co., Ltd. The nucleotide sequence of the gene is shown in SEQ ID NO.1. PCR was performed using the sequences shown in SEQ ID NO.2 and SEQID NO.3 as primers to obtain the first PCR product. The nucleic acid electrophoresis diagram is shown in Figure 2 a;

[0045] (2) Using the dextranase padex gene of Penicillium aculeatus (GenBank No. KF999646.1) as a template and the sequences shown in SEQ ID NO.4 and SEQ ID NO.5 as primers, PCR was performed to linearize the padex gene to obtain a second PCR product. The nucleotide sequence of the dextranase padex gene of Penicillium aculeatus is shown in SEQ ID NO.6, and the nucleic acid electrophoresis diagram is shown in Figure 2 b;

[0046] The PCR conditions were as follows: 94°C pre-denaturation for 3 min; 94°C denaturation for 5 s, 60°C annealing for 15 s, 72°C extension for 2 min, 35 cycles; 72°C extension for 5 min. After the PCR reaction was completed, the results were detected by agarose gel electrophoresis.

[0047] (3) The first and second PCR products are digested with DMT enzyme respectively, and then the first and second PCR amplification products are recovered from gel, and homologous recombination is performed to construct a recombinant plasmid. The reaction system selected for the connection of the present invention is a homologous recombination system. Preferably: purified first PCR product: 2 μL; purified second PCR product: 1 μL; 2×Basic Assembly PremixMix 5 μL, and the reaction system is filled up to 10 μL with ultrapure water.

[0048] The connection procedure of the present invention is as follows: the above reaction system is gently mixed and placed at 50°C for 30 minutes, and then placed on ice to obtain the connection product. The connection product is transformed into Escherichia coli DH5α competent cells, 500 μL of LLB liquid culture medium is added, and cultured at 37°C, 220rpm for 1 hour, 50 μL of bacterial solution is spread on a solid LLB plate containing 100 μg / mL bleomycin antibiotics, and cultured at 37°C overnight, positive colonies are picked for PCR identification, and the positive bacterial solution is sent to a universal biological sequencing company for sequencing. The correctly sequenced plasmid is linearized using SacⅠ endonuclease and then transformed into Pichia pastoris X33 competent cells.

[0049] (4) Preparation of competent cells of Pichia pastoris X33

[0050] Activate Pichia pastoris X33 strain (purchased from Invitrogen) on YPD plates to obtain single dispersed colonies. Pick a single colony and inoculate it into 5 mL YPD medium, incubate it at 30°C and 250 rpm for 24 hours, then take 1 mL and inoculate it into 50 mL YPD medium, and continue to incubate it under the same conditions for 4 to 6 hours until the OD600 of the bacteria reaches 1.1~1.3. Transfer the bacterial solution to a 50 mL centrifuge tube, centrifuge it at 1500×g for 5 minutes at 4°C, and discard the supernatant. Resuspend the bacteria with 40 mL ice-cold sterile water, centrifuge it at 1500×g for 5 minutes at 4°C, and discard the supernatant. Repeat this step once. Resuspend the bacteria with 10 mL ice-cold 1 M sorbitol solution, centrifuge it at 1500×g for 5 minutes at 4°C, and discard the supernatant. The prepared yeast competent cells are stored in a -80°C refrigerator at low temperature, and are used immediately after preparation to avoid repeated freezing.

[0051] (5) Electric shock conversion

[0052] Thaw the cryopreserved competent cells on ice, let stand for 5-6 minutes until the competent cells are completely thawed, immediately add 10 μL of the linearized recombinant plasmid obtained in step (3), and let stand on ice for about 2 minutes. Preheat the electroporation instrument for 30 minutes in advance, add the competent cells to the electroporation cup, and perform electroporation transformation: voltage 2500V, time 4.5ms, remove the electroporation cup, immediately add 1mL of ice-cold 1M sorbitol solution, rinse the yeast cells in the electroporation cup, and transfer them to a centrifuge tube, and culture at 30°C, 250rpm shaking for 1 hour. The cultured bacteria were centrifuged at 4000xg for 2 minutes, 900 μL of supernatant was removed with a pipette tip, and the remaining culture medium was used to resuspend the bacteria. All the bacteria were spread on a YPD plate containing 100 μg / mL bleomycin resistance, and inverted cultured at 30°C for 3-5 days. The growth of the bacteria on the culture medium was observed to obtain the genetically engineered bacteria SpyCatcher-padex of the fusion transformation, which was classified and named Pichia pastoris, and the preservation number was CGMCC No. 32605. A single colony was selected and cultured in YPD medium at 30°C, 220rpm, and cultured for 24 hours.

[0053] (6) Enrichment culture and methanol induction

[0054] The genetically engineered bacteria SpyCatcher-padex, the fusion transformant cultured in step (5), was inoculated into liquid YPD culture medium at a rate of 0.5%, and cultured at 30°C and 250 r / min for 24 hours. Then, it was inoculated into BMGY culture medium at a ratio of 1%, and cultured under the same conditions for 12-24 hours. The bacteria were collected by centrifugation, and after discarding the culture supernatant, the bacteria were resuspended in BMMY culture medium, and finally cultured on a shaker at 25°C and 250 r / min for 5 days. 1% methanol was added every 24 hours for induction. The induced fermentation bacterial suspension was centrifuged at 0°C and 10000 r / min for 15 minutes, and the supernatant collected was the dextranase fusion transformant SpyCatcher-padex, with an enzyme activity of 150-200 U / mL. Subsequently, protein electrophoresis was performed, and the protein size was 78KDa, that is, dextranase padex 65KDa + SpyCatcher 13KDa. The protein electrophoresis diagram is as follows Figure 3 shown.

[0055] Each liter of the BMGY medium contains: 1% yeast extract powder, 2% peptone, 100 mM sodium phosphate pH 6.0, 1.34% YNB, 4x10 -5% biotin, 1% glycerol. Preparation method: weigh 20g peptone, 10g yeast extract powder, dissolve in water, add 100mL 1M potassium phosphate pH6.0 buffer, add water to 800mL, autoclave at 121℃ for 20min, add 100mL 10% glycerol, 100mL 10xYNB, 2mL 500xB, and the preparation is complete, and package.

[0056] Each liter of the BMMY medium contains the following medium formula: 1% yeast extract, 2% peptone, 100 mM sodium phosphate pH 6.0, 1.34% YNB, 4x10 -5 % biotin (B), 1% methanol. Preparation method: weigh 20g peptone, 10g yeast extract powder, dissolve in water, add 100mL 1M sodium phosphate pH 6.0 buffer, add water to 800mL, autoclave at 121℃ for 20min, add 100mL 10% methanol, 100mL 10xYNB, 2mL 500xB, complete the preparation, and package.

[0057] Preparation of 100 mg / mL Zeocin (bleomycin): Weigh 100 mg of bleomycin and add 1 mL of sterile water. Filter through a 0.22 μm microporous filter to sterilize, and store at -20°C after aliquoting.

[0058] 10xYNB: Weigh 134 g YNB (yeast nitrogen base) and dissolve it in 1000 mL water. Sterilize it by filtering with a 0.22 μm sterile filter. Store at 4°C. The shelf life is 1 year.

[0059] 500xB: Weigh 20 mg of biotin and dissolve it in 100 mL of water. Filter and sterilize using a 0.22 μm sterile filter. It can be stored at 4°C for one year.

[0060] (7) The DNS method was used to detect the enzyme activity.

[0061] Enzyme activity assay

[0062] 1. Preparation of reaction system: Take 400 μL of substrate solution containing 3% dextran T70 and add 100 μL of enzyme solution diluted to an appropriate multiple.

[0063] 2. Temperature-controlled reaction: Keep in a 35°C water bath for 1 hour.

[0064] 3. Terminate the reaction: Add 375 μL DNS to the reaction solution, and then heat in a boiling water bath for 5 minutes.

[0065] 4. Cooling and dilution: After cooling, add 5 mL of distilled water to the system and mix well.

[0066] 5. Photometric determination: Measure the photometric value at 540 nm, using the inactivated enzyme solution as the control group.

[0067] 6. Calculate enzyme activity: Calculate the reducing sugar content in the catalytic system based on the glucose standard curve, and finally calculate the enzyme activity of the sample solution. The enzyme activity unit is defined as: the amount of enzyme required to produce 1 μmol reducing sugar (glucose equivalent) per minute is one enzyme activity unit (U).

[0068] (8) Dextranase padex and dextranase fusion transformant SpyCatcher-padex were catalyzed in 3% T70 substrate solution at 35°C and pH 5.5 for 1 h. The enzyme activity was detected by DNS method. The dextranase activity was taken as 100%. The relative enzyme activity of the dextranase fusion transformant SpyCatcher-padex was calculated. The dextranase padex activity was taken as 100%. Figure 4 The dextranase fusion transformant SpyCatcher-padex has an enzymatic activity 3.21 times that of dextranase padex.

[0069] (9) Dextranase padex and dextranase fusion modified SpyCatcher-padex were incubated at 40°C, samples were taken at different times, and then the enzyme activities were detected to compare the temperature stability of the two at 40°C. Figure 5 It can be seen that the dextranase fusion transformant SpyCatcher-padex was incubated at 40℃ for 1h, with the activity of 0h being 100%, and the enzyme activity was 98.04% of the original enzyme activity, while the dextranase padex was incubated at 40℃ for 1h, and the enzyme activity was 84.67% of the original enzyme activity.

[0070] (10) The dextranase fusion modified SpyCatcher-padex has substrate specificity and can specifically identify and catalyze the cleavage of α-1,6 glycosidic bonds. Under 35°C, dextran T70 was used as the enzymatic substrate and the reaction was carried out for 3 hours. The molecular weight of the hydrolysis product was 6000Da, and the molecular weight distribution was concentrated. SpyCatcher-padex can efficiently catalyze the hydrolysis of high molecular weight dextran and can be used in industrial production. The HPLC chart is shown in the figure below. Figure 6 .

[0071] The above-mentioned determination experiments show that the dextranase fusion modification constructed by the present invention has higher activity, stability and specific catalytic properties, can be widely used in food processing, drug synthesis and other fields, and has high commercial value.

[0072] It should be noted that the above-mentioned technical contents of the present invention are only for explanation and clarification to enable those skilled in the art to understand the technical essence of the present invention, so the technical contents are not used to limit the substantial protection scope of the present invention. The substantial protection scope of the present invention shall be subject to the claims. Those skilled in the art should know that any modification, equivalent substitution and improvement based on the substantial spirit of the present invention shall be within the substantial protection scope of the present invention.

Claims

1. A fusion modified form of dextranase, SpyCatcher-padex, which is obtained by fusing a SpyCatcher gene fragment to the N-terminus of a dextranase padex gene derived from Penicillium aculeatus through homologous recombination.

2. A gene encoding the fusion transformed SpyCatcher-padex according to claim 1, the nucleotide sequence of which is shown as SEQ ID NO.

7.

3. A recombinant expression plasmid containing the gene of the fusion transformed SpyCatcher-padex according to claim 2, wherein the vector of the expression plasmid is pPICZα-A.

4. A host expression cell containing the recombinant expression plasmid according to claim 3, wherein the host expression cell is Pichia pastoris.

5. A genetically engineered bacterium SpyCatcher-padex, obtained by culturing the host expression cell according to claim 4 and screening for bleomycin resistance.

6. The genetically engineered bacterium SpyCatcher-padex described in claim 5 is classified and named Pichia pastoris, with a preservation number of CGMCC No.32605, and is deposited in the General Microbiological Center of China Microbiological Culture Collection Administration, with a preservation address of No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, and a preservation date of November 13, 2024.

7. A method for obtaining the gene encoding the fusion modified SpyCatcher-padex according to claim 2, characterized in that: The following steps are involved: (1) The SpyCatcher gene was synthesized based on the gene sequence provided by NCBI, and its nucleotide sequence is shown in SEQ ID NO.1; (2) Using the SpyCatcher gene as a template, the nucleotide sequence of the gene is shown in SEQ ID NO.1, and using the sequences shown in SEQ ID NO.2 and SEQ ID NO.3 as primers to perform PCR to obtain a first PCR product; (3) Using the dextranase padex gene of Penicillium aculeatus as a template and the sequences shown in SEQ ID NO.4 and SEQ ID NO.5 as primers, PCR was performed to obtain a second PCR product, wherein the nucleotide sequence of the dextranase padex gene of Penicillium aculeatus is shown in SEQ ID NO.6; (4) The first and second PCR products were digested with DMT enzyme, then recovered and purified again by gel recovery, and the first PCR product: the second PCR product was homologously recombined at a ratio of 2:1, and transformed, and a single colony was selected to obtain the coding gene of the fusion transformant SpyCatcher-padex.

8. The method according to claim 8, characterized in that The PCR program for steps (2) and (3) was: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 5 s, annealing at 60°C for 15 s, and extension at 72°C for 2 min, 35 cycles; and extension at 72°C for 5 min.

9. Use of the fusion modified SpyCatcher-padex according to claim 1 in catalyzing the degradation of dextran.

10. The use according to claim 9, characterized in that When catalyzing dextran T70 substrate at 35°C and pH 5.5, the enzymatic activity of the dextranase fusion transformant SpyCatcher-padex was 3-4 times that of the dextranase padex.

Images