Methods and compositions for macrophage polarization

Abstract

Disclosed herein are compositions and methods comprising an extracellular vesicle comprising a nucleic acid that targets a gene, causing macrophage polarization of a tumor-associated macrophage. In certain embodiments, disclosed herein are methods and compositions for increasing macrophage polarization for the treatment of cancer.

Description

[0001] This application is a divisional application of the invention patent application with application number 201980011011.0, application date February 12, 2019, the applicant is Longsa Sales Co., Ltd., and the invention name is "Methods and compositions for macrophage polarization". Field of the Invention

[0002] The present invention relates to compositions and methods comprising extracellular vesicles having nucleic acids that target genes and induce macrophage polarization of tumor-associated macrophages. Background of the Invention

[0004] Immunotherapy is a disease treatment performed by inducing, enhancing or suppressing immune responses. The side effects of cancer immunotherapy are generally less than those of traditional cancer therapies such as chemotherapy and radiotherapy. In one method, cancer immunotherapy has been used to stimulate the patient's own macrophages to attack cancer cells. Macrophages present different phenotypes, for example, they may have pro-cancer activity, or they may have anti-cancer activity. The M2 phenotype or "alternative activated macrophages" generally exhibits pro-cancer activity such as immune system suppression and extracellular matrix and tissue remodeling activity. The M1 phenotype or "classical activated macrophages" generally exhibits anti-cancer activity such as tumor cell phagocytosis and adaptive immune stimulation so that tumor cells can be identified and attacked. It is necessary to promote the improvement in the immunomodulatory method and composition of macrophage polarization (i.e., conversion to M1 phenotype). Summary of the invention

[0005] Aspects of the present disclosure encompass an extracellular vesicle comprising one or more immunomodulatory components that, when in contact with a macrophage, selectively repolarize the macrophage from an M2 phenotype to an M1 phenotype. In some aspects, the present disclosure encompasses an extracellular vesicle that is an exosome that comprises one or more immunomodulatory components that, when in contact with a macrophage, selectively repolarize the macrophage from an M2 phenotype to an M1 phenotype.

[0006] In some aspects, the extracellular vesicles (e.g., the exosomes) comprise one or more immunomodulatory components that, when in contact with macrophages, selectively repolarize the macrophages from an M2 phenotype to an M1 phenotype, and the one or more immunomodulatory components are nucleic acids, such as inhibitory RNAs (e.g., antisense RNAs, siRNAs, shRNAs, miRNAs, lncRNAs, primary miRNAs (pri-miRNAs), or precursor miRNAs (pre-miRNAs)) or, for example, antisense oligonucleotides (ASOs), or, for example, the immunomodulatory components are antisense oligonucleotides comprising a sequence that is at least 95% identical to a sequence selected from SEQ ID NOs: 1-6.

[0007] In some aspects, the extracellular vesicles (e.g., the exosomes) comprise one or more immunomodulatory components, which selectively repolarize the macrophages from an M2 phenotype to an M1 phenotype when in contact with the macrophages, and the one or more immunomodulatory components (e.g., nucleic acids, such as inhibitory RNA (e.g., antisense RNA, siRNA, shRNA, miRNA, lncRNA, primary miRNA or precursor miRNA) or antisense oligonucleotides (ASOs)), or for example, the immunomodulatory components are selected from SEQ ID The invention relates to an antisense oligonucleotide having a sequence that is at least 95% identical to the sequence of NO: 1-6, which inhibits at least one macrophage target gene, for example, at least one gene is selected from the group consisting of KRAS, HRAS, NRAS, HIF1-α, HIF1-β, Sp1, P300, LKB1, AMPK, STAT3, STAT6, n-MYC, c-MYC, HCAR1, A2AB, IDO, TDO, arginase, glutaminase, CEBP / β, Pi3Kγ and PKM2, for example, STAT3, STAT6, CEBP / β, Pi3Kγ, KRAS and HIF1-α, for example, STAT3, for example, KRAS.

[0008] In some aspects, the extracellular vesicles (e.g., the exosomes) comprise one or more immunomodulatory components that, when in contact with macrophages, selectively repolarize the macrophages from an M2 phenotype to an M1 phenotype, and the immunomodulatory component is an antisense oligonucleotide targeting STAT3.

[0009] In some aspects, the extracellular vesicles (e.g., the exosomes) comprise one or more immunomodulatory components that, when in contact with macrophages, selectively repolarize the macrophages from an M2 phenotype to an M1 phenotype, and the immunomodulatory component is an antisense oligonucleotide targeting KRAS.

[0010] In some aspects, the extracellular vesicles (e.g., the exosomes) comprise one or more immunomodulatory components that, when in contact with macrophages, selectively repolarize the macrophages from an M2 phenotype to an M1 phenotype, and the immunomodulatory components are targeted to KRAS (e.g., wild-type human KRAS, or wild-type human KRAS and mouse KRAS G12D ) of the invention, such as antisense RNA, siRNA, shRNA, miRNA, lncRNA, primary miRNA or precursor miRNA.

[0011] In any of the aforementioned aspects, the extracellular vesicles (e.g., the exosomes) contain one or more immunomodulatory components (e.g., nucleic acids, inhibitory RNA (antisense RNA, siRNA, shRNA, miRNA, lncRNA, primary miRNA or precursor miRNA) or ASO), which, when in contact with macrophages, selectively repolarize the macrophages from an M2 phenotype to an M1 phenotype, and the macrophages are tumor (e.g., pancreatic tumor) resident macrophages.

[0012] In any of the aforementioned aspects, the extracellular vesicles (e.g., the exosomes) comprise: one or more immunomodulatory components (e.g., nucleic acids, inhibitory RNA (antisense RNA, siRNA, shRNA, miRNA, lncRNA, primary miRNA or precursor miRNA) or ASO), which selectively repolarize the macrophages from an M2 phenotype to an M1 phenotype when in contact with the macrophages; and further comprise additional immunomodulatory components, such as small molecule drugs, antibodies or active fragments thereof (e.g., immune checkpoint inhibitors that bind to CTLA-4, PD-1 or PD-L1 or inhibitors that bind to CSF1-R) or therapeutic proteins or active fragments thereof.

[0013] In any of the aforementioned aspects, the extracellular vesicles (eg, exosomes) comprise: one or more immunomodulatory components (eg, nucleic acids, inhibitory RNA (antisense RNA, siRNA, shRNA, miRNA, lncRNA, primary miRNA or precursor miRNA) or ASO), wherein the one or more immunomodulatory components selectively repolarize the macrophages from an M2 phenotype to an M1 phenotype when in contact with the macrophages; and further comprise additional immunomodulatory components, such as antibodies or active fragments thereof (eg, immune checkpoint inhibitors that bind to CTLA-4, PD-1 or PD-L1 or inhibitors that bind to CSF1-R), wherein the antibodies or active fragments thereof comprise immunomodulatory components that bind to macrophages. The CDRs of ipilimumab are at least 95% identical to those of nivolumab, or at least 95% identical to those of cemiplimab, or at least 95% identical to those of pembrolizumab, or at least 95% identical to those of atezolizumab, or at least 95% identical to those of avelumab, or at least 95% identical to those of durvalumab, or at least 95% identical to those of pexidartinib. , or CDRs that are at least 95% identical to the CDRs of PLX7486, or at least 95% identical to the CDRs of ARRY-382, or at least 95% identical to the CDRs of JNJ-40346527, or at least 95% identical to the CDRs of BLZ945, or at least 95% identical to the CDRs of Emactuzumab, or at least 95% identical to the CDRs of AMG820, or at least 95% identical to the CDRs of IMC-CS4, or at least 95% identical to the CDRs of Cabiralizumab, or wherein the antibody or active fragment thereof is at least one antibody selected from the group consisting of ipilimumab, nivolumab, Cemizumab, pembrolizumab, atezolizumab, avelumab, durvalumab, pirimicatinib, PLX7486, ARRY-382, JNJ-40346527, BLZ945, ematurumab, AMG820, IMC-CS4 and cabilutumab, or wherein the antibody or active fragment thereof is at least one antibody that competes for binding with an antibody selected from the group consisting of ipilimumab, nivolumab, Cemizumab, pembrolizumab, atezolizumab, avelumab, durvalumab, pirimicatinib, PLX7486, ARRY-382, JNJ-40346527, BLZ945, ematurumab, AMG820, IMC-CS4 and cabilutumab.

[0014] In any of the foregoing aspects, wherein the extracellular vesicles (e.g., the exosomes) comprise: one or more immunomodulatory components (e.g., nucleic acids, inhibitory RNAs (antisense RNAs, siRNAs, shRNAs, miRNAs, lncRNAs, primary miRNAs, or precursor miRNAs) or ASOs), which upon contact with macrophages selectively repolarize the macrophages from an M2 phenotype to an M1 phenotype;The invention also comprises an additional immunomodulatory component, such as an antibody or an active fragment thereof (e.g., an immune checkpoint inhibitor that binds to CTLA-4, PD-1 or PD-L1, or an inhibitor that binds to CSF1-R), wherein the antibody or active fragment thereof comprises a CDR that is at least 95% identical to that of Ipilimumab, or at least 95% identical to that of Nivolumab, or at least 95% identical to that of Cemiplimab, or at least 95% identical to that of Pembrolizumab, or at least 95% identical to that of Atezolizumab. The CDRs of ezolizumab are at least 95% identical to those of avelumab, or at least 95% identical to those of durvalumab, or at least 95% identical to those of pexidartinib, or at least 95% identical to those of PLX7486, or at least 95% identical to those of ARRY-382, or at least 95% identical to those of JNJ-40346527, or at least 95% identical to those of BLZ945, or at least 95% identical to those of emactumab. The invention relates to a CDR that is at least 95% identical to a CDR of uzumab, or at least 95% identical to a CDR of AMG820, or at least 95% identical to a CDR of IMC-CS4, or at least 95% identical to a CDR of Cabiralizumab, or wherein the antibody or active fragment thereof is at least one antibody selected from the group consisting of ipilimumab, nivolumab, simvastatin, pembrolizumab, atezolizumab, avelumab, durvalumab, piritinib, PLX7486, ARRY-382, JNJ-40346527, BLZ945, ematuriaumab, A MG820, IMC-CS4 and cabilutumab, or wherein the antibody or active fragment thereof is at least one antibody that competes for binding with an antibody selected from the group consisting of ipilimumab, nivolumab, simvastatin, pembrolizumab, atezolizumab, avelumab, durvalumab, piritinib, PLX7486, ARRY-382, JNJ-40346527, BLZ945, ematurumab, AMG820, IMC-CS4 and cabilutumab, the extracellular vesicle further comprising PTGFRN or a fragment thereof, and the antibody or fragment thereof may be optionally fused to the PTGFRN or a fragment thereof. ;

[0015] In any of the foregoing aspects, the comparison is determined using an assay selected from the group consisting of an extracellular vesicle uptake assay, a target gene expression assay, a downstream gene expression assay, a cytokine release assay, and a macrophage surface protein assay.

[0016] In any of the preceding aspects, the M2 macrophages are tumor-associated macrophages selected from the group consisting of M2a, M2b, and M2c macrophages.

[0017] In any of the foregoing aspects, the M1 macrophages exhibit increased secretion of inflammatory cytokines and chemokines selected from the group consisting of INFγ, IL-12, IL-23, TNFα, IL-6, IL-1, CSCL9, CXCL10 and CXCL11 compared to the M2 macrophages before polarization, and / or exhibit decreased secretion of immunosuppressive cytokines and chemokines selected from the group consisting of IL-10, TGFβ, PGE2, CCL2, CCL17, CCL18, CCL22 and CCL24 compared to the M2 macrophages before polarization, and / or express increased tumor-associated antigens compared to the M2 macrophages before polarization, and / or have increased expression of CD8 T cells compared to the M2 macrophages before polarization. + Stimulation of T cells and / or natural killer cells.

[0018] In various aspects, the present disclosure encompasses a pharmaceutical composition comprising extracellular vesicles (e.g., exosomes) comprising one or more immunomodulatory components that, when contacted with macrophages, selectively repolarize the macrophages from an M2 phenotype to an M1 phenotype.

[0019] In some aspects, the present disclosure encompasses a method of treating a disease (e.g., a cancer, such as, for example, pancreatic cancer) in a patient (e.g., a human patient) in need thereof, the method comprising administering (e.g., via a route selected from the group consisting of intravenous administration, intraperitoneal administration, and intratumoral administration) an extracellular vesicle as described in any of the preceding aspects, e.g., an exosome as described in any of the preceding aspects, the exosome comprising one or more immunomodulatory components (e.g., an inhibitory RNA targeting a proto-oncogene (e.g., KRAS)), wherein the one or more immunomodulatory components selectively repolarize the macrophage from an M2 phenotype to an M1 phenotype upon contact with the macrophage; or comprising administering a pharmaceutical composition comprising the extracellular vesicle as described in any of the preceding aspects, e.g., an exosome as described in any of the preceding aspects, the exosome comprising one or more immunomodulatory components, wherein the one or more immunomodulatory components selectively repolarize the macrophage from an M2 phenotype to an M1 phenotype upon contact with the macrophage.

[0020] In some aspects, the disclosure encompasses the above treatment methods and also includes a second therapy, such as surgery, chemotherapy, radiation therapy, cryotherapy, hormone therapy, or immunotherapy.

[0021] In some aspects, the disclosure encompasses a method of modulating gene expression in a macrophage, the method comprising: contacting the macrophage with an extracellular vesicle comprising one or more immunomodulatory components that inhibit at least one gene and thereby increase macrophage polarization from an M2 phenotype to an M1 phenotype compared to contacting the macrophage with an equimolar amount of the immunomodulatory component alone.

[0022] In some aspects, the method of modulating gene expression in a macrophage comprises contacting the macrophage ex vivo or in vivo with an extracellular vesicle comprising one or more immunomodulatory components that inhibit at least one gene and thereby increase macrophage polarization from an M2 phenotype to an M1 phenotype compared to contacting the macrophage with an equimolar amount of the immunomodulatory component alone.

[0023] In some aspects, the method of modulating gene expression in a macrophage comprises contacting the macrophage in vivo with an extracellular vesicle comprising one or more immunomodulatory components (e.g., by administering the extracellular vesicle to a subject (e.g., a human subject), for example, via a route selected from the group consisting of intravenous administration, intraperitoneal administration, and intratumoral administration), wherein the one or more immunomodulatory components inhibit at least one gene and thereby increase macrophage polarization from an M2 phenotype to an M1 phenotype compared to contacting the macrophage with an equimolar amount of the immunomodulatory component alone.

[0024] In some aspects, the subject of the above disclosed methods of modulating gene expression in macrophages suffers from a condition selected from cancer (eg, pancreatic cancer) and fibrosis.

[0025] In some aspects, the extracellular vesicle used in any of the methods of modulating gene expression in macrophages disclosed above is an exosome, and the immunomodulatory component is a nucleic acid, e.g., an inhibitory RNA, such as, e.g., antisense RNA, siRNA, shRNA, miRNA, lncRNA, pri-miRNA, or pre-miRNA.

[0026] In some aspects, the extracellular vesicle used in any of the methods of modulating gene expression in macrophages disclosed above is an exosome, and the immunomodulatory component is a nucleic acid, such as an ASO.

[0027] In some aspects, the extracellular vesicle used in any of the methods for modulating gene expression in macrophages disclosed above is an exosome, and the immunomodulatory component is a nucleic acid, such as an antisense oligonucleotide comprising a sequence at least 95% identical to a sequence selected from SEQ ID NOs: 1-6 or an antisense oligonucleotide comprising a sequence selected from SEQ ID NOs: 1-6, and the at least one gene is selected from the group consisting of KRAS, HRAS, NRAS, HIF1-α, HIF1-β, Sp1, P300, LKB1, AMPK, STAT3, STAT6, n-MYC, c-MYC, HCAR1, A2AB, IDO, TDO, arginase, glutaminase, CEBP / β, Pi3Kγ and PKM2, or selected from the group consisting of STAT3, STAT6, CEBP / β, Pi3Kγ, KRAS and HIF1-α, or is STAT3, or is KRAS, and if KRAS, the immunomodulatory component may optionally be an inhibitory RNA targeting wild-type human KRAS.

[0028] In some aspects, the present disclosure provides a method of treating pancreatic cancer in a subject, the method comprising: administering to the subject extracellular vesicles comprising an inhibitory RNA targeting human wild-type KRAS; wherein the treatment increases the percentage of tumor-resident macrophages polarizing from an M2 phenotype to an M1 phenotype to an increase compared to the treatment with an inhibitory RNA targeting human wild-type KRAS. G12D Higher levels of polarization percentage were observed in patients treated with inhibitory RNA.

[0029] In some aspects, the present disclosure provides the above-described method of treating pancreatic cancer in a subject, wherein the percentage of polarization of the tumor-resident macrophages is determined using an ex vivo assay of tumor-resident macrophages obtained from a tumor sample.

[0030] Provided herein are compositions and methods for selecting, enriching, or engineering extracellular vesicles with one or more immunomodulatory components that can modify macrophage activity, promote the conversion of macrophages from an M2 phenotype to an M1 phenotype (macrophage polarization), and enhance a patient's anti-cancer immune system.

[0031] Therefore, in the first aspect, the present invention provides an extracellular vesicle, the extracellular vesicle comprising one or more immunomodulatory components, such as nucleic acid molecules that inhibit at least one gene in a target cell. In certain embodiments, the target cell is a macrophage, and the gene inhibition increases the polarization of macrophages from an M2 phenotype to an M1 phenotype compared to an equimolar amount of one or more immunomodulatory components alone. In certain embodiments, the extracellular vesicle is an exosome. In certain embodiments, the nucleic acid is an inhibitory RNA. In certain embodiments, the inhibitory RNA is an antisense RNA, siRNA, shRNA, miRNA, lncRNA, primary miRNA, or precursor miRNA. In certain embodiments, the at least one gene is selected from the group consisting of KRAS, HRAS, NRAS, HIF1-α, HIF1-β, Sp1, P300, LKB1, AMPK, STAT3, STAT6, n-MYC, c-MYC, HCAR1, A2AB, IDO, TDO, arginase, glutaminase, CEBP / β, Pi3Kγ, and PKM2. In certain embodiments, the gene is KRAS. In certain embodiments, the nucleic acid is an inhibitory RNA targeting wild-type human KRAS. In certain embodiments, the inhibitory RNA also targets mouse Kras G12D . In certain embodiments, the macrophage is a tumor-resident macrophage. In certain embodiments, the tumor is a pancreatic tumor. In certain embodiments, the extracellular vesicle further comprises an additional immunomodulatory component. In certain embodiments, the additional immunomodulatory component is a small molecule drug, an antibody, or a therapeutic protein. In certain embodiments, the antibody is an immune checkpoint inhibitor. In certain aspects, a pharmaceutical composition comprising any of the extracellular vesicles mentioned above is provided herein.

[0032] In certain aspects, described herein is a method for treating a disease in a patient in need thereof, the method comprising administering to the patient an extracellular vesicle or a pharmaceutical composition as described herein, thereby treating the disease in the patient. In certain embodiments, the disease is cancer. In certain embodiments, the cancer is pancreatic cancer. In some embodiments, the disease is a fibrotic disorder. In some embodiments, the fibrotic disorder is pulmonary fibrosis, liver fibrosis, or pancreatic fibrosis. In certain embodiments, the liver fibrosis is non-alcoholic steatohepatitis or NASH. In certain embodiments, the patient is human. In certain embodiments, the nucleic acid is an inhibitory RNA targeting a proto-oncogene. In certain embodiments, the proto-oncogene is human KRAS. In certain embodiments, the cancer is pancreatic cancer. In certain embodiments, the method further comprises performing at least a second therapy. In certain embodiments, the second therapy comprises surgical therapy, chemotherapy, radiotherapy, cryotherapy, hormone therapy, or immunotherapy.

[0033] In certain embodiments, the target cell M2 macrophage is a tumor-associated macrophage selected from the group consisting of M2a, M2b and M2c macrophages. In certain embodiments, compared with the M2 macrophages before polarization, the M1 macrophages exhibit increased secretion of inflammatory cytokines and chemokines selected from the group consisting of INFγ, IL-12, IL-23, TNFα, IL-6, IL-1, CSCL9, CXCL10 and CXCL11. In certain embodiments, compared with the M2 macrophages before polarization, the M1 macrophages exhibit reduced secretion of immunosuppressive cytokines and chemokines selected from the group consisting of IL-10, TGFβ, PGE2, CCL2, CCL17, CCL18, CCL22 and CCL24. In certain embodiments, compared with the M2 macrophages before polarization, the M1 macrophages express increased tumor-associated antigens. In certain embodiments, compared with the M2 macrophages before polarization, the M1 macrophages increase CD8 + Stimulation of T cells and / or natural killer cells.

[0034] In certain aspects, described herein is a method of treating pancreatic cancer in a subject, the method comprising: administering to the subject extracellular vesicles comprising an inhibitory RNA targeting human wild-type KRAS; wherein the treatment increases the percentage of tumor-resident macrophages polarizing from an M2 phenotype to an M1 phenotype to an increase compared to treatment with an inhibitory RNA targeting human wild-type KRAS. G12D Higher levels of polarization percentage were observed in patients treated with inhibitory RNA. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1Shown are the gene expression levels of Stat 3, Stat 6, Cebpβ-1, Pi3Kγ, CEBPβ-2, and Kras after transfection of increasing amounts of siRNA targeting each of the genes.

[0036] Figure 2 Shown is Arg1 expression following transfection of increasing amounts of siRNA targeting Stat 3, Stat 6, Cebpβ-1, Pi3Kγ, CEBPβ-2, and Kras, respectively. Scrambled siRNA-transfected macrophages were used as a control.

[0037] Figure 3 Shown is exosome uptake as determined by total cellular GFP intensity of six macrophage subsets (M0, M1, M2a, M2c, M2++, and TAM).

[0038] Figure 4 Shown are free antisense oligonucleotide (free ASO) and ASO-loaded exosomes (Exo-ASO) uptake by M2 or M0 macrophages as measured by total fluorescence intensity.

[0039] Figure 5A In untreated mice, 1x10 11 or 1x10 12 Figure 3. Exosome uptake by macrophages in vivo following GFP-containing exosomes. Figure 5B Shown is the uptake of native exosomes and Exo-ASOs by tumor cells and macrophages in vivo after injection of a single dose of native unlabeled exosomes or Cy5-labeled Exo-ASOs in B16F10 tumor-bearing mice.

[0040] Figure 6 Shown in the presence of 5 μM free cholesterol-tagged ASO or 1x10 5 or 1x10 6 Stat3 expression in M2 polarized murine RAW264.7 cells after incubation with exosomes loaded with cholesterol-tagged ASOs. Five different cholesterol-tagged ASOs targeting STAT3 were tested: ASO 4.1, double-stranded MOE chemistry; ASO 5.1 and ASO 5.2, single-stranded O-methyl chemistry; ASO 5.3 and ASO 5.4, single-stranded MOE chemistry. Untreated polarized macrophages and polarized macrophages incubated with unmodified exosomes were used as negative controls. Macrophages transfected with Stat 3 siRNA were used as controls.

[0041] Figure 7 Shown in the presence of 5 μM free cholesterol-tagged ASO or 1x10 5 or 1x10 6Arg1 transcript levels in M2 polarized murine RAW264.7 cells after incubation with exosomes loaded with cholesterol-tagged ASOs. Five different cholesterol-tagged ASOs targeting STAT3 were tested: ASO 4.1, double-stranded MOE chemistry; ASO 5.1 and ASO 5.2, single-stranded O-methyl chemistry; ASO 5.3 and ASO 5.4, single-stranded MOE chemistry. Untreated polarized macrophages and polarized macrophages incubated with unmodified exosomes were used as negative controls. Macrophages transfected with Stat 3 siRNA were used as controls.

[0042] Fig. 8A Shown is STAT3 expression in M2 polarized murine RAW264.7 cells after incubation with high (4 μM) ASO or high (4 μM) and low (0.4 μM) doses of Exo-ASO against STAT3. Figure 8B Shown is KRAS expression in M2 polarized murine RAW264.7 cells after incubation with a high dose (4 μM) of ASO or Exo-ASO against KRAS. Figure 8C Shown is C / EBPβ expression in M2 polarized murine RAW264.7 cells after incubation with high (4 μM) and low (0.4 μM) doses of ASO or Exo-ASO against C / EBPβ.

[0043] Fig.9A Shown are STAT3 transcription levels in primary human macrophages from three separate donors following treatment with varying doses of free STAT3 ASO or STAT3 Exo-ASO. The IC50 for each treatment and the fold improvement of STAT3 Exo-ASO compared to free STAT3 ASO are presented. Fig. 9B CD163 levels in primary human macrophages from three separate donors following treatment with varying doses of free STAT3 ASO or STAT3 Exo-ASO are shown. The IC50 for each treatment and the fold improvement of STAT3 Exo-ASO compared to free STAT3 ASO are presented.

[0044] Fig.10 Shown are target gene expressions in human M2 macrophages after treatment with 4 μM free ASO or Exo-ASO against HIF1α, Pi3Kγ, CEBP / β, STAT6 and STAT3, respectively. Untreated human M2 macrophages and human M2 macrophages treated with 4 μM scrambled Exo-ASO were used as controls.

[0045] Fig.11CD163 expression in human M2 macrophages after treatment with 4 μM free ASO or Exo-ASO against HIF1α, Pi3Kγ, CEBP / β, STAT6 and STAT3, respectively, is shown. Untreated human M2 macrophages and human M2 macrophages treated with 4 μM scrambled Exo-ASO were used as controls.

[0046] Fig. 12A Shown is IL-12 induction following treatment with 4 μM free STAT3 ASO, 4 μM STAT3 Exo-ASO, 4 μM scrambled Exo-ASO, native exosomes, or C188-9, a small molecule inhibitor of STAT3, in the presence or absence of LPS. Fig. 12B Shown is IL-23 induction following treatment with 4 μM free STAT3 ASO, 4 μM STAT3 Exo-ASO, 4 μM scrambled Exo-ASO, native exosomes, or C188-9, a small molecule inhibitor of STAT3, in the presence or absence of LPS.

[0047] Fig.13A Shown are STAT3 transcript levels after treatment with unmodified exosomes (EVs only) and concentration-matched Stat 3 free ASO and Stat3Exo-ASO. Fig. 13B Shown are CD163 transcript levels after treatment with unmodified exosomes (EVs only) and concentration-matched Stat 3 free ASO and Stat 3Exo-ASO. Fig. 13C Shown are TGFβ transcript levels after treatment with unmodified exosomes (EVs only) and concentration-matched Stat 3 free ASO and Stat 3Exo-ASO. Fig.13D Shown are STAT6 transcript levels after treatment with unmodified exosomes (EVs only) and concentration-matched Stat 3 free ASO and Stat 3Exo-ASO.

[0048] Fig.14 Shown are TGFβ expression levels after exosome treatment with cells loaded with ASO against STAT3 (both MOE and LNA chemistries), ASO against STAT6 (MOE chemistries), and ASO against CEBP / β (MOE chemistries), respectively. DETAILED DESCRIPTION

[0049] Macrophage polarization is the process by which macrophages adopt different functional programs in response to signals from the macrophage microenvironment. This ability is related to the diverse roles of macrophages in organisms: macrophages are powerful effector cells of the innate immune system and are also crucial in cell debris removal, embryonic development, and tissue repair.

[0050] Macrophage phenotypes are roughly divided into 2 groups: M1 (classically activated macrophages) and M2 (alternatively activated macrophages). This rough classification is based on in vitro studies in which cultured macrophages are treated with molecules that stimulate their phenotype to switch to a specific state. M1 macrophages are pro-inflammatory and play an important role in direct host defense against pathogens (such as phagocytosis and secretion of pro-inflammatory cytokines and microbicidal molecules). M2 macrophages have completely opposite functions: regulating the resolution phase of inflammation and repairing damaged tissues. See, for example, Wynn, TA, Chawla, A., & Pollard, JW (2013). Origins and Hallmarks of Macrophages: Development, Homeostasis, and Disease. Nature, 496 (7446), 445-455; Mills, CD, Kincaid, K., Alt, JM, Heilman, MJ, & Hill, AM (2000). M-1 / M-2 Macrophages and the Th1 / Th2 Para digm. The Journal of Immunology, 164 (12), 6166-6173. Many solid tumors are characterized by bone marrow-rich infiltrates, which often contain a type of M2 macrophage called tumor-associated macrophages (TAMs). M2 macrophages (such as TAMs) express high levels of phosphorylated STAT3 and STAT6 that promote the expression of the metabolic enzyme arginase (Arg1). TAMs mediate a variety of tumor-promoting activities, such as (for example) promotion of cancer cell motility, cancer metastasis formation and angiogenesis, and TAM formation depends on the microenvironmental factors present in the developing tumor. TAMs produce immunosuppressive cytokines (such as (for example) IL-10, TGFβ, PGE2 and very small amounts of NO or ROI) and low levels of inflammatory cytokines (IL-12, IL-1β, TNFα, IL-6). Compared with "classically activated" M1 macrophages, tumor-associated antigen presentation by TAMs is reduced, as is the stimulation of the anti-tumor function of T cells and NK cells. Unlike M1 macrophages, TAMs cannot lyse tumor cells. https: / / en.wikipedia.org / wiki / Mac rophage_polarization-cite_note-Sica2008-31 Therefore, targeting of TAMs and other M2 macrophages offers a novel anticancer therapeutic strategy, as has been demonstrated by delivering agents to alter the recruitment and distribution of TAMs, deplete existing TAMs, or induce re-education of TAMs from an M2 phenotype to an M1 phenotype.

[0051] The exosome therapeutics of the present invention have a selective effect on M2 macrophages to promote a tissue-resident microenvironment, thereby treating diseases such as cancer and fibrosis by "repolarizing" abnormal macrophages to an M1 phenotype. The exosomes described herein are precisely engineered with various bioactive molecules on the surface of the exosomes or within the exosome lumen to produce drug candidates that engage the pathway that repolarizes M2 macrophages to an M1 phenotype to treat human diseases.

[0052] Tumor-associated M2 polarized macrophages or TAMs can effectively suppress T cell proliferation and effector function and promote tumor growth. Antibodies that deplete macrophages against the CSF-1 receptor have also been used to report the reversal of TAMs back to the M1 phenotype. These methods have shown limited success in clinical trials due to a narrow therapeutic window and a lack of specificity due to targeting all macrophages as expected, rather than just targeting abnormal M2 macrophages. It is expected that the depletion of macrophages in batches will lead to an increased risk of infection and other safety issues. The exosomes of the present invention more selectively target M2 macrophages due to the natural exosome tropism of macrophages, and break the balance of functions for the desired M1 phenotype. These exosomes repolarize macrophages, causing the production of the desired spectrum of inflammatory cytokines required for anti-tumor immune responses. As shown in the following examples, exosomes reprogram immunosuppressive M2 macrophages to an M1 phenotype in vitro.

[0053] In addition to the immunosuppression induced in the tumor microenvironment, M2 polarized macrophages secrete large amounts of transforming growth factor β or TGFβ, an important cytokine involved in cell signaling that induces fibroblast accumulation, leading to collagen deposition and tissue remodeling, ultimately leading to tissue fibrosis. It has been shown that reprogramming these M2 macrophages to reduce TGFβ production by targeting key signaling molecules such as STAT3 has beneficial activity in preclinical models of pulmonary fibrosis. Several small molecule approaches targeting STAT3 have been used, but the lack of inhibition specificity only within abnormal M2 macrophages has prevented this treatment approach from being feasible. Certain exosomes described here selectively target key pathways in M2 macrophages that allow M2 macrophages to target STAT3, as well as other cellular pathways in fibrotic syndromes of the lung and other tissues.

[0054] Disclosed herein are extracellular vesicles suitable for regulating macrophages of the immune system. These extracellular vesicles contain one or more immunomodulatory components, which, when in contact with macrophages, inhibit at least one macrophage target gene, thereby increasing macrophage polarization from an M2 phenotype to an M1 phenotype compared to an equimolar amount of one or more immunomodulatory components alone. Also provided are methods for producing extracellular vesicles and methods for using these extracellular vesicles to treat cancer and other immune system-related diseases such as, for example, fibrotic disorders.

[0055] Before describing the present invention in more detail, it should be understood that the present invention is not limited to the specific embodiments described, as such embodiments may of course vary. It should also be understood that the terminology used herein is only for the purpose of describing specific embodiments, and is not intended to be limiting, as the scope of the present invention is limited only by the appended claims.

[0056] When providing a numerical range, it is understood that unless the context clearly dictates otherwise, each intermediate value between the upper and lower limits of the range and any other stated or intermediate values ​​of the stated range to one tenth of the lower limit unit is included in the present invention. The upper and lower limits of these smaller ranges may be independently included in these smaller ranges and are also included in the present invention, subject to any specific excluded limits in the stated range. When the stated range includes one or both of the limits, ranges exceeding either or both of those included limits are also included in the present invention.

[0057] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention belongs. Although any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present invention, representative exemplary methods and materials are now described.

[0058] All publications and patents cited in this specification are incorporated herein by reference to the same extent as if each individual publication or patent was specifically and individually indicated to be incorporated by reference, and are incorporated herein to disclose and describe the methods and / or materials in connection with which the publication is cited.

[0059] It should be noted that as used herein and in the appended claims, the singular forms "a," "an," and "the" include plural references unless the context clearly dictates otherwise. Similarly, the term "at least one" includes plural references (i.e., is equivalent to the phrase "one or more" unless the context clearly dictates otherwise). It should be further noted that the claims may be drafted to exclude any optional elements. Therefore, this specification is intended only to serve as an antecedent basis for use of such exclusive terminology as "solely," "only," and the like in connection with reciting claim elements or for use of negative limitations.

[0060] The term "about" when used to modify a numerical value is intended to encompass variations in the stated value that are functionally equivalent to the stated value for the purpose of practicing the described technology as readily determined by one of skill in the art. In certain embodiments, the term "about" includes variations of + / -5%, + / -10%, + / -20%, + / -30%, + / -40%, or + / -50% from the stated value.

[0061] As will be apparent to those skilled in the art after reading this disclosure, each of the individual embodiments described and illustrated herein has discrete components and features that can be readily separated or combined with the features of any of the other several embodiments without departing from the scope or spirit of the invention. Any method recited can be performed in the order of events recited or in any other order that is logically possible.

[0062] In further describing the present invention, the system of the present invention for practicing the method of the present invention will be discussed in more detail, followed by a discussion of an overview of the related methods.

[0063] As used herein, the term "extracellular vesicle" refers to a vesicle of cell origin comprising a membrane that encloses an internal space. Extracellular vesicles include membrane-bound vesicles whose diameters are all smaller than the diameters of the cells from which they are derived. In general, extracellular vesicles are in the range of 20nm to 1000nm in diameter, and may include various macromolecular cargoes that are in the internal space, displayed on the outer surface of the extracellular vesicle and / or across the membrane. Cargo may include nucleic acids, proteins, carbohydrates, lipids, small molecules and / or combinations thereof. For example and without limitation, extracellular vesicles include apoptotic bodies, cell fragments, vesicles derived from cells by direct or indirect manipulation (e.g., by continuous extrusion or treatment with an alkaline solution), organelles containing vesicles, and vesicles produced by living cells (e.g., by direct plasma membrane budding or fusion of late endosomes with plasma membranes). Extracellular vesicles may be derived from living or dead organisms, explanted tissues or organs, and / or cultured cells. Extracellular vesicular material includes exosomes and nanovesicles as described, for example, in commonly owned US Patent No. 10,195,290, which is incorporated herein by reference for all purposes.

[0064] As used herein, the term "exosome" refers to a small (diameter between 20-300 nm, more preferably between 40-200 nm) vesicle of cell origin containing a membrane that encloses an internal space, and the vesicle is produced by the cell by direct plasma membrane budding or by fusion of late endosomes with the plasma membrane. Exosomes are extracellular vesicle substances. Exosomes contain lipids or fatty acids and polypeptides, and optionally contain a payload (e.g., a therapeutic agent), a receptor (e.g., a targeting moiety), a polynucleotide (e.g., a nucleic acid, RNA, or DNA), a sugar (e.g., a monosaccharide, a polysaccharide, or a polysaccharide) or other molecules. Exosomes can be derived from production cells and separated from production cells based on their size, density, biochemical parameters, or a combination thereof.

[0065] As used herein, the term "nanovesicle" refers to a small (diameter between 20-250nm, more preferably between 30-150nm) vesicle of cell origin containing a membrane that encloses an internal space, and the vesicle is generated by the cell by direct or indirect manipulation so that the nanovesicle is not produced by the production cell without manipulation. Suitable manipulation of production cells includes, but is not limited to, continuous extrusion, treatment with alkaline solution, ultrasonic treatment, or a combination thereof. In some cases, the production of nanovesicles may cause damage to production cells. Preferably, the nanovesicle population is substantially free of vesicles derived from production cells by direct budding from the plasma membrane or fusion of late endosomes with the plasma membrane. Nanovesicles are extracellular vesicle materials. Nanovesicles contain lipids or fatty acids and polypeptides, and optionally contain a payload (e.g., a therapeutic agent), a receptor (e.g., a targeting moiety), a polynucleotide (e.g., a nucleic acid, RNA, or DNA), a sugar (e.g., a monosaccharide, a polysaccharide, or a polysaccharide) or other molecules. Once the nanovesicle is derived from a production cell according to manipulation, it can be separated from the production cell based on its size, density, biochemical parameters, or a combination thereof.

[0066] As used herein, the term "M2 phenotype" refers to macrophages that exhibit one or more tumor-promoting activities or express markers known in the art to be associated with the M2 phenotype, such as, but not limited to, CD8 +reduction or absence of T cell and / or natural killer cell stimulation; lack of phagocytosis of tumor cells; secretion and / or expression of M2-associated cytokines (e.g., IL-10, TGFβ, PGE2, CCL2, CCL17, CCL18, CCL22, and CCL24); secretion and / or expression of growth factors (e.g., VEGF-A, VEGF-C, EGF, and TGF-β); secretion and / or expression of transfer enzymes (e.g., matrix metalloproteinases MMP2, MMP9, cysteine ​​cathepsins); secretion / expression of immunosuppressive factors (e.g., arginase I (ArgI), which extracts the substrate L-arginine from inducible nitric oxide synthase (iNOS)); expression of cell surface markers YM1, FIZZ1, Dectin-1, MGL; M2-associated miRNAs (e.g., miRNA146a, miRNA let 7b and miR-223) (see e.g. Mosser, DM and Edwards, JP (2008). Exploring the full spectrum of macrophage activation. Nature Reviews Immunology, 8(12),958-96; Murray, PJ, Allen, JE, Biswas, SK, Fisher, EA, Gilroy, DW, Goerdt, S., Wynn, TA (2014). Macrophage activation and polarization: nomenclature and experimental guidelines. Immunity, 41(1), 14-20; and Liu, YC, Zou, XB, Chai, YF, & Yao, YM (2014). Macrophage polarization in inflammatory diseases. International Journal of Biological Sciences, 10 (5), 520-5299, and references cited therein, each of which is incorporated by reference for all purposes) and / or reduced expression / secretion of M1-related factors or reduced M1-related activity as listed below compared to at least one reference sample, wherein the reference sample comprises a population of M1 activated macrophages. In vitro M1 activation is induced by treatment with TLR ligands such as bacterial lipopolysaccharide (LPS) typically used for Gram-negative bacteria and lipoteichoic acid (LTA) typically used for Gram-positive bacteria, granulocyte-macrophage colony stimulating factor (GM-CSF) or a combination of LPS and interferon gamma (IFN-γ).See Mills, CD, Kincaid, K., Alt, JM, Heilman, MJ and Hill, AM (2000). M-1 / M-2 Macrophages and the Th1 / Th2 Paradigm. The Journal of Immunology, 164(12), 6166-6173; Krausgruber, Thomas et al. "IRF5 promotes inflammatory macrophage polarization and TH1-TH17 responses." Nature immunology 12.3(2011): 231-238 and Martinez, FO and Gordon, S. (2014). The M1 and M2 paradigm of macrophage activation: time for reassessment. F1000 Prime Reports, 6(March), 1-13, and references cited therein, each of which is incorporated herein by reference for all purposes.

[0067] As used herein, the term "M1 phenotype" refers to macrophages that exhibit anti-tumor activity or markers known in the art to be associated with the M1 phenotype, such as but not limited to CD8 +Stimulation of T cells and / or natural killer cells, phagocytosis of tumor cells, secretion and / or expression of M1-related cytokines (e.g., INFγ, IL-12, IL-23, TNFα, IL-6, IL-1, CCL5, CSCL9, CXCL10 and CXCL11), expression of M1-related miRNAs (e.g., miRNA155, miR-33) (see, e.g., Mosser, DM and Edwards, JP (2008). Exploring the full spectrum of macrophage activation. Nature Reviews Immunology, 8(12), 958-96; Murray, PJ, Allen, JE, Biswas, SK, Fisher, EA, Gilroy, DW, Goerdt, S., Wynn, TA (2014). Macrophage activation and polarization: nomenclature and experimental guidelines. Immunity, 41 (1), 14-20; and Liu, YC, Zou, XB, Chai, YF, & Yao, YM (2014). Macrophage polarization in inflammatory diseases. International Journal of Biological Sciences, 10 (5), 520-5299, and references cited therein, each of which is incorporated by reference for all purposes) and / or reduced expression / secretion of M2-related factors listed above compared to at least one reference sample or reduced M2-related activity, wherein the reference sample comprises a population of M2-activated macrophages. In vitro M2 activation is induced by treatment with IL-4 and IL-13 (see, e.g., Liu, YC, Zou, XB, Chai, YF, & Yao, YM (2014). Macrophage polarization in inflammatory diseases. International Journal of Biological Sciences, 10 (5), 520-529, incorporated by reference for all purposes).

[0068] As used herein, the term "macrophage polarization" refers to a change in macrophages from an M2 phenotype to an M1 phenotype and / or refers to an increase in the percentage of a population of macrophages found in a patient (e.g., tumor-associated macrophages or circulating macrophages) that exhibit an M1 phenotype compared to at least one reference sample (e.g., a sample taken from the same patient prior to the test sample or historical data). See, e.g., Mills, CD, Kincaid, K., Alt, JM, Heilman, MJ, and Hill, AM (2000). M-1 / M-2 Macrophages and the Th1 / Th2 Paradigm. The Journal of Immunology, 164(12), 6166-6173; Mosser, DM, and Edwards, JP (2008). Exploring the full spectrum of macrophage activation. Nature Reviews Immunology, 8(12), 958-969; and Xue, J., Schmidt, SV, and Schultze, JL (2014), Transcriptome-Based Network Analysis Reveals a Spectrum Model of Human Macrophage Activation. Immunity, 40(2) L274-288, each of which is incorporated by reference for all purposes.

[0069] The term "extracellular vesicle delivery / delivery of extracellular vesicles" refers to the administration and positioning of extracellular vesicles to target tissues, cells and / or organs of a subject. In some embodiments, the immunomodulatory components can be delivered to the cytoplasm of the target cell. In other embodiments, the immunomodulatory components are delivered to the membrane of the target cell. In some embodiments, the membrane of the extracellular vesicle fuses with the membrane of the target cell.

[0070] As used herein, the term "producer cell" refers to any cell that can be separated from an extracellular vesicle. Producer cells are cells that serve as a source of extracellular vesicles. Producer cells can share protein, lipid, sugar or nucleic acid components with extracellular vesicles. In some embodiments, the producer cell is a modified cell or a synthetic cell. In some embodiments, the producer cell is a cultured cell or a separated cell. In certain embodiments, the producer cell is a cell line. In some embodiments, the producer cell line is a human fetal kidney cell line. In some embodiments, the producer cell line is a HEK293SF cell line. In certain other embodiments, the producer cell is a primary cell. In some specific embodiments, the producer cell is an immune cell, such as (for example) B lymphocytes, T lymphocytes, dendritic cells, mast cells, macrophages, natural killer cells (NK cells), antigen presenting cells, T helper cells or regulatory T cells (Treg cells).

[0071] As used herein, "membrane" is a boundary layer that separates an inner space from an outer space and includes one or more biological compounds (usually lipids, and optionally polypeptides and / or carbohydrates). In some embodiments, the membrane includes lipids and fatty acids. In some embodiments, the membrane includes phospholipids, glycolipids, fatty acids, sphingolipids, phosphoglycerides, sterols, cholesterol, and phosphatidylserine. In some of these embodiments, the membrane also includes one or more polypeptides and / or one or more polysaccharides (such as polysaccharides). The extracellular vesicle includes a membrane as defined herein.

[0072] As used herein, the term "immunomodulatory component" refers to a therapeutic agent that acts on a target (e.g., a target gene, including, for example, but not limited to, KRAS, HRAS, NRAS, HIF1-α, HIF1-β, Sp1, P300, LKB1, AMPK, STAT3, STAT6, n-MYC, c-MYC, HCAR1, A2AB, IDO, TDO, arginase, glutaminase, CEBP / β, Pi3Kγ, and PKM2) contacted with an agent and modifies immune cells (e.g., macrophages or other immune cells). The immunomodulatory component that can be introduced into an extracellular vesicle and / or a production cell includes a therapeutic agent, such as a polynucleotide (such as an inhibitory nucleic acid (e.g., antisense oligonucleotide (ASO), siRNA, miRNA, antisense RNA, shRNA, lncRNA, primary miRNA, and precursor miRNA)), an agonist, an antagonist, an antibody and / or an antigen binding fragment, an immune checkpoint inhibitor or a regulator of an immune checkpoint inhibitor ligand, a surface antigen and its derivatives, and / or a cytokine and its derivatives. In certain embodiments, the immunomodulatory component is an inhibitory nucleic acid (eg, antisense oligonucleotide (ASO), siRNA, miRNA, antisense RNA, shRNA, lncRNA, pri-miRNA, and pre-miRNA).See, for example, Weiss, B. (Ed.): Antisense Oligodeoxynucleotides and Antisense RNA: Novel Pharmacological and Therapeutic Agents, CRC Press, Boca Raton, FL, 1997; Elbashir S, Harborth J, Lendeckel W, Yalcin A, Weber K, Tuschl T (2001). "Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells".Nature.411(6836):494-988; Bartel DP(January 2004)."MicroRNAs:genomics,biogenesis,mechanism,and function".Cell.116(2):281-97; Paddison, PJ; Caudy, AA; Bernstein, E; Hannon, GJ; Conklin, DS (April 15, 2002). "Short hairpin RNAs (shRNAs)induce sequence-specific silencing in mammalian cells. Genes & Development. 16 (8): 948-58; Ma L, Bajic VB, Zhang Z (June 2013). "On the classification of long non-coding RNAs". RNA Biology. 10 (6): 925-33; and Ambros V, Bartel B, Bartel DP, Burge CB, Carrington JC, Chen X, Dreyfuss G, Eddy SR, Griffiths-Jones S, Marshall M, Matzke M, Ruvkun G, Tuschl T (March 2003). "A uniform system for microRNA annotation". RNA. 9 (3): 277-9, each of which is incorporated herein for all purposes.

[0073] As used herein, the phrase "nucleic acid molecule that inhibits" or "inhibitory nucleic acid" refers to any nucleic acid that causes the expression or activity of a target gene to be inhibited when introduced into a cell so that it interacts with a target gene. The nucleic acid molecule that inhibits (i.e., inhibitory nucleic acid) can be DNA or inhibitory RNA (e.g., siRNA, miRNA, antisense RNA, shRNA, lncRNA, precursor miRNA, or mRNA), wherein the RNA is single-stranded, double-stranded, or contains both single-stranded and double-stranded regions. In some embodiments, the inhibitory nucleic acid is an antisense oligonucleotide (ASO). ASO can be single-stranded or double-stranded DNA, RNA, or a DNA / RNA hybrid. See, for example, Antisense Oligodeoxynucleotides and Antisense RNA: Novel Pharmacological and Therapeutic Agents, CRC Press, Boca Raton, FL, 1997, which is incorporated herein by reference for all purposes. An "EXO ASO" is an ASO that is physically associated with extracellular vesicles, such as, for example, exosomes, either through interaction with the vesicle membrane (e.g., as occurs with cholesterol or fatty acyl-derivatized ASOs) or by loading into the vesicle lumen using techniques such as electroporation or through genetically engineering producer cells such as by, for example, transfection or transduction to introduce a construct encoding the desired ASO into the producer cells, followed by isolation of the extracellular vesicles from the engineered producer cells.

[0074] The term "receiver" refers to a molecule that directs an extracellular vesicle to a target and / or promotes the interaction of an extracellular vesicle with a target in a subject. In some embodiments, the receiver is a polypeptide, sometimes referred to herein as a "receiver polypeptide". In some embodiments, the receiver is capable of increasing the concentration of an immunomodulatory component in a subject's tissue, such as by directed transport to a target tissue of the subject. Examples of receivers include, but are not limited to, those listed in Table 3.

[0075] The term "target" may refer to a gene (i.e., a target gene) whose activity is regulated by the immunomodulatory components of the present disclosure. In certain embodiments, the target gene is inhibited by a nucleic acid molecule (such as, for example, an inhibitory ASO) associated with an extracellular vesicle (i.e., bound to the membrane surface, inserted into a lipid bilayer, or encapsulated in a closed body of a vesicle). Examples of target genes include, but are not limited to, KRAS, HRAS, NRAS, HIF1-α, HIF1-β, Sp1, P300, LKB1, AMPK, STAT3, STAT6, n-MYC, c-MYC, HCAR1, A2AB, IDO, TDO, arginase, glutaminase, CEBP / β, Pi3Kγ, and PKM2. "Target" may also refer to a cell (i.e., a target cell) directed by an extracellular vesicle of the present disclosure. In certain embodiments, the target cell is an immune cell (e.g., a macrophage). In certain embodiments, the target cell is a hematopoietic stem cell or a pluripotent stem cell. In certain embodiments, the target cell is a circulating macrophage. In certain embodiments, the target cell is a tumor-resident macrophage (i.e., a macrophage located in the tumor microenvironment, in the tumor tissue, or near the tumor surface). In addition, "target" may also refer to a protein on a target cell whose activity is regulated by contact with an immunomodulatory component of the present disclosure, or a protein (i.e., a target protein) that acts as a ligand for binding to an extracellular vesicle of the present disclosure. Therefore, in certain embodiments, the target protein is on a target cell and interacts with an extracellular vesicle.

[0076] "Therapeutic agents" or "therapeutic molecules" include compounds or molecules that produce a desired therapeutic effect, pharmacological and / or physiological effect on a subject in need thereof when present in an effective amount. It includes any compound, such as a small molecule drug or a biologic (e.g., a polypeptide drug or a nucleic acid drug), that has a measurable or deliverable effect on a subject when administered to the subject (e.g., it alleviates or alleviates the symptoms of a disease, disorder, or condition).

[0077] As used herein, the term "immune checkpoint inhibitor" or "checkpoint inhibitor" refers to a therapeutic agent that stimulates immune cell activity by reducing the immunosuppressive checkpoint pathways that block immune cells (e.g., agents that inhibit PD-1 / PD-L1 (such as Nivolumab, Cemiplimab, and Pembrolizumab, which target PD-1, and Atezolizumab, Avelumab, and Durvalumab, each of which targets PD-L1) and agents that inhibit CTLA-4 / B7-1 / B7-2 (such as Ipilimumab)). See, e.g., Pardoll DM (March 2012). "The blockade of immune checkpoints in cancer immunotherapy". Nature Reviews. Cancer. 12(4): 252-64.

[0078] As used herein, the term "antibody" encompasses immunoglobulins and fragments thereof, whether natural or partially or entirely produced synthetically. The term also covers any protein having a binding domain homologous to an immunoglobulin binding domain. "Antibody" also includes polypeptides comprising a framework region from an immunoglobulin gene or its fragment that specifically binds and recognizes an antigen. The use of the term antibody is intended to include complete antibodies, polyclonal antibodies, monoclonal antibodies and recombinant antibodies, their fragments, and also includes single-chain antibodies, humanized antibodies, mouse antibodies, chimeric monoclonal antibodies, mouse-human monoclonal antibodies, mouse-primate monoclonal antibodies, primate-human monoclonal antibodies, anti-idiotypic antibodies, antibody fragments (such as (for example) scFv, (scFv)2, Fab, Fab' and F(ab')2, F(ab1)2, Fv, dAb and Fd fragments), bifunctional antibodies and antibody-related polypeptides. Antibodies include bispecific antibodies and multispecific antibodies, as long as they exhibit the desired biological activity or function. Exemplary antibody compositions include antibodies that inhibit CTLA-4 (such as, for example, ipilimumab), antibodies that inhibit PD-1 (such as, for example, nivolumab, simvastatin, and pembrolizumab), antibodies that inhibit PD-L1 (such as, for example, atezolizumab, avelumab, durvalumab), and antibodies that inhibit CSFR1 (such as, for example, pexidartinib, PLX7486, ARRY-382, JNJ-40346527, BLZ945, emactuzumab, AMG820, IMC-CS4, and cabiralizumab). The term "antigen-binding fragment" as used herein refers to a fragment of an intact immunoglobulin and any portion of a polypeptide including an antigen-binding region having the ability to specifically bind to an antigen. For example, the antigen-binding fragment may be a F(ab')2 fragment, a Fab' fragment, a Fab fragment, a Fv fragment, or a scFv fragment, but is not limited thereto. The Fab fragment has an antigen binding site and contains a light chain variable region and a heavy chain variable region, a light chain constant region and the first constant region CH1 of the heavy chain. The Fab' fragment differs from the Fab fragment in that the Fab' fragment additionally includes a heavy chain hinge region that includes at least one cysteine ​​residue at the C-terminus of the heavy chain CH1 region. F(ab')2 fragments are produced, whereby the cysteine ​​residues of the Fab' fragment are joined by disulfide bonds at the hinge region. The Fv fragment is the smallest antibody fragment having only a heavy chain variable region and a light chain variable region, and recombinant techniques for producing Fv fragments are well known in the art. The double-chain Fv fragment may have a structure in which the heavy chain variable region is connected to the light chain variable region by a non-covalent bond.Single-chain Fv (scFv) fragments generally may have a dimer structure like the dimer structure in a double-chain Fv fragment, wherein the heavy chain variable region is covalently bound to the light chain variable region via a peptide linker, or the heavy chain variable region and the light chain variable region are directly connected to each other at their C-terminal ends. Antigen-binding fragments can be obtained using proteases (e.g., complete antibodies are digested with papain to obtain Fab fragments, and digested with pepsin to obtain F(ab')2 fragments), and can be prepared by genetic recombination techniques. dAb fragments consist of VH domains. Single-chain antibody molecules may include polymers with a variety of individual molecules, such as dimers, trimers, or other polymers.

[0079] The phrase "nucleic acid molecule" refers to a single-stranded or double-stranded polymer having deoxyribonucleotide or ribonucleotide bases. It includes chromosomal DNA and self-replicating plasmids, vectors, mRNA, tRNA, siRNA, miRNA, etc. Nucleic acid molecules can be recombinant, and exogenous polypeptides can be expressed when the nucleic acid is introduced into a cell. The term encompasses chemically modified nucleic acids, such as those described, for example, in Selvam C, Mutisya D, Prakash S, Ranganna K, Thilagavathi R. "Therapeutic potential of chemically modified siRNA: Recent trends," Chem Biol Drug Des. 2017 Nov; 90(5): 665-678; locked nucleic acids (LNAs) as described, for example, in Petersen M, Wengel J (February 2003). "LNA: a versatile tool for therapeutics and genomics". Trends Biotechnol. 21(2): 74-81; and other types of clinically relevant chemically modified nucleic acids, such as those described, for example, in Summerton, J; Weller, D (1997). "Morpholino Antisense Oligomers: Design, Preparation and Properties". Antisense & Nucleic Acid Drug Development. 7(3): 187-195; Goodchild, J (2011). Therapeutic oligonucleotides. Methods in Molecular Biology. 764. pp. 1-15, each of which is incorporated herein by reference for all purposes.

[0080] The term "agonist" refers to a molecule that binds to a receptor and activates the receptor to produce a biological response. Receptors can be activated by endogenous agonists or exogenous agonists. Non-limiting examples of endogenous agonists include hormones and neurotransmitters. Non-limiting examples of exogenous agonists include various classes of compounds, including small molecules, antibodies, synthetic peptides, etc. Agonists can be full agonists, partial agonists, or inverse agonists.

[0081] The term "antagonist" refers to a molecule that blocks or represses an agonist-mediated response when bound to a receptor rather than causing a biological response of its own. Many antagonists achieve their effectiveness by competing with endogenous ligands or substrates for structurally defined binding sites on receptors. Non-limiting examples of antagonists include alpha blockers, beta blockers, and calcium channel blockers. Antagonists can be competitive antagonists, noncompetitive antagonists, or noncompetitive antagonists.

[0082] As used herein, the term "pharmaceutical composition" refers to one or more of the compounds described herein, such as, for example, extracellular vesicles mixed or admixed or suspended therein with one or more other chemical components such as pharmaceutically acceptable carriers and excipients. One purpose of a pharmaceutical composition is to facilitate the administration of an extracellular vesicle preparation to a subject. The term "pharmaceutically acceptable" and its grammatical variations refer to compositions, carriers, diluents and agents that can be administered to a subject or onto a subject without producing undesirable physiological effects to the extent that prevents the administration of the composition. The term "excipient" or "carrier" refers to an inert substance added to a pharmaceutical composition to further facilitate the administration of a compound. The term "pharmaceutically acceptable carrier" or "pharmaceutically acceptable excipient" encompasses any of the agents approved by a regulatory agency of the U.S. federal government or listed in the U.S. Pharmacopoeia for Animals (including Humans), as well as any carrier or diluent that does not cause considerable irritation to the subject and does not abrogate the biological activity and properties of the administered compound. Excipients and carriers that are suitable for preparing pharmaceutical compositions and are generally safe, non-toxic and desirable are included.

[0083] As used herein, the terms "isolate / isolated / isolating" or "purify / purified / purifying" and "extracted / extracting" are used interchangeably and refer to the state of a preparation (e.g., a plurality of known or unknown amounts and / or concentrations) of desired extracellular vesicles that has been subjected to one or more purification processes (e.g., selection or enrichment of a desired extracellular vesicle preparation). In some embodiments, separation or purification as used herein is the process of removing, partially removing (e.g., eluting) extracellular vesicles from a sample containing production cells. In some embodiments, the isolated extracellular vesicle composition has no detectable undesirable activity, or alternatively, the level or amount of undesirable activity is equal to or below an acceptable level or amount. In other embodiments, the isolated extracellular vesicle composition has an amount and / or concentration of desired extracellular vesicles that is equal to or above an acceptable amount and / or concentration. In other embodiments, the isolated extracellular vesicle composition is enriched compared to the starting material (e.g., production cell preparation) from which the composition is obtained. Compared to the starting material, this enrichment can be 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, 99.9%, 99.999%, 99.9999%, or more than 99.9999%. In some embodiments, the isolated extracellular vesicle preparation is substantially free of residual biological products. In some embodiments, the isolated extracellular vesicle preparation is 100% free, 99% free, 98% free, 97% free, 96% free, or 95% free of any contaminating biological substances. Residual biological products may include non-biological materials (including chemicals) or undesirable nucleic acids, proteins, lipids, or metabolites. Substantially free of residual biological products can also mean that the extracellular vesicle composition does not contain detectable production cells, and only extracellular vesicles are detectable.

[0084] The term "administration / administering" and its variants refer to the introduction of a composition or agent such as an extracellular vesicle into a subject, and includes the introduction of one or more additional compositions or agents in parallel and sequentially according to any schedule consistent with producing a therapeutic effect. The dosage administration schedule may be selected to achieve a constant level (e.g., plasma level) of the administered agent in the subject, or to be exposed intermittently, for example, to reduce toxicity or prevent desensitization. Methods for achieving these results are well known to those of ordinary skill in the art based on known pharmacokinetic principles as described in, for example, The Pharmacological Basis of Therapeutics by Goodman and Gilman (Macmillan Publishing Co. 13th edition). The introduction of a composition or agent into a subject is carried out by any suitable route, including oral, pulmonary, intranasal, parenteral (intravenous, intraarterial, intramuscular, intraperitoneal or subcutaneous), rectal, intralymphatic, intrathecal, periocular, intratumoral or local. Administration includes self-administration and administration by others. Suitable routes of administration allow the composition or agent to perform its intended function. For example, if the appropriate route is intravenous, the composition is administered by introducing the composition or agent into a vein of the subject.

[0085] As used herein, the term "modulate / modulating", "modify" and / or "modulator" generally refers to the ability to change by increasing or decreasing, such as directly or indirectly promoting / stimulating / upregulating or interfering / inhibiting / downregulating a specific concentration, level, expression, function or behavior, such as (for example) to act as an antagonist or agonist. In some cases, a modulator may increase and / or reduce a specific concentration, level, activity or function relative to a control or relative to the average level of activity generally expected or relative to a control level of activity. The terms "inhibit", "repress", "regulate" are used herein to describe changes in the expression or activity of a target gene compared to conditions without one or more immunomodulatory components. Inhibition refers to the elimination or substantial elimination of gene expression or activity. Repression refers to the reduction of gene expression or activity, but not complete elimination or substantial elimination. Regulation means any change in gene expression or activity, either upward or downward.

[0086] The term "sufficient amount" means an amount sufficient to produce a desired effect, such as an amount sufficient to modulate a disorder in a subject.

[0087] The term "therapeutically effective amount" is an amount effective to improve the symptoms of a disease. Where prevention can be considered therapy, a therapeutically effective amount may be a "prophylactically effective amount".

[0088] The "identity" percentage between a nucleotide sequence and a reference sequence is defined as: after comparing the sequences and introducing a room (if necessary) to reach the maximum sequence identity percentage, the percentage of a single nucleotide in the nucleotide sequence that is identical to the single nucleotide in the reference sequence. The comparison for the purpose of measuring the nucleotide sequence identity percentage can be realized in a variety of ways belonging to the skills in this area, and the method, for example, uses publicly available computer software, such as BLAST, BLAST-2, ALIGN, MEGALIGN (DNASTAR), CLUSTALW, CLUSTAL OMEGA or MUSCLE software. Those skilled in the art can determine the appropriate parameters for comparing sequences, including obtaining any algorithm required for maximum comparison to the full length of the compared sequence. For more detailed information about the BLAST algorithm, see Mount, DW (2004). Bioinformatics: Sequence and Genome Analysis (2nd edition). Cold Spring Harbor Press. ISBN 978-0-87969-712-9.

[0089] The "identity" percentage between a polypeptide sequence and a reference sequence is defined as: after the alignment sequence is compared and a room is introduced (if necessary) to reach the maximum sequence identity percentage, the percentage of amino acid residues in the polypeptide sequence that are identical to the amino acid residues in the reference sequence. The comparison for the purpose of determining the amino acid sequence identity percentage can be realized in a variety of ways belonging to the skills in the art, such as using publicly available computer software, such as BLAST, BLAST-2, ALIGN, MEGALIGN (DNASTAR), CLUSTALW, CLUSTAL OMEGA or MUSCLE software. Those skilled in the art can determine the appropriate parameters for the alignment sequence, including obtaining any algorithm required for the maximum alignment for the full length of the compared sequence. For more detailed information on the BLAST algorithm, see Mount, DW (2004). Bioinformatics: Sequence and Genome Analysis (2nd edition). Cold Spring Harbor Press. ISBN 978-0-87969-712-9.

[0090] As used herein, the term "substantially" or "substantial" refers, for example, to the presence, level or concentration of an entity in a particular space, the effect of one entity on another entity, or a therapeutic effect. For example, if the increase is 2-fold, 3-fold, 4-fold, 5-fold, 10-fold, 50-fold, 100-fold, or 1000-fold relative to the baseline, the activity, level, or concentration of the entity is substantially increased. If the increase is 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, or 500% relative to the baseline, the activity, level, or concentration of the entity is also substantially increased.

[0091] The term "in vivo" refers to processes that occur in living organisms.

[0092] As used herein, the term "mammal" includes both human and non-human mammals.

[0093] Abbreviations used in this application include the following: “mRNA” refers to messenger RNA; “miRNA” refers to microRNA; “siRNA” refers to small interfering RNA; “antisense RNA” refers to single-stranded RNA complementary to mRNA, which may additionally contain DNA nucleotides and is often referred to as antisense oligonucleotides or “ASOs”; “shRNA” refers to small or short hairpin RNA; “lncRNA” refers to long noncoding RNA; and “dsDNA” refers to double-stranded DNA.

[0094] Composition

[0095] Aspects of the present disclosure include compositions capable of modulating the immune system. The composition comprises an extracellular vesicle comprising a cell membrane and at least one immunomodulatory component associated with the cell membrane or enclosed in a membrane-bound enclosure. The enclosure in the membrane-bound body can be achieved using techniques including electroporation, freeze drying, or by engineering production cells (such as, for example, HEK293 cells, Chinese hamster ovary (CHO) cells, and mesenchymal stem cells (MSCs)) to introduce constructs encoding immunomodulatory components such as nucleic acids (encoding ASOs) or proteins. Association with the cell membrane encompasses binding to the inner or outer lipid leaflets of the membrane and transmembrane insertion into the lipid bilayer. In some cases, membrane association is achieved using proteins (e.g., scaffold proteins or fragments thereof), such as, for example, prostaglandin F2 receptor negative regulator (PTGFRN); basic immunoglobulin (BSG); immunoglobulin superfamily member 2 (IGSF2); immunoglobulin superfamily member 3 (IGSF3); immunoglobulin superfamily member 8 (IGSF8); integrin beta-1 (ITGB1); integrin alpha-4 (ITGA4); 4F2 cell surface antigen heavy chain (SLC3A2); and a class AT P transporters (ATP1A1, ATP1A2, ATP1A3, ATP1A4, ATP1B3, ATP2B1, ATP2B2, ATP2B3, ATP2B4 have been identified as being highly enriched on the surface of exosomes that can provide elements of a fusion protein comprising a scaffold and an immunomodulatory component (as described in commonly owned U.S. Pat. No. 10,195,290). Such extracellular vesicles and exemplary techniques are described in detail in commonly owned U.S. Pat. No. 10,195,290, which is incorporated by reference for all purposes. Into this article. As described in shared U.S. Patent No. 10,195,290, surface engineered exosomes can be generated by chemical and / or physical methods such as PEG-induced fusion and / or ultrasound fusion to introduce these scaffold proteins (and fragments thereof) into exosomes or production cells. Complexes can be generated between exogenous therapeutic proteins and scaffold proteins. Alternatively, fusion proteins can be generated by conjugating scaffold proteins with exogenous therapeutic proteins (such as (for example) immunomodulatory proteins) and producing engineered exosomes containing complexes or fusion proteins on the surface, using the aforementioned chemical and / or physical methods. Natural full-length fragments or biologically active fragments of therapeutic proteins can be transported to the surface of exosomes by conjugation to scaffold proteins. Such exosomes can also be obtained from production cells containing exogenous sequences inserted into the cell genome. For example, exogenous sequences can be inserted into genomic sites at the 3' end or 5' end of the genomic sequence encoding PTGFRN, BSG, IGSF2, IGSF3, IGSF8, ITGB1, ITGA4, SLC3A2 or ATP transporter.For example, an exogenous sequence can be inserted into a genomic sequence encoding PTGFRN, BSG, IGSF2, IGSF3, IGSF8, ITGB1, ITGA4, SLC3A2, or an ATP transporter. Association with the cell membrane encompasses binding of the immunomodulatory component to an internal or external membrane surface, anchoring of the immunomodulatory component within a lipid bilayer, or extension of the immunomodulatory component via a lipid bilayer. As described in shared U.S. Patent No. 10,195,290, the immunomodulatory component can be tethered to a scaffold protein, or expressed as a fusion protein with a scaffold protein.

[0096] Extracellular vesicles

[0097] In various embodiments, the composition comprises an extracellular vesicle. In certain embodiments, the extracellular vesicle is a cell-derived vesicle comprising a membrane enclosing an interior space, as described in commonly owned US Patent No. 10,195,290.

[0098] In various embodiments, the extracellular vesicle can be a membrane-bound vesicle having a diameter smaller than the diameter of the cell from which it is derived. In some embodiments, the longest dimension of the extracellular vesicle is between about 20-1000 nm, such as about 20-100 nm, 20-200 nm, 20-300 nm, 20-400 nm, 20-500 nm, 20-600 nm, 20-700 nm, 20-800 nm, 20-900 nm, 30-100 nm, 30-200 nm, 30-300 nm, 30-400 nm, 30-500 nm, 30-600 nm, 30-700 nm, 30-800 nm, 20-900 nm, 30-100 nm, 30-200 nm, 30-300 nm, 30-400 nm, 30-500 nm, 30-600 nm, 30-800 nm, 3 ... m, 30-700nm, 30-800nm, 30-900nm, 40-100nm, 40-200nm, 40-300nm, 40-400nm, 40-500nm, 40-600nm, 40-700nm, 40-800nm, 40-900nm, 50-150nm, 50-500nm, 50-750nm, 100-200nm, 100-500nm or 500-1000nm.

[0099] In certain embodiments, the extracellular vesicle is an exosome. In certain embodiments, the extracellular vesicle is a nanovesicle. In certain embodiments, the extracellular vesicle is an apoptotic body. In certain embodiments, the extracellular vesicle is a cell fragment. In certain embodiments, the extracellular vesicle is a vesicle derived from a cell by direct or indirect manipulation. In certain embodiments, the extracellular vesicle is an organelle containing a vesicle. In various embodiments, the extracellular vesicle is a vesicle produced by a living cell.

[0100] In some embodiments, the extracellular vesicles are derived from living organisms. In some embodiments, the extracellular vesicles are derived from dead organisms. In some embodiments, the extracellular vesicles are derived from explanted tissues. In some embodiments, the extracellular vesicles are derived from explanted organs. In some embodiments, the extracellular vesicles are derived from cultured cells. In some of these embodiments, when the extracellular vesicles are generated in a cell culture system, the extracellular vesicles are further separated (for example, by separating the extracellular vesicles from the cultured cells). Separation can be achieved by sedimentation. For example, the specific density of the extracellular vesicles can be 0.5-2.0, 0.6-1.0, 0.7-1.0, 0.8-1.0, 0.9-1.0, 1.0-1.1, 1.1-1.2, 1.2-1.3, 1.4-1.5, 1.0-1.5, 1.5-2.0 and 1.0-2.0 kg / m 3 Between. Separation can also be achieved by affinity purification. For example, the extracellular vesicles can be purified by binding a group comprising extracellular vesicles to a resin, wherein the resin comprises a plurality of ligands having specific affinity for one or more proteins on the surface of the extracellular vesicles. The protein can be a tetraspanin (e.g., CD63, CD81, CD9), an EWI protein / immunoglobulin superfamily member (e.g., PTGFRN, IGSF8, IGSF3), an integrin (e.g., ITGB1, ITGA4), an ATP transporter (e.g., ATP1A1, ATP1A2, ATP1A3, ATP1A4, ATP1B3, ATP2B1, ATP2B2, ATP2B3, ATP2B4), SLC3A2, BSG, or CD98hc.

[0101] In various embodiments, the extracellular vesicle comprises lipids or fatty acids and polypeptides. In certain embodiments, the extracellular vesicle further comprises sugars. In certain embodiments, the extracellular vesicle further comprises polynucleotides.

[0102] In various embodiments, the extracellular vesicle membrane comprises an inner surface and an outer surface and closes the inner space. In some embodiments, the extracellular vesicle also comprises a payload, such as an immunomodulatory component as described herein. In certain embodiments, the payload is enclosed in the inner space. In certain embodiments, the payload is displayed on the outer surface of the extracellular vesicle. In certain embodiments, the payload spans the membrane of the extracellular vesicle. In various embodiments, the payload comprises nucleic acids, proteins, carbohydrates, lipids, small molecules and / or combinations thereof. The method for producing an extracellular vesicle with a payload includes electroporation, freeze drying and genetic engineering of production cells from which extracellular vesicles can be separated. See, for example, U.S. Patent No. 10,195,290 and the same. In some embodiments, the extracellular vesicle also comprises a receiver, i.e., a targeting moiety that can be specific to an organ, tissue or cell as described in U.S. Patent No. 10,195,290. A fusion protein with a targeting moiety is used. For example, the fusion protein may comprise PTGFRN, BSG, IGSF2, IGSF3, IGSF8, ITGB1, ITGA4, SLC3A2, ATP transporter or a fragment or variant thereof and a targeting moiety. The targeting moiety can be used to target exosomes to specific organs, tissues or cells for treatment using exosomes at any time. In some embodiments, the targeting moiety is an antibody or an antigen-binding fragment thereof. Antibodies and antigen-binding fragments thereof include complete antibodies, polyclonal antibodies, monoclonal antibodies and recombinant antibodies, fragments thereof, and also include single-chain antibodies, humanized antibodies, murine antibodies, chimeric monoclonal antibodies, mouse-human monoclonal antibodies, mouse-primate monoclonal antibodies, primate-human monoclonal antibodies, anti-idiotypic antibodies, antibody fragments (such as, for example, scFv, (scFv)2, Fab, Fab' and F(ab')2, F(ab1)2, Fv, dAb and Fd fragments), bifunctional antibodies and antibody-related polypeptides. Antibodies and antigen-binding fragments thereof also include bispecific antibodies and multispecific antibodies, as long as they exhibit the desired biological activity or function.

[0103] exosomes

[0104] In various embodiments, the extracellular vesicles are exosomes. In certain embodiments, exosomes are small membrane-bound vesicles secreted by production cells.

[0105] In some embodiments, the longest dimension of the exosomes from the producer cells is between about 20-300 nm, such as about 20-290 nm, 20-280 nm, 20-270 nm, 20-260 nm, 20-250 nm, 20-240 nm, 20-230 nm, 20-220 nm, 20-210 nm, 20-200 nm, 20-190 nm, 20-180 nm, 20-170 nm, 20-160 nm, 20-150 nm, 20-140 nm, 20-130 nm, 20-120 nm, 20-110 nm, 20-100 nm, 20-90 nm, 20-80 nm, 20-70 nm, 20-60 nm, 20-50nm, 20-40nm, 20-30nm, 30-300nm, 30-290nm, 30-280nm, 30-270nm , 30-260nm, 30-250nm, 30-240nm, 30-230nm, 30-220nm, 30-210nm, 30-200nm , 30-190nm, 30-180nm, 30-170nm, 30-160nm, 30-150nm, 30-140nm, 30-130n m, 30-120nm, 30-110nm, 30-100nm, 30-90nm, 30-80nm, 30-70nm, 30-60nm, 30 -50nm, 30-40nm, 40-300nm, 40-290nm, 40-280nm, 40-270nm, 40-260nm, 40- 250nm, 40-240nm, 40-230nm, 40-220nm, 40-210nm, 40-200nm, 40-190nm, 40- 180nm, 40-170nm, 40-160nm, 40-150nm, 40-140nm, 40-130nm, 40-120nm, 40 -110nm, 40-100nm, 40-90nm, 40-80nm, 40-70nm, 40-60nm, 40-50nm, 50-300n m, 50-290nm, 50-280nm, 50-270nm, 50-260nm, 50-250nm, 50-240nm, 50-230 nm, 50-220nm, 50-210nm, 50-200nm, 50-190nm, 50-180nm, 50-170nm, 50-160 nm, 50-150nm, 50-140nm, 50-130nm, 50-120nm, 50-110nm, 50-100nm, 50-90 nm, 50-80nm, 50-70nm, 50-60nm, 60-300nm, 60-290nm, 60-280nm, 60-270nm,60-260nm, 60-250nm, 60-240nm, 60-230nm, 60-220nm, 60-210nm, 60-200nm, 60-190nm, 60-180nm, 60-170nm, 60-160nm, 60-150nm, 60-140nm, 60-130nm, 60-120nm, 60-110nm, 60-100nm, 60-90nm, 60-80nm, 60-70nm, 70-300nm, 70-290nm, 70-280nm, 70-270nm, 70-2 60nm, 70-250nm, 70-240nm, 70-230nm, 70-220nm, 70-210nm, 70-200nm, 70-190nm, 70-180nm, 70-170nm, 70-160nm, 70-150nm, 70-14 0nm, 70-130nm, 70-120nm, 70-110nm, 70-100nm, 70-90nm, 70-80nm, 80-300nm, 80-290nm, 80-280nm, 80-270nm, 80-260nm, 80-250nm , 80-240nm, 80-230nm, 80-220nm, 80-210nm, 80-200nm, 80-190nm, 80-180nm, 80-170nm, 80-160nm, 80-150nm, 80-140nm, 80-130nm , 80-120nm, 80-110nm, 80-100nm, 80-90nm, 90-300nm, 90-290nm, 90-280nm, 90-270nm, 90-260nm, 90-250nm, 90-240nm, 90-230nm, 9 0-220nm, 90-210nm, 90-200nm, 90-190nm, 90-180nm, 90-170nm, 90-160nm, 90-150nm, 90-140nm, 90-130nm, 90-120nm, 90-110nm, 90-100nm, 100-300nm, 110-290nm, 120-280nm, 130-270nm, 140-260nm, 150-250nm, 160-240nm, 170-230nm, 180-220nm or 190-210nm.

[0106] In a particularly preferred embodiment, the longest dimension of the exosomes from the production cells described herein is between about 30-100nm. In another preferred embodiment, the longest dimension of the exosomes from the production cells is between about 20-300nm. In another preferred embodiment, the longest dimension of the exosomes from the production cells is between about 40-200nm. In another embodiment, the exosome population described herein comprises a population in which 90% of the exosomes have a longest dimension of 20-300nm. In another embodiment, the exosome population described herein comprises a population in which 95% of the exosomes have a longest dimension of 20-300nm. In another embodiment, the exosome population described herein comprises a population in which 99% of the exosomes have a longest dimension of 20-300nm. In another embodiment, the exosome population described herein comprises a population in which 90% of the exosomes have a longest dimension of 40-200nm. In another embodiment, the exosome population described herein comprises a population in which 95% of the exosomes have a longest dimension of 40-200nm. In another embodiment, the population of exosomes described herein comprises a population wherein 99% of the exosomes have a longest dimension of 40-200 nm. In other preferred embodiments, the size of the exosomes or population of exosomes described herein is measured according to the method described below.

[0107] In some embodiments, exosomes are produced by production cells. In some embodiments, the membrane of the exosomes comprises one or more molecules derived from production cells. In some embodiments, the exosomes are produced and separated in a cell culture system (e.g., by separating the exosomes from the production cells). Separation can be achieved by sedimentation. For example, the specific density of the exosomes can be 0.5-2.0, 0.6-1.0, 0.7-1.0, 0.8-1.0, 0.9-1.0, 1.0-1.1, 1.1-1.2, 1.2-1.3, 1.4-1.5, 1.0-1.5, 1.5-2.0 and 1.0-2.0 kg / m 3Between. Separation can also be achieved by affinity purification. For example, the extracellular vesicles can be purified by binding a group comprising extracellular vesicles to a resin, wherein the resin comprises a plurality of ligands with specific affinity for one or more proteins on the surface of the extracellular vesicles. The one or more proteins on the surface of the extracellular vesicles can be tetraspanins (e.g., CD63, CD81, and / or CD9), EWI proteins / immunoglobulin superfamily members (e.g., PTGFRN, IGSF8, and / or IGSF3), integrins (e.g., ITGB1 and / or ITGA4), ATP transporters (e.g., ATP1A1, ATP1A2, ATP1A3, ATP1A4, ATP1B3, ATP2B1, ATP2B2, ATP2B3, and / or ATP2B4), SLC3A2, BSG, or CD98hc. The protein may be additionally active as an immunomodulatory component displayed on the surface of exosomes, optionally via fusion to a polypeptide portion having a desired pharmacological activity, such as, for example, an antibody, antibody fragment, scFv, etc., having checkpoint inhibitory activity. Such antibodies are known in the art, such as ipilimumab targeting CTLA-4, nivolumab, semuximab, and pembrolizumab targeting PD-1, and atezolizumab, avelumab, and durvalumab, each targeting PD-L1 (see, e.g., Pardoll DM (March 2012). "The blockade of immune checkpoints in cancer immunotherapy". Nature Reviews. Cancer. 12(4): 252-64, which is incorporated herein by reference).

[0108] In some embodiments, the exosome membrane comprises an inner surface and an outer surface. In certain embodiments, the inner surface faces the inner core of the exosome. In certain embodiments, the outer surface may contact the membrane / cytoplasm of an endosome, a multivesicular body, or a producer cell or a target cell.

[0109] In some embodiments, the exosome membrane comprises lipids and fatty acids. In some embodiments, the exosome membrane comprises phospholipids, glycolipids, fatty acids, sphingolipids, phosphoglycerides, sterols, cholesterol and phosphatidylserine. In some embodiments, the lipids and fatty acids can be one or more of the lipids and fatty acids listed in Table 1.

[0110] In certain embodiments, the exosome comprises a lipid bilayer consisting of an inner leaflet and an outer leaflet. The composition of the inner leaflet and the outer leaflet can be determined by a cross-bilayer distribution assay known in the art, see, for example, Kuypers et al. Biohim Biophys Acta 1985 819:170. In some embodiments, the composition of the outer leaflet is between about 70%-90% choline phospholipids, between about 0%-15% acidic phospholipids, and between about 5%-30% phosphatidylethanolamine. In some embodiments, the composition of the inner leaflet is between about 15%-40% choline phospholipids, between about 10%-50% acidic phospholipids, and between about 30%-60% phosphatidylethanolamine.

[0111] In some embodiments, the exosome membrane further comprises one or more polypeptides. In certain embodiments, the exosome comprises one or more polypeptides selected from the following list, including but not limited to spectrin, myosin-like polypeptide, band 3, SLC4A1, actin, actin-like polypeptide, glyceraldehyde 3-P dehydrogenase (G3PD), tetraspanins (e.g., CD63, CD81 and / or CD9), Alix and TSG101, integrins (e.g., ITGB1 and / or ITGA4), selectins, CR1, TNFRI, proteolytic enzymes, glycosylphosphatidylinositol (GPI) linked proteins or histones, EWI proteins / immunoglobulin superfamily members (e.g., PTGFRN, IGSF8 and / or IGSF3), ATP transporters (e.g., ATP1A1, ATP1A2, ATP1A3, ATP1A4, ATP1B3, ATP2B1, ATP2B2, ATP2B3 and / or ATP2B4), SLC3A2, BSG or CD98hc). In some embodiments, the exosomes comprise at least one polypeptide selected from Table 2.

[0112] In some embodiments, the exosomes include polypeptides on their surface. In some embodiments, the exosomes are modified to contain one or more polypeptides. In some embodiments, the production cells are modified to contain one or more polypeptides. In some embodiments, the production cells naturally contain one or more polypeptides, and the exosomes derived therefrom also contain polypeptides. Any desired surface markers at a certain level can be modified directly on the exosomes (e.g., by contacting the complex with a recombinantly produced polypeptide to cause insertion into the complex membrane or conjugation with the complex membrane). Alternatively or in addition, any desired surface markers at a certain level can be modified directly on the production cells (e.g., by contacting the complex with a recombinantly produced polypeptide to cause insertion into the cell membrane or conjugation with the cell membrane). Alternatively, the production cells can be modified by transducing exogenous nucleic acids into the production cells to express the desired surface markers. The surface markers may already exist naturally on the production cells, in which case the exogenous constructs may lead to overexpression of the markers and an increase in the concentration of the markers inside or above the production cells. Alternatively, naturally expressed surface markers can be removed from production cells (e.g., by inducing gene silencing in production cells). Polypeptides can confer different functions to exosomes (e.g., specific targeting capabilities, delivery functions (e.g., fusion molecules), enzymatic functions, extended or shortened in vivo half-life, etc.). In some embodiments, polypeptides include, but are not limited to, CD47, CD55, CD49, CD40, CD133, CD59, Glypican-1, CD9, CD63, CD81, integrins, selectins, lectins, and cadherins.

[0113] In certain embodiments, the exosomes comprise one or more polypeptides on their surface, wherein the polypeptides are selected from a group of proteins recently identified as being enriched on the surface of exosomes (described in detail in co-owned U.S. Patent Applications 62 / 550,543 and PCT / US2018 / 048026, which are incorporated herein by reference in their entirety). This group of polypeptides includes prostaglandin F2 receptor negative regulator (PTGFRN); basic immunoglobulin (BSG); immunoglobulin superfamily member 3 (IGSF3); immunoglobulin superfamily member 8 (IGSF8); integrin beta-1 (ITGB1); integrin alpha-4 (ITGA4); 4F2 cell surface antigen heavy chain (SLC3A2); and a class of ATP transporters (ATP1A1, ATP1A2, ATP1A3, ATP1A4, ATP1B3, ATP2B1, ATP2B2, ATP2B3, ATP2B4)).

[0114] In various embodiments, one or more polypeptides on the surface of the exosomes comprise an antibody or an antigen-binding fragment. The antibody or antigen-binding fragment may be derived from a natural source or may be partially or completely produced synthetically. In some embodiments, the antibody is a monoclonal antibody. In some of these embodiments, the monoclonal antibody is an IgG antibody. In certain embodiments, the monoclonal antibody is IgG1, IgG2, IgG3, or IgG4. In some other embodiments, the antibody is a polyclonal antibody. In certain embodiments, the antigen-binding fragment is selected from Fab, Fab' and F(ab')2, F(ab1)2, Fv, dAb, and Fd fragments. In certain embodiments, the antigen-binding fragment is a scFv or (scFv)2 fragment. In certain other embodiments, the antibody or antigen-binding fragment is (Single domain antibody). In some embodiments, the antibody or antigen binding fragment is a bispecific antibody or a multispecific antibody. In various embodiments, the antibody or antigen binding fragment thereof binds to mesothelin.

[0115] In some embodiments, the exosomes comprise on their surface a fusion protein comprising (1) PTGFRN or a fragment thereof and (2) an antibody or an antigen-binding fragment thereof, wherein the antibody or the antigen-binding fragment thereof binds to PD-1, PD-1L, CSF1-R or other immunomodulatory components.

[0116] In some embodiments, the exosome membrane further comprises one or more polysaccharides, such as glycans.

[0117] In some embodiments, exosomes deliver a payload (therapeutic agent) to a target. The payload is a therapeutic agent that acts on a target (e.g., a target cell) that is in contact with the exosome. In certain embodiments, the payload is an immunomodulatory component, such as an inhibitory RNA. Contact may occur in vitro or in a subject. The payload that can be introduced into exosomes and / or production cells includes therapeutic agents, such as nucleotides (e.g., nucleotides containing a detectable portion or a toxin that destroys transcription), nucleic acids (e.g., DNA or mRNA molecules encoding polypeptides such as enzymes, or RNA molecules with regulatory functions such as miRNA, dsDNA, lncRNA, or siRNA), amino acids (e.g., amino acids containing a detectable portion or a toxin that destroys translation), polypeptides (e.g., enzymes), lipids, carbohydrates, small molecules (e.g., small molecule drugs and toxins), and combinations thereof. In certain embodiments, exosomes deliver more than one therapeutic agent. In certain embodiments, the therapeutic agent is one or more nucleic acids that inhibit one or more target genes. In certain embodiments, the therapeutic agent comprises an antibody and a nucleic acid. In certain embodiments, the therapeutic agent comprises a nucleic acid and a small molecule.In certain embodiments, the therapeutic agent comprises a CSF1R inhibitor, such as clinical candidate drugs piritinib, PLX7486, ARRY-382, JNJ-40346527, BLZ945, ematurumab, AMG820 and IMC-CS4, and other agents described in, e.g., Cannarile MA, Weisser M, Jacob W, Jegg AM, Ries CH, Rüttinger D (2017). "Colony-stimulating factor 1 receptor (CSF1R) inhibitors in cancer therapy". Journal for Immunotherapy of Cancer. 5(1):53; see also, e.g., Patel S, Player MR (2009). "Colony-stimulating factor-1 receptor inhibitors for the treatment of cancer and inflammatory disease". Curr Top Med Chem. 9:599-610, Cabiralizumab (cabira; FPA-008), a monoclonal antibody and in early clinical trials for metastatic pancreatic cancer (see A phase I / II dose escalation and expansion study of cabiralizumab (cabira; FPA-008), an anti-CSF1R antibody, intranasal giant cell tumor (TGCT, diffuse pigmented villonodular synovitis D-PVNS; A Study of Cabiralzumab Given by Itself or With Nivolumab in Advanced Cancer or Cancer That Has Spread; and Novel Combination Shows Promising Responses in Pancreatic Cancer Nov 2017). In certain embodiments, the therapeutic agent comprises an immune checkpoint inhibitor. In certain embodiments, the immune checkpoint inhibitor is among antibodies such as, for example, ipilimumab targeting CTLA-4, nivolumab, simvastatin, and pembrolizumab targeting PD-1, and atezolizumab, avelumab, and durvalumab, each targeting PD-L1.

[0118] Exosomes can interact with target cells via membrane fusion and deliver the payload (e.g., therapeutic agent) in the exosome composition to the surface or cytoplasm of the target cell. In some embodiments, membrane fusion occurs between the exosome and the plasma membrane of the target cell. In other embodiments, membrane fusion occurs between the exosome and the endosomal membrane of the target cell.

[0119] In some embodiments, the exosomes contain a receiver polypeptide. The receiver polypeptide can be synthetic. In some embodiments, the receiver polypeptide is introduced into the production cell (e.g., an exogenous nucleic acid encoding the receiver polypeptide is introduced into the production cell), or a recombinant receiver polypeptide is made outside the production cell (e.g., synthesized by a protein expression system). In some embodiments, the receiver polypeptide (e.g., a polypeptide produced in a recombinant manner) is directly introduced into the exosome (e.g., after the exosome is separated from the production cell). In some embodiments, the receiver polypeptide may be on the surface of the exosome. In some embodiments, the receiver polypeptide is capable of targeting the exosome to a specific target (e.g., a target such as a pathogen, metabolite, protein, polypeptide complex, or cell (such as a non-functional cell or cancer cell)) circulating in the subject's circulatory system (such as blood), or a target residing in a tissue (such as a diseased tissue).

[0120] In some embodiments, exosomes are synthetic. That is, exosomes are modified to add additional components after exosomes are recovered from production cells. For example, exosomes may contain a payload, such as, for example, a therapeutic polypeptide, a nucleic acid (such as DNA or RNA) or other polynucleotides, a polysaccharide or polysaccharide, a lipid or fatty acid, a large biological product, a small molecule or a toxin, which is not found in exosomes when recovered from production cells. In some embodiments, exosomes are modified (for example, by introducing a payload, or otherwise modifying the content of the complex, such as by changing the protein, lipid or polysaccharide content of the membrane). For example, exosomes are first separated from production cells and then modified as needed to generate synthetic exosomes. In some embodiments, production cells are modified. For example, exogenous nucleic acids, exogenous polypeptides or small molecules or toxins can be introduced into production cells. Alternatively or in addition, production cells can be modified in other ways (for example, by modifying cell or membrane content, such as by changing the lipid or polysaccharide content of the cell membrane). The exosomes generated by the modified producer cells comprise one or more of the modifications to the producer cells. The methods produce synthetic exosomes. In some embodiments, both the producer cells and the exosomes isolated from the producer cells are modified as described herein.

[0121] Nanovesicles

[0122] In various embodiments, the extracellular vesicle is a nanovesicle. In certain embodiments, the nanovesicle is a small vesicle of cell origin comprising a membrane that encloses the internal space, and the vesicle is generated by the cell by direct or indirect manipulation so that the nanovesicle is not produced by the cell without manipulation. Suitable manipulation of cells includes, but is not limited to, continuous extrusion, treatment with alkaline solutions, ultrasonic treatment, or a combination thereof, and in some cases, may result in damage to the production cells.

[0123] In various embodiments, the longest dimension of the nanovesicle is between about 20-250 nm, such as between about 20-100 nm, 20-150 nm, 20-200 nm, 30-100 nm, 30-150 nm, 30-200 nm, 30-250 nm, 40-100 nm, 40-150 nm, 40-200 nm, 40-250 nm, 50-100 nm, 50-150 nm, 50-200 nm, 50-250 nm, 100-200 nm, or 150-250 nm.

[0124] In various embodiments, the nanovesicles are derived from production cells. In certain embodiments, the nanovesicles are generated by production cells by direct or indirect manipulation. Suitable manipulations include, but are not limited to, continuous extrusion, treatment with alkaline solutions, ultrasonic treatment, or a combination thereof. In some of these embodiments, manipulation may result in damage to the production cells. In some preferred embodiments, the nanovesicle population is substantially free of vesicles derived from production cells by direct budding from the plasma membrane or fusion of late endosomes with the plasma membrane.

[0125] In some embodiments, the nanovesicles are separated from the production cells based on their size, density, biochemical parameters, or a combination thereof. In certain embodiments, separation can be achieved by sedimentation. For example, the specific density of the nanovesicles can be 0.5-2.0, 0.6-1.0, 0.7-1.0, 0.8-1.0, 0.9-1.0, 1.0-1.1, 1.1-1.2, 1.2-1.3, 1.4-1.5, 1.0-1.5, 1.5-2.0, and 1.0-2.0 kg / m 3 between.

[0126] In various embodiments, the nanovesicle comprises lipids or fatty acids and polypeptides. In certain embodiments, the nanovesicle further comprises sugars. In certain embodiments, the nanovesicle further comprises polynucleotides. In some embodiments, the nanovesicle further comprises a receptor. In some embodiments, the nanovesicle further comprises a payload. In some embodiments of these embodiments, the payload comprises nucleic acids, proteins, carbohydrates, lipids, small molecules and / or combinations thereof.

[0127] Immunomodulatory components

[0128] In one aspect, the extracellular vesicles, such as exosomes, comprise at least one immunomodulatory component that increases macrophage polarization from an M2 phenotype to an M1 phenotype. In one aspect, the increase from an M2 phenotype to an M1 phenotype is assessed relative to a reference sample comprising an M2 macrophage population. In one aspect, the increase achieved by the extracellular vesicles of the present disclosure is greater than or equal to the increase achieved by an equimolar amount of an individual immunomodulatory component. In certain embodiments, the immunomodulatory component is a polynucleotide that increases macrophage polarization. In certain embodiments, the polynucleotide is a nucleic acid that inhibits at least one gene such as, for example, proto-oncogenes and other types of genes, and such inhibition promotes increased polarization from an M2 phenotype to an M1 phenotype, wherein the at least one gene includes, for example but not limited to, the following genes: KRAS, HRAS, NRAS, HIF1-α, HIF1-β, Sp1, P300, LKB1, AMPK, STAT3, STAT6, n-MYC, c-MYC, HCAR1, A2AB, IDO, TDO, arginase, glutaminase, CEBP / β, Pi3Kγ, and PKM2. In certain embodiments, a combination of polynucleotides and proteinaceous immunomodulatory components is contemplated, including proteinaceous immunomodulatory components such as, for example, antibodies or antibody fragments targeting PD-1, PD-L1, CTLA-4 (such as, for example, ipilimumab targeting CTLA-4, nivolumab, semuximab and pembrolizumab targeting PD-1, and atezolizumab, avelumab, durvalumab, each targeting PD-L1), CSF1R inhibitors (such as, for example, clinical candidates piritinib, PLX7486, ARRY-382, JNJ-40346527, BLZ945, ematurumab, AMG820 and IMC-CS4 and described in, for example, Cannarile MA, Weisser M, Jacob W, Jegg AM, Ries CH, Rüttinger D (2017). "Colony-stimulating factor 1 receptor (CSF1R) inhibitors incancer therapy". Journal for Immunotherapy of Cancer. 5(1):53; see also, for example, Patel S, Player MR (2009). "Colony-stimulating factor-1 receptor inhibitors for the treatment of cancer and inflammatory disease". Curr Top Med Chem.9:599-610, cabiralizumab (cabira; FPA-008), a monoclonal antibody and used in early clinical trials for metastatic pancreatic cancer (see A phase I / II dose escalation and expansion study of cabiralizumab (cabira; FPA-008), an anti-CSF1R antibody, in tenosynovial giant cell tumor (TGCT, diffuse pigmented villonodular synovitis D-PVNS; A Study of Cabiralzumab Given by Itself or With Nivolumab in Advanced Cancer or Cancer That Has Spread; and Novel Combination Shows Promising Responses in Pancreatic Cancer Nov 2017, and other immunomodulatory components that can be used to treat cancer and inflammatory diseases.

[0129] In some of these embodiments, nucleic acid includes but is not limited to mRNA, miRNA, siRNA, antisense RNA, shRNA, lncRNA and dsDNA. In some embodiments, nucleic acid is RNA (e.g., mRNA, miRNA, siRNA, antisense RNA, shRNA or lncRNA). In some of these embodiments, when polynucleotide is mRNA, it can be translated into desired polypeptide. In some embodiments, polynucleotide is microRNA (miRNA), primary miRNA or precursor miRNA molecule. In some of these embodiments, miRNA is delivered to the cytoplasm of target cells so that miRNA molecules can silence natural mRNA in target cells. In some embodiments, polynucleotide is small interfering RNA (siRNA) or short hairpin RNA (shRNA) that can interfere with the expression of oncogenes or other abnormal polypeptides. In some of these embodiments, siRNA is delivered to the cytoplasm of target cells so that siRNA molecules can silence natural mRNA in target cells. In some embodiments, polynucleotide is antisense RNA complementary to mRNA. In some embodiments, polynucleotide is long non-coding RNA (lncRNA) that can regulate gene expression and regulate disease. In some embodiments, the polynucleotide is an antisense oligonucleotide (ASO). In various embodiments, the ASO is a single-stranded or double-stranded DNA, RNA, or DNA / RNA hybrid. See, for example, Antisense Oligodeoxynucleotides and Antisense RNA: Novel Pharmacological and Therapeutic Agents, CRC Press, Boca Raton, FL, 1997, which is incorporated herein by reference for all purposes.

[0130] In some embodiments, the polynucleotide is a DNA that can be transcribed into RNA. In some of these embodiments, the transcribed RNA can be translated into a desired polypeptide. In certain embodiments, the nucleic acid inhibits at least one gene consisting of KRAS, HRAS, NRAS, HIF1-α, HIF1-β, Sp1, P300, LKB1, AMPK, STAT3, STAT6, n-MYC, c-MYC, HCAR1, A2AB, IDO, TDO, arginase, CEBP / β, Pi3Kγ, glutaminase, and PKM2. In certain embodiments, the nucleic acid inhibits at least one gene consisting of STAT3, STAT6, CEBP / β, Pi3Kγ, KRAS, and HIF1-α. In certain embodiments, the nucleic acid inhibition is an inhibitory RNA that inhibits at least one gene consisting of KRAS, HRAS, NRAS, HIF1-α, HIF1-β, Sp1, P300, LKB1, AMPK, STAT3, STAT6, n-MYC, c-MYC, HCAR1, A2AB, IDO, TDO, arginase, CEBP / β, Pi3Kγ, glutaminase, and PKM2. In certain embodiments, the nucleic acid is an inhibitory RNA that inhibits at least one gene consisting of STAT3, STAT6, CEBP / β, Pi3Kγ, KRAS, and HIF1-α. In certain embodiments, the nucleic acid is an antisense oligonucleotide (ASO) that inhibits at least one gene consisting of: KRAS, HRAS, NRAS, HIF1-α, HIF1-β, Sp1, P300, LKB1, AMPK, STAT3, STAT6, n-MYC, c-MYC, HCAR1, A2AB, IDO, TDO, arginase, CEBP / β, Pi3Kγ, glutaminase, and PKM2. In certain embodiments, the nucleic acid is an antisense oligonucleotide (ASO) that inhibits at least one gene consisting of: STAT3, STAT6, CEBP / β, Pi3Kγ, KRAS, and HIF1-α. In certain embodiments, the nucleic acid inhibits the human KRAS proto-oncogene. In certain embodiments, the nucleic acid is an inhibitory RNA that inhibits the human KRAS proto-oncogene. In certain embodiments, the nucleic acid inhibits STAT3.

[0131] In some embodiments of the present disclosure, the nucleic acid is a known antisense oligonucleotide (ASO), examples of which are listed in Table 0. In certain embodiments, the ASO comprises a sequence that is at least 90% to 99% identical to a known ASO, such as an ASO listed in Table 0. In some embodiments, the ASO inhibits STAT3. In various embodiments, the ASO comprises a sequence that is at least 90% to 99% identical to TAAGCTGATAATTCAACTCA (SEQ ID NO: 1). In certain embodiments, the ASO comprises a sequence that is at least 90% identical to SEQ ID NO: 1. In certain embodiments, the ASO comprises a sequence that is at least 91% identical to SEQ ID NO: 1. In certain embodiments, the ASO comprises a sequence that is at least 92% identical to SEQ ID NO: 1. In certain embodiments, the ASO comprises a sequence that is at least 93% identical to SEQ ID NO: 1. In certain embodiments, the ASO comprises a sequence that is at least 94% identical to SEQ ID NO: 1. In certain embodiments, the ASO comprises a sequence that is at least 95% identical to SEQ ID NO: 1. In certain embodiments, the ASO comprises a sequence that is at least 96% identical to SEQ ID NO: 1. In certain embodiments, the ASO comprises a sequence that is at least 97% identical to SEQ ID NO: 1. In certain embodiments, the ASO comprises a sequence that is at least 98% identical to SEQ ID NO: 1. In certain embodiments, the ASO comprises a sequence that is at least 99% identical to SEQ ID NO: 1. In certain embodiments, the ASO comprises the sequence of SEQ ID NO: 1. In some embodiments, the ASO is modified by MOE, O-methyl or LNA chemistry. In some embodiments, the ASO further comprises a cholesterol tag at the 5' end or the 3' end.

[0132] In some embodiments, the nucleic acid is an antisense oligonucleotide (ASO) that inhibits STAT6. In various embodiments, the ASO comprises a sequence that is at least 90% to 99% identical to TGAGCGAATGGACAGGTCTT (SEQ ID NO: 2). In certain embodiments, the ASO comprises a sequence that is at least 90% identical to SEQ ID NO: 2. In certain embodiments, the ASO comprises a sequence that is at least 91% identical to SEQ ID NO: 2. In certain embodiments, the ASO comprises a sequence that is at least 92% identical to SEQ ID NO: 2. In certain embodiments, the ASO comprises a sequence that is at least 93% identical to SEQ ID NO: 2. In certain embodiments, the ASO comprises a sequence that is at least 94% identical to SEQ ID NO: 2. In certain embodiments, the ASO comprises a sequence that is at least 95% identical to SEQ ID NO: 2. In certain embodiments, the ASO comprises a sequence that is at least 96% identical to SEQ ID NO: 2. In certain embodiments, the ASO comprises a sequence that is at least 97% identical to SEQ ID NO: 2. In certain embodiments, the ASO comprises a sequence that is at least 98% identical to SEQ ID NO: 2. In certain embodiments, the ASO comprises a sequence that is at least 99% identical to SEQ ID NO: 2. In certain embodiments, the ASO comprises the sequence of SEQ ID NO: 2. In some embodiments, the ASO is modified by MOE, O-methyl, or LNA chemistry.

[0133] In some embodiments, the ASO further comprises a cholesterol tag at the 5' end or the 3' end.

[0134] In some embodiments, the nucleic acid is an antisense oligonucleotide (ASO) that inhibits CebpB. In various embodiments, the ASO comprises a sequence that is at least 90% to 99% identical to TGGATTTAAAGGCAGGCGGC (SEQ ID NO: 3). In certain embodiments, the ASO comprises a sequence that is at least 90% identical to SEQ ID NO: 3. In certain embodiments, the ASO comprises a sequence that is at least 91% identical to SEQ ID NO: 3. In certain embodiments, the ASO comprises a sequence that is at least 92% identical to SEQ ID NO: 3. In certain embodiments, the ASO comprises a sequence that is at least 93% identical to SEQ ID NO: 3. In certain embodiments, the ASO comprises a sequence that is at least 94% identical to SEQ ID NO: 3. In certain embodiments, the ASO comprises a sequence that is at least 95% identical to SEQ ID NO: 3. In certain embodiments, the ASO comprises a sequence that is at least 96% identical to SEQ ID NO: 3. In certain embodiments, the ASO comprises a sequence that is at least 97% identical to SEQ ID NO: 3. In certain embodiments, the ASO comprises a sequence that is at least 98% identical to SEQ ID NO: 3. In certain embodiments, the ASO comprises a sequence that is at least 99% identical to SEQ ID NO: 3. In certain embodiments, the ASO comprises the sequence of SEQ ID NO: 3. In some embodiments, the ASO is modified by MOE, O-methyl, or LNA chemistry.

[0135] In some embodiments, the ASO further comprises a cholesterol tag at the 5' end or the 3' end.

[0136] In some embodiments, the nucleic acid is an antisense oligonucleotide (ASO) that inhibits Pi3Kγ. In various embodiments, the ASO comprises a sequence that is at least 90% to 99% identical to TTGGGTAAAGTCGTGCAGCA (SEQ ID NO: 4). In certain embodiments, the ASO comprises a sequence that is at least 90% identical to SEQ ID NO: 4. In certain embodiments, the ASO comprises a sequence that is at least 91% identical to SEQ ID NO: 4. In certain embodiments, the ASO comprises a sequence that is at least 92% identical to SEQ ID NO: 4. In certain embodiments, the ASO comprises a sequence that is at least 93% identical to SEQ ID NO: 4. In certain embodiments, the ASO comprises a sequence that is at least 94% identical to SEQ ID NO: 4. In certain embodiments, the ASO comprises a sequence that is at least 95% identical to SEQ ID NO: 4. In certain embodiments, the ASO comprises a sequence that is at least 96% identical to SEQ ID NO: 4. In certain embodiments, the ASO comprises a sequence that is at least 97% identical to SEQ ID NO: 4. In certain embodiments, the ASO comprises a sequence that is at least 98% identical to SEQ ID NO: 4. In certain embodiments, the ASO comprises a sequence that is at least 99% identical to SEQ ID NO: 4. In certain embodiments, the ASO comprises the sequence of SEQ ID NO: 4. In some embodiments, the ASO is modified by MOE, O-methyl or LNA chemistry. In some embodiments, the ASO further comprises a cholesterol tag at the 5' end or the 3' end.

[0137] In some embodiments, the nucleic acid is an antisense oligonucleotide (ASO) that inhibits HIF1α. In various embodiments, the ASO comprises a sequence that is at least 90% to 99% identical to SEQ ID NO:5. In certain embodiments, the ASO comprises a sequence that is at least 90% identical to SEQ ID NO:5. In certain embodiments, the ASO comprises a sequence that is at least 91% identical to SEQ ID NO:5. In certain embodiments, the ASO comprises a sequence that is at least 92% identical to SEQ ID NO:5. In certain embodiments, the ASO comprises a sequence that is at least 93% identical to SEQ ID NO:5. In certain embodiments, the ASO comprises a sequence that is at least 94% identical to SEQ ID NO:5. In certain embodiments, the ASO comprises a sequence that is at least 95% identical to SEQ ID NO:5. In certain embodiments, the ASO comprises a sequence that is at least 96% identical to SEQ ID NO:5. In certain embodiments, the ASO comprises a sequence that is at least 97% identical to SEQ ID NO:5. In certain embodiments, the ASO comprises a sequence that is at least 98% identical to SEQ ID NO:5. In certain embodiments, the ASO comprises a sequence that is at least 99% identical to SEQ ID NO: 5. In certain embodiments, the ASO comprises the sequence of SEQ ID NO: 5. In some embodiments, the ASO is modified by MOE, O-methyl or LNA chemistry. In some embodiments, the ASO further comprises a cholesterol tag at the 5' end or the 3' end.

[0138] In some embodiments, the nucleic acid is an antisense oligonucleotide (ASO) that inhibits HIF1α. In various embodiments, the ASO comprises a sequence that is at least 90% to 99% identical to GTGCAGTATTGTAGCCAGGC (SEQ ID NO: 5). In certain embodiments, the ASO comprises a sequence that is at least 90% identical to SEQ ID NO: 5. In certain embodiments, the ASO comprises a sequence that is at least 91% identical to SEQ ID NO: 5. In certain embodiments, the ASO comprises a sequence that is at least 92% identical to SEQ ID NO: 5. In certain embodiments, the ASO comprises a sequence that is at least 93% identical to SEQ ID NO: 5. In certain embodiments, the ASO comprises a sequence that is at least 94% identical to SEQ ID NO: 5. In certain embodiments, the ASO comprises a sequence that is at least 95% identical to SEQ ID NO: 5. In certain embodiments, the ASO comprises a sequence that is at least 96% identical to SEQ ID NO: 5. In certain embodiments, the ASO comprises a sequence that is at least 97% identical to SEQ ID NO: 5. In certain embodiments, the ASO comprises a sequence that is at least 98% identical to SEQ ID NO: 5. In certain embodiments, the ASO comprises a sequence that is at least 99% identical to SEQ ID NO: 5. In certain embodiments, the ASO comprises the sequence of SEQ ID NO: 5. In some embodiments, the ASO is modified by MOE, O-methyl or LNA chemistry. In some embodiments, the ASO further comprises a cholesterol tag at the 5' end or the 3' end.

[0139] In some embodiments, the nucleic acid is an antisense oligonucleotide (ASO) that inhibits Kras. In various embodiments, the ASO comprises a sequence that is at least 90% to 99% identical to GTAGCATGTAAATATAGCCC (SEQ ID NO: 6). In certain embodiments, the ASO comprises a sequence that is at least 90% identical to SEQ ID NO: 6. In certain embodiments, the ASO comprises a sequence that is at least 91% identical to SEQ ID NO: 6. In certain embodiments, the ASO comprises a sequence that is at least 92% identical to SEQ ID NO: 6. In certain embodiments, the ASO comprises a sequence that is at least 93% identical to SEQ ID NO: 6. In certain embodiments, the ASO comprises a sequence that is at least 94% identical to SEQ ID NO: 6. In certain embodiments, the ASO comprises a sequence that is at least 95% identical to SEQ ID NO: 6. In certain embodiments, the ASO comprises a sequence that is at least 96% identical to SEQ ID NO: 6. In certain embodiments, the ASO comprises a sequence that is at least 97% identical to SEQ ID NO: 6. In certain embodiments, the ASO comprises a sequence that is at least 98% identical to SEQ ID NO: 6. In certain embodiments, the ASO comprises a sequence that is at least 99% identical to SEQ ID NO: 6. In certain embodiments, the ASO comprises the sequence of SEQ ID NO: 6. In some embodiments, the ASO is modified by MOE, O-methyl or LNA chemistry. In some embodiments, the ASO further comprises a cholesterol tag at the 5' end or the 3' end.

[0140] In certain embodiments, the composition comprises extracellular vesicles, such as exosomes, and an additional immunomodulatory component that is a small molecule, antibody, or antibody fragment known to promote macrophage polarization. In certain embodiments, the additional immunomodulatory component is a colony stimulating factor 1 receptor (CSF1R) inhibitor.

[0141] In certain embodiments, the composition comprises an additional immunomodulatory component with anti-tumor activity. In some embodiments, the additional immunomodulatory component modulates the innate immune response. In some of these embodiments, the additional immunomodulatory component targets natural killer cells. In some other embodiments, the additional immunomodulatory component modulates the adaptive immune response. In some of these embodiments, the additional immunomodulatory component targets cytotoxic T cells.

[0142] In some embodiments, the additional immunomodulatory components are located on the surface of the extracellular vesicle. In some embodiments, the additional immunomodulatory components are located inside the extracellular vesicle. In some embodiments, the additional immunomodulatory components are located both on the surface and inside the extracellular vesicle.

[0143] In some embodiments, the additional immunomodulatory component is expressed in its full-length form in the production cell. In other embodiments, the additional immunomodulatory component is expressed as a translational fusion protein with an exosome surface protein, which results in a higher level of expression of the biologically active portion of the immunomodulatory compound on the surface of the exosome. In some embodiments, the additional immunomodulatory compound is a soluble protein that is expressed as a translational fusion protein with an exosome surface protein such that the soluble protein is retained on the surface of the exosome.

[0144] In some embodiments, the additional immunomodulatory component is an inhibitor for negative checkpoint regulators such as (for example) A2AR, B7-H3 (CD276), B7-H4 (VTCN1), BTLA, CTLA-4, IDO, KIR, LAG3, NOX2, PD-1, TIM-3, VISTA, SIGLEC7 (CD328) and SIGLEC9 (CD329). In some embodiments, the additional immunomodulatory component is an inhibitor for binding partners of negative checkpoint regulators such as (for example) PD-L1 and PD-L2.

[0145] In certain embodiments, the additional immunomodulatory component is an inhibitor of cytotoxic T lymphocyte-associated protein 4 (CTLA-4). In some of these embodiments, the CTLA-4 inhibitor is a monoclonal antibody to CTLA-4. In certain embodiments, the inhibitor is a fragment of a monoclonal antibody to CTLA-4. In certain embodiments, the antibody fragment is a scFv, (scFv)2, Fab, Fab' and F(ab')2, F(ab1)2, Fv, dAb or Fd of a monoclonal antibody to CTLA-4. In certain embodiments, the inhibitor is a nanobody, a bispecific antibody or a multispecific antibody against CTLA-4. In some specific embodiments, the monoclonal antibody is ipilimumab. In some specific embodiments, the monoclonal antibody is tremelimumab.

[0146] In certain embodiments, the additional immunomodulatory component is an inhibitor of programmed cell death protein 1 (PD-1). In certain embodiments, the additional immunomodulatory component is an inhibitor of programmed death ligand 1 (PD-L1). In certain embodiments, the additional immunomodulatory component is an inhibitor of programmed death ligand 2 (PD-L2). In some embodiments, the inhibitor of PD-1, PD-L1 or PD-L2 is a monoclonal antibody of PD-1, PD-L1 or PD-L2. In certain embodiments, the inhibitor is a fragment of a monoclonal antibody of PD-1, PD-L1 or PD-L2. In certain embodiments, the antibody fragment is scFv, (scFv) 2, Fab, Fab' and F(ab') 2, F(ab1) 2, Fv, dAb or Fd of a monoclonal antibody of PD-1, PD-L1 or PD-L2. In certain embodiments, the inhibitor is a nanobody, a bispecific antibody or a multispecific antibody against PD-1, PD-L1 or PD-L2. In some specific embodiments, the monoclonal antibody is nivolumab. In some specific embodiments, the monoclonal antibody is pembrolizumab. In some specific embodiments, the monoclonal antibody is pidilizumab. In some specific embodiments, the monoclonal antibody is atezolizumab. In some specific embodiments, the monoclonal antibody is avelumab.

[0147] In certain embodiments, the additional immunomodulatory component is an inhibitor of lymphocyte activation gene 3 (LAG3). In some of these embodiments, the inhibitor of LAG3 is a monoclonal antibody to LAG3, such as (for example) BMS-986016 (see clinical trial number NCT01968109 "Safety Study of Anti-LAG-3 With and Without Anti-PD-1 in the Treatment of Solid Tumors" at ClinicalTrials.gov).

[0148] In certain embodiments, the additional immunomodulatory component is an inhibitor of protein 3 (TIM-3) containing T cell immunoglobulin mucin. In certain embodiments, the additional immunomodulatory component is an inhibitor of B lymphocytes and T lymphocyte attenuators (BTLA). In certain embodiments, the additional immunomodulatory component is an inhibitor of T cell immune receptors (TIGIT) with Ig domains and ITIM domains. In certain embodiments, the additional immunomodulatory component is an inhibitor of the V domain Ig inhibitory factor (VISTA) of T cell activation. In certain embodiments, the additional immunomodulatory component is an inhibitor of adenosine A2a receptor (A2aR). In certain embodiments, the additional immunomodulatory component is an inhibitor of killer cell immunoglobulin-like receptors (KIR). In certain embodiments, the additional immunomodulatory component is an inhibitor of indoleamine 2,3-dioxygenase (IDO). In certain embodiments, the additional immunomodulatory component is an inhibitor of CD20, CD39 or CD73.

[0149] In some embodiments, the additional immunomodulatory component is an activator for a positive co-stimulatory molecule. In some embodiments, the additional immunomodulatory component is an activator for a binding partner of a positive co-stimulatory molecule.

[0150] In some embodiments, additional immunomodulatory components are activators of TNF receptor superfamily members such as agonistic antibodies or natural ligands or TNF receptor superfamily members. In certain embodiments, TNF receptor superfamily members are selected from the group consisting of: CD120a, CD120b, CD18, OX40, CD40, Fas receptor, M68, CD27, CD30, 4-1BB, TRAILR1, TRAILR2, TRAILR3, TRAILR4, RANK, OCIF, TWEAK receptor, TACI, BAFF receptor, ATAR, CD271, CD269, GITR, TROY, CD358, TRAMP and XEDAR. In some embodiments, additional immunomodulatory components are TNF superfamily members. In certain embodiments, the TNF superfamily member is selected from the group consisting of TNFα, TNF-C, OX40L, CD40L, FasL, LIGHT, TL1A, CD27L, Siva, CD153, 4-1BB ligand, TRAIL, RANKL, TWEAK, APRIL, BAFF, CAMLG, NGF, BDNF, NT-3, NT-4, GITR ligand, and EDA-2.

[0151] In certain embodiments, the additional immunomodulatory component is an activator of TNF receptor superfamily member 4 (OX40). In some of these embodiments, the activator of OX40 is an agonist antibody of OX40. In some other of these embodiments, the activator of OX40 is OX40 ligand (OX40L).

[0152] In certain embodiments, the additional immunomodulatory component is an activator of CD27. In some of these embodiments, the activator of CD27 is an agonist antibody of CD27. In some other of these embodiments, the activator of CD27 is a CD27 ligand (CD27L).

[0153] In certain embodiments, the additional immunomodulatory component is an activator of CD40. In some of these embodiments, the activator of CD40 is an agonist antibody of CD40. In some other of these embodiments, the activator of CD40 is CD40 ligand (CD40L).

[0154] In certain embodiments, the additional immunomodulatory component is an activator of glucocorticoid-induced TNFR-related protein (GITR). In some of these embodiments, the activator of GITR is an agonist antibody of GITR. In some other of these embodiments, the activator of GITR is a natural ligand of GITR.

[0155] In certain embodiments, the additional immunomodulatory component is an activator of 4-1BB. In some of these embodiments, the activator of 4-1BB is an agonist antibody of 4-1BB. In some other embodiments of these embodiments, the activator of 4-1BB is a natural ligand of 4-1BB.

[0156] In some embodiments, the additional immunomodulatory component is a Fas receptor (Fas). In some of these embodiments, the Fas receptor is displayed on the surface of an extracellular vesicle. In some other embodiments, the additional immunomodulatory component is a Fas ligand (FasL). In some of these embodiments, the Fas ligand is displayed on the surface of an extracellular vesicle. In certain embodiments, the additional immunomodulatory component is an antibody to the Fas receptor. In certain embodiments, the additional immunomodulatory component is an antibody to the Fas ligand.

[0157] In some embodiments, the additional immunomodulatory component is an activator of a CD28 superfamily co-stimulatory molecule. In certain embodiments, the CD28 superfamily co-stimulatory molecule is ICOS or CD28. In certain embodiments, the additional immunomodulatory component is ICOSL, CD80 or CD86.

[0158] In certain embodiments, the additional immunomodulatory component is an activator of an inducible T cell co-stimulator (ICOS). In some of these embodiments, the activator of ICOS is an agonist antibody of ICOS. In some other of these embodiments, the activator of ICOS is an ICOS ligand (ICOSL).

[0159] In certain embodiments, the additional immunomodulatory component is an activator of CD28. In some of these embodiments, the activator of CD28 is an agonist antibody of CD28. In some other of these embodiments, the activator of CD28 is a natural ligand of CD28. In certain embodiments, the ligand of CD28 is CD80.

[0160] In certain embodiments, the additional immunomodulatory component is a cytokine. In some embodiments, the cytokine is a soluble cytokine that has been translationally fused to an exosome surface protein or fragment thereof. In some embodiments, the cytokine is IL-2. In some embodiments, the cytokine is IL-7. In some embodiments, the cytokine is IL-12. In some embodiments, the cytokine is IL-15.

[0161] In some embodiments, the additional immunomodulatory component is a T cell receptor (TCR) or a derivative thereof. In certain embodiments, the additional immunomodulatory component is a TCR alpha chain or a derivative thereof. In certain embodiments, the additional immunomodulatory component is a TCR beta chain or a derivative thereof. In some embodiments, the additional immunomodulatory component is a co-receptor or a derivative thereof of a T cell.

[0162] In some embodiments, the additional immunomodulatory component is a tumor antigen. In certain embodiments, the tumor antigen is selected from the group consisting of alpha-fetoprotein (AFP), carcinoembryonic antigen (CEA), epithelial tumor antigen (ETA), mucin 1 (MUC1), Tn-MUC1, mucin 16 (MUC16), tyrosinase, melanoma-associated antigen (MAGE), tumor protein p53 (p53), CD4, CD8, CD45, CD80, CD86, programmed death ligand 1 (PD-L1), programmed death ligand 2 (PD-L2), NY-ESO-1, PSMA, TAG-72, HER2, GD2, cMET, EGFR, mesothelin, VEGFR, alpha folate receptor, CE7R, IL-3, cancer-testis antigen, MART-1gp100 and TNF-related apoptosis-inducing ligand.

[0163] In certain embodiments, the tumor antigen is carcinoembryonic antigen (CEA). In certain embodiments, the tumor antigen is epithelial tumor antigen (ETA).

[0164] In certain embodiments, the tumor antigen is a mucin. In some of these embodiments, the mucin is a secreted mucin. In some other of these embodiments, the mucin is a transmembrane mucin. In specific embodiments, the tumor antigen is mucin 1 (MUC1). In specific embodiments, the tumor antigen is Tn-MUC1. In specific embodiments, the tumor antigen is mucin 16 (MUC16).

[0165] In certain embodiments, the tumor antigen is a melanoma associated antigen (MAGE). In some of these embodiments, the MAGE is a type I MAGE. In some other of these embodiments, the MAGE is a type II MAGE. In specific embodiments, the type I MAGE is MAGE-A2. In specific embodiments, the type I MAGE is MAGE-A4.

[0166] In certain embodiments, the tumor antigen is alpha-fetoprotein (AFP). In certain embodiments, the tumor antigen is tumor protein p53 (p53). In certain embodiments, the tumor antigen is tyrosinase. In certain embodiments, the tumor antigen is tyrosinase-related protein (TRP). In some embodiments, the tumor antigen is programmed death ligand 1 (PD-L1) or programmed death ligand 2 (PD-L2). In various embodiments, the tumor antigen is selected from the group consisting of: CD4, CD8, CD45, CD80 and CD86.

[0167] In some embodiments, the immunomodulatory component is a chimeric antigen receptor (CAR) or a derivative thereof. In some embodiments, CAR binds to one or more of the following: alpha-fetoprotein (AFP), carcinoembryonic antigen (CEA), epithelial tumor antigen (ETA), mucin 1 (MUC1), Tn-MUC1, mucin 16 (MUC16), tyrosinase, melanoma-associated antigen (MAGE), tumor protein p53 (p53), CD4, CD8, CD45, CD80, CD86, programmed death ligand 1 (PD-L1), programmed death ligand 2 (PD-L2), NY-ESO-1, PSMA, TAG-72, HER2, GD2, cMET, EGFR, mesothelin, VEGFR, alpha folate receptor, CE7R, IL-3, cancer-testis antigen, MART-1gp100 and TNF-related apoptosis-inducing ligand.

[0168] In some embodiments, the additional immunomodulatory component is an activator of a T cell receptor or a coreceptor. In certain embodiments, the additional immunomodulatory component is an activator of CD3. In certain embodiments, the activator is a fragment of a monoclonal antibody of CD3. In certain embodiments, the antibody fragment is scFv, (scFv) 2, Fab, Fab' and F(ab') 2, F(ab1) 2, Fv, dAb or Fd of a monoclonal antibody of CD3. In certain embodiments, the activator is a nanobody, a bispecific antibody or a multispecific antibody against CD3. In certain embodiments, the additional immunomodulatory component is an activator of CD28. In certain embodiments, the activator is a fragment of a monoclonal antibody of CD28. In certain embodiments, the antibody fragment is scFv, (scFv) 2, Fab, Fab' and F(ab') 2, F(ab1) 2, Fv, dAb or Fd of a monoclonal antibody of CD28. In certain embodiments, the activator is a nanobody, a bispecific antibody or a multispecific antibody against CD28.

[0169] In some embodiments, the additional immunomodulatory component is a major histocompatibility complex (MHC) or a derivative thereof. In some of these embodiments, the additional immunomodulatory component is a class I MHC or a derivative thereof. In some of these embodiments, the additional immunomodulatory component is a class II MHC or a derivative thereof. In some of these embodiments, the additional immunomodulatory component is a class III MHC or a derivative thereof.

[0170] In some embodiments, the additional immunomodulatory component is a human leukocyte antigen (HLA) or a derivative thereof. In some of these embodiments, the additional immunomodulatory component is HLA-A, HLA-B, HLA-C, or a derivative thereof. In some of these embodiments, the additional immunomodulatory component is HLA-E, HLA-F, HLA-G, or a derivative thereof. In some of these embodiments, the additional immunomodulatory component is HLA-DP, HLA-DQ, HLA-DR, or a derivative thereof.

[0171] In various embodiments, the immunomodulatory component can be a polypeptide, a polynucleotide, a polysaccharide, a lipid, a small molecule, or a toxin.

[0172] In some embodiments, the immunomodulatory component can be a protein, peptide, glycolipid, or glycoprotein.

[0173] In certain embodiments, the immunomodulatory component is an agonist. In some of these embodiments, the agonist is an endogenous agonist such as a hormone or a neurotransmitter. In some other embodiments of these embodiments, the agonist is an exogenous agonist such as a drug. In some embodiments, the agonist is a physical agonist that can produce an agonist reaction without being bound to a receptor. In some embodiments, the agonist is a superagonist that can produce a maximum response greater than that of an endogenous agonist. In certain embodiments, the agonist is a full agonist that has full efficacy on a receptor. In certain other embodiments, the agonist is a partial agonist that has only partial efficacy on a receptor relative to a full agonist. In some embodiments, the agonist is an inverse agonist that can inhibit the intrinsic activity of a receptor. In some embodiments, the agonist is a co-agonist that works with other co-agonists to produce an effect on a receptor. In certain embodiments, the agonist is an irreversible agonist that is permanently bound to a receptor via the formation of a covalent bond. In certain embodiments, the agonist is a selective agonist for a particular type of receptor.

[0174] In certain embodiments, the immunomodulatory component is an antagonist. In some embodiments in these embodiments, the antagonist is a competitive antagonist, which reversibly binds to the same binding site of the receptor with an endogenous ligand or agonist without activating the receptor. Competitive antagonists can affect the amount of the agonist necessary for achieving maximum response. In some other embodiments in these embodiments, the antagonist is a non-competitive antagonist, which binds to the active site of the receptor or the ectopic site of the receptor. Non-competitive antagonists can reduce the magnitude of the maximum response that can be obtained by any amount of agonist. In some other embodiments, the antagonist is a non-competitive antagonist, which needs to be activated by an agonist before it is combined with a separate ectopic binding site.

[0175] In various embodiments, the immunomodulatory component comprises an antibody or an antigen binding fragment. The immunomodulatory component can be a full-length protein or a fragment thereof. The antibody or antigen binding fragment can be derived from a natural source or produced partially or entirely synthetically. In some embodiments, the antibody is a monoclonal antibody. In some of these embodiments, the monoclonal antibody is an IgG antibody. In certain embodiments, the monoclonal antibody is IgG1, IgG2, IgG3 or IgG4. In some other embodiments, the antibody is a polyclonal antibody. In certain embodiments, the antigen binding fragment is selected from Fab, Fab' and F(ab')2, F(ab1)2, Fv, dAb and Fd fragments. In certain embodiments, the antigen binding fragment is a scFv or (scFv)2 fragment. In certain other embodiments, the antibody or antigen binding fragment is (Single domain antibody). In some embodiments, the antibody or antigen-binding fragment is a bispecific antibody or a multispecific antibody.

[0176] In various embodiments, the antibody or antigen binding fragment is fully human. In some embodiments, the antibody or antigen binding fragment is humanized. In some embodiments, the antibody or antigen binding fragment is chimeric. In some of these embodiments, the chimeric antibody has a non-human V region domain and a human C region domain. In some embodiments, the antibody or antigen binding fragment is non-human, such as mouse or livestock.

[0177] In some embodiments, the immunomodulatory component is a protein, peptide, glycolipid, or glycoprotein.

[0178] In various embodiments, the composition comprises two or more of the above-mentioned immunomodulatory components, including mixtures, fusions, combinations and conjugates of atoms, molecules, etc. In certain embodiments, the composition comprises a nucleic acid combined with a polypeptide. In certain embodiments, the composition comprises two or more polypeptides conjugated to each other. In certain embodiments, the composition comprises a protein conjugated to a bioactive molecule. In some embodiments of these embodiments, the bioactive molecule is a prodrug.

[0179] Pharmaceutical composition

[0180] The pharmaceutical composition generally comprises a plurality of extracellular vesicles and a pharmaceutically acceptable excipient or carrier in a form suitable for administration to a subject. The pharmaceutically acceptable excipient or carrier is determined in part by the specific composition administered and by the specific method for administering the composition. Therefore, there are a variety of suitable formulations of pharmaceutical compositions comprising a plurality of extracellular vesicles. (See, for example, Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa. 21st edition (2005)). Pharmaceutical compositions are generally formulated as sterile and fully comply with all Good Manufacturing Practice (GMP) regulations of the US Food and Drug Administration.

[0181] In some embodiments, the pharmaceutical composition comprises one or more therapeutic agents and an extracellular vesicle as described herein. In some embodiments, the extracellular vesicle is co-administered with one or more separate therapeutic agents, wherein co-administration includes administering the separate therapeutic agent before, after, or concurrently with the administration of the extracellular vesicle.

[0182] Pharmaceutically acceptable excipients include excipients that are generally safe, non-toxic and desirable, including excipients that are acceptable for veterinary use as well as human pharmaceutical use.

[0183] Examples of carriers or diluents include, but are not limited to, water, saline, Ringer's solution, dextrose solution, and 5% human serum albumin. The use of such media and compounds for pharmaceutically active substances is well known in the art. Unless any conventional media or compounds are incompatible with the extracellular vesicles described herein, their use in the composition is considered. Supplementary therapeutic agents may also be incorporated into the composition. Typically, the pharmaceutical composition is formulated to match its intended route of administration. The extracellular vesicles may be administered parenterally, topically, intravenously, orally, subcutaneously, intraarterially, intradermally, transdermally, rectally, intracranially, intraperitoneally, intranasally, intramuscularly, or in the form of an inhalant. In certain embodiments, a pharmaceutical composition comprising extracellular vesicles is administered intravenously (e.g., by injection). The extracellular vesicles may optionally be administered in combination with other therapeutic agents that are at least partially effective in treating the disease, disorder, or illness that the extracellular vesicles are intended to target.

[0184] The solution or suspension may include the following components: a sterile diluent such as water, saline solution, fixed oils, polyethylene glycol, glycerol, propylene glycol or other synthetic solvents; an antibacterial compound such as benzyl alcohol or methyl paraben; an antioxidant such as ascorbic acid or sodium bisulfite; a chelating compound such as ethylenediaminetetraacetic acid (EDTA); a buffer such as acetate, citrate or phosphate; and a compound for adjusting tonicity such as sodium chloride or dextrose. The pH can be adjusted with an acid or base such as hydrochloric acid or sodium hydroxide. The preparation may be enclosed in an ampoule, a disposable syringe or a multiple dose vial made of glass or plastic.

[0185] Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (if water soluble) or dispersions and sterile powders. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor EL TM(BASF, Parsippany, NJ) or phosphate buffered saline (PBS). Compositions are generally sterile and fluidity reaches a certain degree so that there is easy injectability. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyols (such as glycerol, propylene glycol and liquid polyethylene glycol, etc.) and their suitable mixtures. Suitable fluidity can be maintained, for example, by using a coating such as lecithin, by maintaining the desired particle size in the case of a dispersion, and by using a surfactant. The prevention of microbial action can be achieved by various antibacterial and antifungal compounds such as parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, etc. If necessary, isotonic compounds such as sugar, polyols (such as mannitol, sorbitol) and sodium chloride can be added to the composition. Extended absorption of injectable compositions can be achieved by including, for example, a compound that delays absorption of aluminum monostearate and gelatin in the composition.

[0186] Sterile injectable solutions can be prepared as needed by incorporating extracellular vesicles in an effective amount and in an appropriate solvent with one or a combination of ingredients listed herein. Generally speaking, dispersions are prepared by incorporating extracellular vesicles into a sterile vehicle containing a basic dispersion medium and any other desired ingredients. In the case of sterile powders for the preparation of sterile injectable solutions, the preparation method is vacuum drying and freeze drying, which produces a powder of the active ingredient plus any additional desired ingredients from a previously sterile filtered solution thereof. Extracellular vesicles can be administered in the form of a depot injection or implantable formulation, which can be formulated in a manner that allows for sustained or pulsatile release of extracellular vesicles.

[0187] Systemic administration of the composition comprising extracellular vesicles can also be performed by transmucosal means. For transmucosal administration, a penetrant suitable for the barrier to be penetrated is used in the formulation. Such penetrants are well known in the art and include, for example, detergents, bile salts, and fusidic acid derivatives for transmucosal administration. Transmucosal administration can be achieved using, for example, nasal sprays.

[0188] In certain embodiments, the pharmaceutical composition comprising extracellular vesicles is administered intravenously to a subject who would benefit from the pharmaceutical composition. In certain other embodiments, the composition is administered to the lymphatic system, for example by intralymphatic injection or by intranodal injection (see, e.g., Senti et al., PNAS 105(46): 17908 (2008)) or by intramuscular injection, by subcutaneous administration, by direct injection into the thymus, or into the liver.

[0189] In certain embodiments, the pharmaceutical composition comprising extracellular vesicles is administered in the form of a liquid suspension. In certain embodiments, the pharmaceutical composition is administered in the form of a formulation capable of forming a depot after administration. In certain preferred embodiments, the depot slowly releases the extracellular vesicles into the circulation, or remains in the form of a depot.

[0190] Typically, pharmaceutically acceptable compositions are highly purified to be free of contaminants, are biocompatible and non-toxic, and are suitable for administration to a subject. If water is a component of the carrier, the water is highly purified and treated to be free of contaminants such as endotoxins.

[0191] Pharmaceutically acceptable carriers can be lactose, dextrose, sucrose, sorbitol, mannitol, starch, gum arabic, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinyl pyrrolidone, cellulose, water, syrup, methylcellulose, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate and / or mineral oil, but are not limited thereto. The pharmaceutical composition may also include lubricants, wetting agents, sweeteners, flavor enhancers, emulsifiers, suspending agents and / or preservatives.

[0192] The pharmaceutical compositions described herein comprise the extracellular vesicles described herein and optionally a pharmaceutically active agent or therapeutic agent. The therapeutic agent can be a biological agent, a small molecule agent, or a nucleic acid agent.

[0193] Dosage forms are provided that contain the pharmaceutical compositions containing extracellular vesicles described herein. In some embodiments, the dosage form is formulated as a liquid suspension for intravenous injection.

[0194] In certain embodiments, the extracellular vesicle preparation is subjected to radiation, e.g., X-rays, gamma rays, beta particles, alpha particles, neutrons, protons, elemental nuclei, UV rays, in order to damage residual replication-competent nucleic acids.

[0195] In some embodiments, the extracellular vesicle preparation is subjected to gamma irradiation using an irradiation dose of more than 1, 5, 10, 15, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, 100, or more than 100 kGy.

[0196] In some embodiments, the extracellular vesicle preparation is subjected to X-ray irradiation using an irradiation dose of more than 0.1, 0.5, 1, 5, 10, 15, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000 or more than 10000 mSv.

[0197] method

[0198] Aspects of the present disclosure also include methods for producing compositions comprising extracellular vesicles and immunomodulatory components. In some embodiments, the method includes: obtaining extracellular vesicles from production cells, wherein the production cells naturally contain immunomodulatory components; and optionally isolating the obtained extracellular vesicles. In some embodiments, the method includes: modifying production cells with immunomodulatory components; obtaining extracellular vesicles from modified production cells; and optionally isolating the obtained extracellular vesicles. In some other embodiments, the method includes: obtaining extracellular vesicles from production cells; isolating the obtained extracellular vesicles; and modifying the isolated extracellular vesicles with immunomodulatory components. In certain embodiments, the method also includes formulating the isolated extracellular vesicles into a pharmaceutical composition.

[0199] Methods for producing extracellular vesicles

[0200] Methods for modifying producer cells with immunomodulatory components

[0201] In various embodiments, the method comprises modifying the producer cell with an immunomodulatory component.

[0202] The production cell can be a mammalian cell line, a plant cell line, an insect cell line, a fungal cell line, or a prokaryotic cell line. In certain embodiments, the production cell line is a mammalian cell line. Mammalian cell lines include, but are not limited to, human embryonic kidney (HEK) cell lines, Chinese hamster ovary (CHO) cell lines, HT-1080 cell lines, HeLa cell lines, PERC-6 cell lines, CEVEC cell lines, fibroblast cell lines, amniotic fluid cell lines, epithelial cell lines, and mesenchymal stem cell (MSC) cell lines. In some preferred embodiments, the mammalian cell line can be HEK-293 cells, BJ human foreskin fibroblasts, fHDF fibroblasts, Neuronal precursor cells, Amniotic fluid cells, adipose mesenchymal stem cells or RPTEC / TERT1 cells. The production cell can also be a primary cell. In various embodiments, the primary cell can be a primary mammalian cell, a primary plant cell, a primary insect cell, a primary fungal cell or a primary prokaryotic cell.

[0203] In certain preferred embodiments, the producer cell is an immune cell, such as a dendritic cell, a T cell, a B cell, a natural killer cell (NK cell), an antigen presenting cell, a macrophage, a T helper cell, or a regulatory T cell (Treg cell).

[0204] In various embodiments, the immunomodulatory components can be produced in the cell by transfection (see, e.g., Bacchetti S, Graham FL (April 1977). "Transfer of the gene for thymidine kinase to thymidine kinase-deficient human cells by purified herpes simplex viral DNA". Proceedings of the National Academy of Sciences of the United States of America. 74(4): 1590-4; Kriegler M (1991). Transfer and Expression: A Laboratory Manual. WH Freeman. pp. 96-97; Felgner PL, Gadek TR, Holm M, Roman R, Chan HW, Wenz M, Northrop JP, Ringold GM, Danielsen M (November 1987). "Lipofection: a highly efficient, lipid-mediated DNA-transfection procedure". Proceedings of the National Academy of Sciences of the United States of America.84(21):7413-7; Felgner JH, Kumar R, Sridhar CN, Wheeler CJ, Tsai YJ, Border R, Ramsey P, Martin M, Felgner PL (January 1994). "Enhanced gene delivery and mechanism studies with a novel series of cationic lipid formulations". The Journal of Biological Chemistry.269(4):2550-61), viral transduction (see, for example, Griffiths AJ, Miller JH, Suzuki DT, Lewontin RC, Gelbart WM (2000). "Transduction".An Introduction to Genetic Analysis (7th edition)), electroporation (see, for example, Neumann, E; Schaefer-Ridder, M; Wang, Y; Hofschneider, PH (1982). "Gene transfer into mouse lyoma cells by electroporation in high electric fields". The EMBO Journal. 1 (7): 841-5)), extrusion (see, for example, Sharei A, Zoldan J, Adamo A, Sim WY,Cho N,Jackson E,Mao S,Schneider S,Han MJ,Lytton-Jean A,Basto PA,Jhunjhunwala S,Lee J,Heller DA,Kang JW,Hartoularos GC,Kim KS,Anderson DG,Langer R,Jensen KF (February 2013)."A vector-free microfluidic platform for intracellular delivery".Proceedings of theNational Academy of Sciences of the United States of America.110(6):2082-7), sonication (see, e.g., Yizhi Song (2007). "Ultrasound-mediated DNA transfer for bacteria". Nucleic Acids Res.35(19):e129.), cell fusion (see, e.g., Felgner PL, Gadek TR, Holm M, Roman R, Chan HW, Wenz M, Northrop JP, Ringold GM, Danielsen M (November 1987). "Lipofection: a highly efficient, lipid-mediated DNA-transfection procedure". Proceedings of the National Academy of Sciences of the United States of America.84(21):7413-), or other methods known to those skilled in the art to introduce transgenes or mRNA expression into production cells.

[0205] In certain embodiments, immunomodulatory components are introduced into production cells by transfection. In some embodiments, synthetic macromolecules such as cationic lipids and polymers can be used to introduce immunomodulatory components into suitable production cells (Papapetrou et al., Gene Therapy 12: S118-S130 (2005)). In some embodiments, cationic lipids form complexes with immunomodulatory components via charge interactions. In some embodiments of these embodiments, positively charged complexes are bound to negatively charged cell surfaces and taken up by cells through endocytosis. In some other embodiments, cationic polymers can be used for transfection production cells. In some embodiments of these embodiments, cationic polymers are polyethyleneimine (PEI). In certain embodiments, chemicals such as calcium phosphate, cyclodextrin or polybrene can be used to introduce immunomodulatory components into production cells. Physical methods such as particle-mediated transfection, "gene guns (gene gun)", gene guns (biolistics) or particle bombardment techniques can also be used to introduce immunomodulatory components into production cells (Papapetrou et al., Gene Therapy 12: S118-S130 (2005)). Reporter genes such as, for example, β-galactosidase, chloramphenicol acetyltransferase, luciferase, or green fluorescent protein can be used to assess the transfection efficiency of producer cells.

[0206] In certain embodiments, the immunomodulatory components are introduced into the production cells by viral transduction. A variety of viruses can be used as gene transfer vehicles, including Moloney murine leukemia virus (MMLV), adenovirus, adeno-associated virus (AAV), herpes simplex virus (HSV), lentivirus, and foamy virus. Virus-mediated gene transfer vehicles include vectors based on DNA viruses such as adenovirus, adeno-associated virus, and herpes virus, as well as retrovirus-based vectors.

[0207] In certain embodiments, immunomodulatory components are introduced into production cells by electroporation. Electroporation creates transient pores in the cell membrane, allowing various molecules to be introduced into the cell. In some embodiments, DNA and RNA as well as polypeptide and non-polypeptide therapeutic agents can be introduced into production cells by electroporation.

[0208] In certain embodiments, the immunomodulatory components are introduced into the production cells by microinjection.In some embodiments, a glass micropipette can be used to inject the immunomodulatory components into the production cells at microscopic levels.

[0209] In certain embodiments, the immunomodulatory components are introduced into the producer cells by extrusion.

[0210] In certain embodiments, the immunomodulatory components are introduced into the production cells by sonication. In some embodiments, the production cells are exposed to high intensity sound waves, causing transient disruption of the cell membrane, thereby allowing loading of the immunomodulatory components.

[0211] In certain embodiments, immunomodulatory components are introduced into production cells by cell fusion. In some embodiments, immunomodulatory components are introduced by electrical cell fusion. In some other embodiments, polyethylene glycol (PEG) is used to fuse production cells. In some other embodiments, Sendai virus is used to fuse production cells.

[0212] In some embodiments, immunomodulatory components are introduced into production cells by hypotonic dissolution. In some embodiments in these embodiments, production cells are exposed to low ionic strength buffers to break them, thereby allowing the loading of immunomodulatory components. In some alternative embodiments, controlled dialysis for hypotonic solutions is used to swell production cells and produce pores in production cell membranes. Subsequently, production cells are exposed to conditions that allow resealing of the membrane.

[0213] In some embodiments, the immunomodulatory components are introduced into the production cells by detergent treatment. In certain embodiments, the production cells are treated with a mild detergent, which transiently damages the production cell membrane by creating pores, thereby allowing the loading of the immunomodulatory components. After loading the production cells, the detergent is washed off, thereby resealing the membrane.

[0214] In some embodiments, the immunomodulatory component is introduced into the production cell by receptor-mediated endocytosis.In certain embodiments, the production cell has a surface receptor that, upon binding the immunomodulatory component, induces internalization of the receptor and the associated immunomodulatory component.

[0215] In some embodiments, the immunomodulatory components are introduced into the production cells by filtration. In certain embodiments, the production cells and immunomodulatory components can be forced through a filter with a pore size smaller than the production cells, causing transient disruption of the production cell membrane and allowing the immunomodulatory components to enter the production cells.

[0216] In some embodiments, producer cells are subjected to several freeze-thaw cycles, causing disruption of the cell membrane, thereby allowing loading of immunomodulatory components.

[0217] Methods for modifying extracellular vesicles with immunomodulatory components

[0218] In various alternative embodiments, the immunomodulatory components are introduced directly into the extracellular vesicles following isolation of the extracellular vesicles.

[0219] In certain embodiments, immunomodulatory components are introduced into extracellular vesicles by transfection. In some embodiments, synthetic macromolecules such as cationic lipids and polymers can be used to introduce immunomodulatory components into extracellular vesicles (Papapetrou et al., Gene Therapy 12: S118-S130 (2005)). In certain embodiments, chemicals such as calcium phosphate, cyclodextrin or polybrene can be used to introduce immunomodulatory components into extracellular vesicles.

[0220] In certain embodiments, the immunomodulatory components are introduced into the extracellular vesicles by electroporation. In some embodiments, the extracellular vesicles are exposed to an electric field, which creates transient pores in the extracellular vesicle membrane, thereby allowing the loading of the immunomodulatory components.

[0221] In certain embodiments, the immunomodulatory components are introduced into the extracellular vesicles by microinjection. In some embodiments, a glass micropipette can be used to directly inject the immunomodulatory components into the extracellular vesicles at a micro level.

[0222] In certain embodiments, the immunomodulatory components are introduced into extracellular vesicles by extrusion.

[0223] In certain embodiments, the immunomodulatory components are introduced into the extracellular vesicles by sonication. In some embodiments, the extracellular vesicles are exposed to high intensity sound waves, causing transient disruption of the extracellular vesicle membrane, thereby allowing loading of the immunomodulatory components.

[0224] In some embodiments, the immunomodulatory component can be conjugated to the surface of the extracellular vesicle. The conjugation can be achieved chemically or enzymatically by methods known in the art.

[0225] In some embodiments, the extracellular vesicle comprises a chemically conjugated immunomodulatory component. Chemical conjugation can be achieved by covalently bonding the immunomodulatory component to another molecule with or without a linker. The formation of such conjugates is within the skill of the technician and is known to be used to achieve various techniques for conjugation, and a specific technique guided by the material to be conjugated is selected. In certain embodiments, a polypeptide is conjugated to an extracellular vesicle. In certain other embodiments, non-polypeptides such as lipids, carbohydrates, nucleic acids, and small molecules are conjugated to an extracellular vesicle.

[0226] In some embodiments, immunomodulatory components are introduced into extracellular vesicles by hypotonic dissolution. In some of these embodiments, the extracellular vesicles are exposed to low ionic strength buffers to rupture them, thereby allowing the loading of immunomodulatory components. In some alternative embodiments, controlled dialysis for hypotonic solutions is used to swell the extracellular vesicles and create pores in the extracellular vesicle membrane. Subsequently, the extracellular vesicles are exposed to conditions that allow the membrane to be resealed.

[0227] In some embodiments, the immunomodulatory components are introduced into the extracellular vesicles by detergent treatment. In certain embodiments, the extracellular vesicles are treated with a mild detergent, which transiently damages the extracellular vesicle membrane by creating pores, thereby allowing the loading of the immunomodulatory components. After the extracellular vesicles are loaded, the detergent is washed off, thereby resealing the membrane.

[0228] In some embodiments, the immunomodulatory component is introduced into the extracellular vesicle by receptor-mediated endocytosis. In certain embodiments, the extracellular vesicle has a surface receptor that, upon binding to the immunomodulatory component, induces internalization of the receptor and the associated immunomodulatory component.

[0229] In some embodiments, the immunomodulatory component is introduced into the extracellular vesicle by mechanical combustion. In certain embodiments, the extracellular vesicle can be bombarded with the immunomodulatory component attached to heavy particles or charged particles such as gold microcarriers. In some of these embodiments, the particles can be accelerated mechanically or electrically so that the particles traverse the extracellular vesicle membrane.

[0230] In some embodiments, the immunomodulatory components are introduced into the extracellular vesicles by filtration. In certain embodiments, the extracellular vesicles and the immunomodulatory components can be forced through a filter having a pore size smaller than that of the extracellular vesicles, causing transient disruption of the extracellular vesicle membrane and allowing the immunomodulatory components to enter the extracellular vesicles.

[0231] In some embodiments, the extracellular vesicles are subjected to several freeze-thaw cycles, causing disruption of the extracellular vesicle membrane, thereby allowing loading of immunomodulatory components.

[0232] Methods for isolating extracellular vesicles

[0233] The extracellular vesicles can be separated from the production cells. In certain embodiments, the extracellular vesicles are released into the cell culture medium by the production cells. It is expected that all known ways of separating extracellular vesicles are considered to be applicable herein. For example, the physical properties of the extracellular vesicles can be used to separate the extracellular vesicles from the medium or other source materials, including separation based on charge (e.g., electrophoretic separation), separation based on size (e.g., filtration, molecular sieving, etc.), separation based on density (e.g., conventional centrifugation or gradient centrifugation), separation based on Svedberg constant (e.g., sedimentation with or without external force, etc.). Alternatively or in addition, separation can be based on one or more biological properties, and includes methods that can use surface markers (e.g., for precipitation, reversible binding to a solid phase, FACS separation, specific ligand binding, non-specific ligand binding, affinity purification, etc.).

[0234] Separation and enrichment can be performed in a general and non-selective manner, typically including continuous centrifugation. Alternatively, separation and enrichment can be performed in a more specific and selective manner, such as using extracellular vesicles or producing cell-specific surface markers. For example, specific surface markers can be used for immunoprecipitation, FACS sorting, affinity purification, and magnetic separation of bead-bound ligands.

[0235] In some embodiments, size exclusion chromatography can be used to separate extracellular vesicles. Size exclusion chromatography techniques are known in the art. Exemplary non-limiting techniques are provided herein. In some embodiments, the void volume fraction is separated and contains target extracellular vesicles. In addition, in some embodiments, the extracellular vesicles can be further separated after chromatographic separation by centrifugation techniques (to one or more chromatography fractions) as known in the art. In some embodiments, for example, density gradient centrifugation can be used to further separate extracellular vesicles. In certain embodiments, it may be desirable to further separate extracellular vesicles from production cell sources and extracellular vesicles from other origins. For example, production cell-derived extracellular vesicles can be separated from non-production cell-derived extracellular vesicles by immunoabsorption capture using antigen antibodies specific to production cells.

[0236] In some embodiments, extracellular vesicle isolation may involve a combination of methods including, but not limited to, differential centrifugation, size-based membrane filtration, immunoprecipitation, FACS sorting, and magnetic separation.

[0237] Methods for measuring extracellular vesicle size

[0238] In some embodiments, the methods described herein include measuring the size of an extracellular vesicle and / or a population of extracellular vesicles. Generally, the extracellular vesicle size measurement is the longest measurable dimension. Generally, the longest measurable dimension of an extracellular vesicle is also referred to as its diameter.

[0239] Extracellular vesicle size can be measured using dynamic light scattering (DLS) and / or multi-angle light scattering (MALS). Methods for measuring extracellular vesicle size using DLS and / or MALS are known to those skilled in the art and include nanoparticle tracking assays (NTA, for example using a Malvern NanoSight NS300 nanoparticle tracking device). In certain embodiments, extracellular vesicle size is measured using a Malvern NanoSight NS300. In some embodiments, the longest dimension of the extracellular vesicles described herein is about 20-300 nm as measured by NTA (e.g., using a Malvern NanoSight NS300). In other embodiments, the longest dimension of the extracellular vesicles described herein is about 40-200 nm as measured by NTA (e.g., using a Malvern NanoSight NS300). In other embodiments, the extracellular vesicle populations described herein comprise a population in which 90% of the extracellular vesicles have a longest dimension of about 20-300 nm as measured by NTA (e.g., using a Malvern NanoSight NS300). In other embodiments, the extracellular vesicle populations described herein comprise a population in which 95% of the extracellular vesicles have a longest dimension of about 20-300 nm as measured by NTA (e.g., using a Malvern NanoSight NS300). In other embodiments, the extracellular vesicle populations described herein comprise a population in which 99% of the extracellular vesicles have a longest dimension of about 20-300 nm as measured by NTA (e.g., using a Malvern NanoSight NS300). In other embodiments, the extracellular vesicle populations described herein comprise a population in which 90% of the extracellular vesicles have a longest dimension of about 40-200 nm as measured by NTA (e.g., using a Malvern NanoSight NS300). In other embodiments, the extracellular vesicle population described herein comprises a population in which 95% of the extracellular vesicles have a longest dimension of about 40-200 nm as measured by NTA (e.g., using a Malvern NanoSight NS300). In other embodiments, the extracellular vesicle population described herein comprises a population in which 99% of the extracellular vesicles have a longest dimension of about 40-200 nm as measured by NTA (e.g., using a Malvern NanoSight NS300).

[0240] Extracellular vesicle size can be measured using adjustable resistive pulse sensing (TRPS). In certain embodiments, iZON qNANO Gold is used to determine the size of extracellular vesicles as measured by TRPS. In some embodiments, as measured by TRPS (e.g., using iZON qNano Gold), the longest dimension of the extracellular vesicles described herein is about 20-300nm. In other embodiments, as measured by TRPS (e.g., iZON qNano Gold), the longest dimension of the extracellular vesicles described herein is about 40-200nm. In other embodiments, the extracellular vesicle populations described herein include a population, wherein as measured by TRPS (e.g., using iZON qNano Gold), 90% of the extracellular vesicles have a longest dimension of about 20-300nm. In other embodiments, the extracellular vesicle populations described herein include a population, wherein as measured by TRPS (e.g., using iZON qNano Gold), 95% of the extracellular vesicles have a longest dimension of about 20-300nm. In other embodiments, the extracellular vesicle populations described herein comprise a population in which 99% of the extracellular vesicles have a longest dimension of about 20-300 nm as measured by TRPS (e.g., using iZON qNanoGold). In other embodiments, the extracellular vesicle populations described herein comprise a population in which 90% of the extracellular vesicles have a longest dimension of about 40-200 nm as measured by TRPS (e.g., using iZON qNano Gold). In other embodiments, the extracellular vesicle populations described herein comprise a population in which 95% of the extracellular vesicles have a longest dimension of about 40-200 nm as measured by TRPS (e.g., using iZON qNano Gold). In other embodiments, the extracellular vesicle populations described herein comprise a population in which 99% of the extracellular vesicles have a longest dimension of about 40-200 nm as measured by TRPS (e.g., using iZON qNano Gold).

[0241] The size of the extracellular vesicles can be measured using electron microscopy. In some embodiments, the electron microscopy used to measure the size of the extracellular vesicles is transmission electron microscopy. In a specific embodiment, the transmission electron microscope used to measure the size of the extracellular vesicles is a Tecnai TM G 2 Spirit BioTWIN. Methods for measuring the size of extracellular vesicles using electron microscopy are well known to those skilled in the art, and any such method may be suitable for measuring the size of extracellular vesicles. In some embodiments, such as by scanning electron microscopy (e.g., Tecnai TM G2 The longest dimension of the extracellular vesicles described herein is about 20-300 nm as measured by a scanning electron microscope (e.g., a Tecnai BioTWIN scanning electron microscope). TM G 2 The longest dimension of the extracellular vesicles described herein is about 40-200 nm as measured by a scanning electron microscope (e.g., a Tecnai BioTWIN scanning electron microscope). In other embodiments, the extracellular vesicle populations described herein comprise a population wherein the extracellular vesicles are approximately 40-200 nm in length as measured by a scanning electron microscope (e.g., a Tecnai TM G 2 Spirit BioTWIN scanning electron microscope), 90% of the extracellular vesicles have a longest dimension of about 20-300 nm. In other embodiments, the extracellular vesicle population described herein comprises a population wherein as measured by scanning electron microscopy (e.g., Tecnai TM G 2 Spirit BioTWIN scanning electron microscope), 95% of the extracellular vesicles have a longest dimension of about 20-300 nm. In other embodiments, the extracellular vesicle populations described herein comprise a population wherein the longest dimension of the extracellular vesicles is about 20-300 nm as measured by scanning electron microscopy (e.g., Tecnai TM G 2 Spirit BioTWIN scanning electron microscope), 99% of the extracellular vesicles have a longest dimension of about 20-300 nm. In other embodiments, the extracellular vesicle populations described herein comprise a population wherein as measured by scanning electron microscopy (e.g., Tecnai TM G 2 Spirit BioTWIN scanning electron microscope), 90% of the extracellular vesicles have a longest dimension of about 40-200 nm. In other embodiments, the extracellular vesicle population described herein comprises a population wherein as measured by scanning electron microscopy (e.g., Tecnai TM G 2 Spirit BioTWIN scanning electron microscope), 95% of the extracellular vesicles have a longest dimension of about 40-200 nm. In other embodiments, the extracellular vesicle populations described herein comprise a population wherein the longest dimension of the extracellular vesicles is about 40-200 nm as measured by scanning electron microscopy (e.g., Tecnai TM G 2 As measured by a Spirit BioTWIN scanning electron microscope, 99% of the extracellular vesicles have a longest dimension of approximately 40-200 nm.

[0242] Methods for measuring macrophage polarization

[0243] Disclosed herein are methods and compositions for increasing macrophage polarization from an M2 phenotype to an M1 phenotype using extracellular vesicles containing one or more immunomodulatory components that inhibit macrophage target gene expression. The composition is preferentially taken up by macrophages (compared to other cell types such as T cells, B cells, macrophages, or dendritic cells), and is as effective or more effective than an equimolar amount of an individual immunomodulatory component in increasing macrophage polarization. The method for determining macrophage polarization, including detecting the M2 and M1 phenotypes of macrophages, can be performed by any method known in the art for determining M2 and M1 phenotypes. Tissue sections (e.g., from tumor biopsies), blood samples, and the like can be assayed (e.g., stained) for markers of pan-macrophages and M2 and M1 macrophages, including, but not limited to, M2 cell surface markers (e.g., YM1, FIZZ1, Dectin-1, MGL), M2-associated cytokines (e.g., IL-10, TGFβ, PGE2, CCL2, CCL17, CCL18, CCL22, and CCL24), M1-associated cytokines (e.g., INFγ, IL-12, IL-23, TNFα, IL-6, IL-1, CCL5, CSCL9, CXCL10, and CXCL11), growth factors (e.g., VEGF-A, VEGF-C, EGF, and TGF-β), enzymes (e.g., matrix metalloproteinases MMP2, MMP9, cysteine ​​cathepsins), M2-associated miRNAs (e.g., miRNA146a, miRNA let 7b and miR-223) and / or M1-related miRNAs (e.g., miRNA155, miR-33). See, for example, Mosser, DM, & Edwards, JP (2008). Exploring the full spectrum of macrophage activation. Nature Reviews Immunology, 8(12), 958-969; Murray, PJ, Allen, JE, Biswas, SK, Fisher, EA, Gilroy, DW, Goerdt, S., Wynn, TA (2014). Macrophage activation and polarization: nomenclature and experimental guidelines. Immunity, 41(1), 14-20.Macrophages and / or macrophage components, secretions or macrophage activities within a sample (see, e.g., Gautier, EL, Shay, T., Miller, J., Greter, M., Jakubzick, C., Ivanov, S., Randolph, GJ (2007). Gene expression profiles and transcriptional regulatory pathways underlying mouse tissue macrophage identity and diversity, Nature Immunology 13(11), 1118-1128) can be detected by flow cytometry, immunohistochemistry, immunoblotting, quantitative PCR or any other method known in the art for detecting cells or cell products in a biological sample.

[0244] Methods for treating cancer

[0245] Additionally, provided herein are methods of treating cancer in a subject.

[0246] In various embodiments, a composition having extracellular vesicles (e.g., exosomes) comprising one or more immunomodulatory components is administered to a subject with cancer, wherein the one or more immunomodulatory components inhibit at least one gene and thereby increase macrophage polarization from an M2 phenotype to an M1 phenotype. In some of these embodiments, the composition can upregulate the immune response and enhance tumor targeting of the subject's immune system. In some aspects, the increased macrophage polarization from an M2 phenotype to an M1 phenotype itself upregulates the subject's immune response and enhances tumor targeting of the subject's immune system. Some authors mention M2d subtype activation as a response to IL-6 and adenosine, and these macrophages are also referred to as tumor-associated macrophages (TAMs). See, e.g. T.(2015).Understanding the Mysterious M2Macrophage through Activation Markers and Effector Mechanisms.Mediators ofInflammation,2015,1-16; Funes,SC,Rios,M.,Escobar-Vera,J., and Kalergis,AM(2018).Implications of macrophage polarization in autoimmunity.Immunology, 154(2), 186-195; and Q. Wang, H. Ni, L. Lan, X. Wei, R. Xiang, and Y. Wang, "Fra-1protooncogeneregulates IL6 expression in macrophages and promotes the macro generation of M2dmacrophages," Cell Research, Volume 20, No. 6, Pages 701-712, 2010. Tumor-associated macrophages (TAMs) are typical in that they promote tumor functions such as cancer cell motility promotion, cancer metastasis formation and angiogenesis, and their formation depends on the microenvironmental factors present in the developing tumor. TAMs produce immunosuppressive cytokines (such as IL-10, TGFβ, PGE2 and very small amounts of NO or ROI) and low levels of inflammatory cytokines (IL-12, IL-1β, TNFα, IL-6). The ability of TAMs to present tumor-associated antigens and the stimulation of the anti-tumor functions of T cells and NK cells are reduced. In addition, TAMs are not able to dissolve tumor cells. https: / / en.wikipedia.org / wiki / Macrophage_polarization-cite_note-Sica2008-31 As has been confirmed by delivery agents to change the recruitment and distribution of TAMs, deplete existing TAMs or induce TAMs to re-educate from M2 phenotype to M1 phenotype, TAM targeting can be a novel anticancer treatment strategy.Also read Lewis,Claire E.,and Jeffrey W.Pollard."Distinct role of macrophages in differenttumor microenvironments."Cancer research 66.2(2006):605-612and Sica,Antonio."Macrophage polarization in tumor progression."Seminars in Cancer Academic Press,2008;Sica,Antonio.Autocrine production of IL-10mediates defective IL-12production and NF-kappa B activation in tumor-associated macrophages.J Immunol.2000January15164(2):762-7;Cuccarese,MichaelF.Dubach,J.Matthew1Pfirschke,Christina1Engblom,CamillaGarris,ChristopherMiller,Miles A.Pittet,Michael J. and Weissleder, Ralph(2017-02-08)."Heterogeneity of macrophage infiltration and therapeutic response in lung carcinoma revealed by 3D organ imaging".Nature Communications.8:14293;Zeisberger,SM;Odermatt,B;Marty,C. A H M; Ballmer-Hofer, K; Schwendener, R A (2006-07-11). "Clodronate-liposome-mediated depletion of tumour-associated macrophages: a new and highly effective antiangiogenic therapy approach". British Journal of Cancer. 95(3):272-281; Rodell, Christopher B.; Arlauckas, Sean P.; Cuccarese, Michael F.; Garris, Christopher S.; Li, Ran; Ahmed, Maaz S.; Kohler, Rainer H.; Pittet, Mikael J.; Weissleder, Ralph (2018-05-21). "TLR7 / 8-agonist-loaded nanoparticles promote the polarization of tumour-associated macrophages to enhance cancer immunotherapy". Nature Biomedical Engineering; Guerriero, Jennifer L.; Sotayo, Alaba; Ponichtera, Holly E.; Castrillon, Jessica A.; Pourzia, Alexandra L.; Schad, Sara; Johnson, Shawn F.; Carrasco, Ruben D.; Lazo, Suzan (March 2017). "Class IIa HDAC inhibition reduces breast tumours and metastases through anti-tumour macrophages". Nature. 543(7645):428-432.

[0247] In some embodiments, the cancer being treated is characterized by infiltration of leukocytes (T cells, B cells, macrophages, dendritic cells, monocytes) into the tumor microenvironment, or so-called "hot tumors" or "inflammatory tumors". In some embodiments, the cancer being treated is characterized by low or undetectable levels of infiltration of leukocytes into the tumor microenvironment, or so-called "cold tumors" or "non-inflammatory tumors". In some embodiments, the amount and duration of administration of the composition is sufficient to convert a "cold tumor" into a "hot tumor", i.e., the administration results in infiltration of leukocytes (such as T cells) into the tumor microenvironment.

[0248] In some embodiments, the composition comprises a combination of extracellular vesicles and more than one immunomodulatory component, including components that promote macrophage polarization from an M2 phenotype to an M1 phenotype, and components that additionally enhance immune responses, such as checkpoint blockade inhibitors, e.g., ipilimumab targeting CTLA-4, nivolumab targeting PD-1, semuximab and pembrolizumab, and atezolizumab, avelumab, durvalumab, each targeting PD-L1; and inhibitors of CSFR-1, such as piritinib, PLX7486, ARRY-382, JNJ-40346527, BLZ945, ematurumab, AMG820, IMC-CS4, and cabilutuzumab. Administration of these compositions as treatments for subjects with cancer can further upregulate immune responses and enhance tumor targeting of the subject's immune system via the combined action of the immunomodulatory components.

[0249] In some embodiments, the additional immunomodulatory component is an antibody or active fragment targeting CTLA-4, PD-1, PD-L1 or CSF1-R. In embodiments, the antibody or its active fragment comprises a CDR that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the CDR of Ipilimumab. In embodiments, the antibody or its active fragment comprises a CDR that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the CDR of Nivolumab. In embodiments, the antibody or its active fragment comprises a CDR that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the CDR of Semiratumab. In embodiments, the antibody or its active fragment comprises a CDR that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the CDRs of pembrolizumab. In embodiments, the antibody or its active fragment comprises a CDR that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the CDRs of atezolizumab. In embodiments, the antibody or its active fragment comprises a CDR that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the CDRs of avelumab. In an embodiment, the antibody or its active fragment comprises a CDR that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the CDRs of durvalumab. In an embodiment, the antibody or its active fragment comprises a CDR that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the CDRs of piritinib. In an embodiment, the antibody or its active fragment comprises a CDR that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the CDRs of PLX7486. In embodiments, the antibody or active fragment thereof comprises a CDR that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to a CDR of ARRY-382. In embodiments, the antibody or active fragment thereof comprises a CDR that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to a CDR of JNJ-40346527.In embodiments, the antibody or its active fragment comprises a CDR that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the CDRs of BLZ945. In embodiments, the antibody or its active fragment comprises a CDR that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the CDRs of ematurumab. In embodiments, the antibody or its active fragment comprises a CDR that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the CDRs of AMG820. In an embodiment, the antibody or its active fragment comprises a CDR that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the CDR of IMC-CS4. In an embodiment, the antibody or its active fragment comprises a CDR that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the CDR of cabilutuzumab.

[0250] In some embodiments, the composition comprising an extracellular vesicle and an immunomodulatory component is administered to a subject as a cancer vaccine. In some of these embodiments, the composition is administered to a subject as a personalized cancer vaccine. In some embodiments, the immunomodulatory component is a tumor antigen or a peptide derived from a tumor antigen. Examples of suitable tumor antigens include: alpha-fetoprotein (AFP), carcinoembryonic antigen (CEA), epithelial tumor antigen (ETA), mucin 1 (MUC1), Tn-MUC1, mucin 16 (MUC16), tyrosinase, melanoma-associated antigen (MAGE), tumor protein p53 (p53), CD4, CD8, CD45, CD80, CD86, programmed death ligand 1 (PD-L1), programmed death ligand 2 (PD-L2), NY-ESO-1, PSMA, TAG-72, HER2, GD2, cMET, EGFR, mesothelin, VEGFR, alpha folate receptor, CE7R, IL-3, cancer-testis antigen, MART-1gp100 and TNF-related apoptosis-inducing ligand. In certain embodiments, the tumor antigen is derived from a reference genome sequence. In certain embodiments, the tumor antigen is derived from the genome sequence of the subject receiving the composition.

[0251] Cancers that can be treated with the composition include, but are not limited to, those listed in Table 5.

[0252] Methods to modulate gene expression, transcriptional networks, and polarization in macrophages

[0253] Some embodiments provide methods for regulating gene expression in macrophages, the method comprising administering to a subject an extracellular vesicle comprising one or more immunomodulatory components, wherein the immunomodulatory components target genes, and wherein the regulation is equal to or greater than the regulation produced by administering an equimolar amount of free immunomodulatory components targeting genes. A method for inhibiting gene expression in macrophages is also provided, the method comprising administering to a subject an extracellular vesicle comprising one or more immunomodulatory components, wherein the immunomodulatory components target genes, and wherein the inhibition is equal to or greater than the inhibition produced by administering an equimolar amount of free immunomodulatory components targeting genes. Some embodiments provide methods for suppressing downstream targets of genes in macrophages, the method comprising administering to a subject an extracellular vesicle comprising one or more immunomodulatory components, wherein the immunomodulatory components target genes, and wherein the inhibition is equal to or greater than the inhibition produced by administering an equimolar amount of free immunomodulatory components targeting genes. Some embodiments provide methods for changing the polarization of a macrophage population, the method comprising administering to a subject an extracellular vesicle comprising one or more immunomodulatory components, wherein the immunomodulatory components target genes, and wherein the polarization change is equal to or greater than the polarization change produced by administering an equimolar amount of free immunomodulatory components targeting genes. In some embodiments, the extracellular vesicle is an exosome. In some embodiments, the immunomodulatory component is an ASO. In some embodiments, the change in polarization is a change from an M2 phenotype to an M1 phenotype.

[0254] Methods for treating fibrotic diseases

[0255] In addition, provided herein is a method of treating a fibrotic disorder in a subject, the method comprising administering to a subject in need thereof an effective amount of a composition comprising exosomes comprising an immunomodulatory component, wherein the immunomodulatory component repolarizes macrophages from an M2 phenotype to an M1 phenotype. In some embodiments, the fibrotic disorder is pulmonary fibrosis, liver fibrosis, or pancreatic fibrosis. In certain embodiments, liver fibrosis is non-alcoholic steatohepatitis or NASH.See, e.g., Mayo Clinic Staff. "Definition [of pulmonary fibrosis]". Mayo Foundation for Medical Education and Research. Archived from the original on July 15, 2014. Retrieved on July 26, 2014, available worldwide at webmayoclinic.org / diseases-conditions / pulmonary-fibrosis / symptoms-causes / syc-20353690; Ferri FF. Idiopathic pulmonary fibrosis. Ferri's Clinical Advisor 2016. Philadelphia, Pa.: Mosby Elsevier; 2016; Gross TJ, Hunninghake GW (2001). "Idiopathic pulmonary fibrosis". N Engl J Med. 345(7):517-525; Friedman LS (2014). Current medical diagnosis and treatment 2014.[Sl]:Mcgraw-Hill.pp. Chapter 16. Liver, Biliary Tract, & Pancreas Disorders; Chalasani N, Younossi Z, Lavine JE, Charlton M, Cusi K, Rinella M, Harrison SA, Brunt EM, Sanyal AJ (January 2018). "The diagnosis and management of nonalcoholic fatty liverdisease: Practice guidance from the American Association for the Study of Liver Diseases". Hepatology. 67(1):328-357; Xue J, Sharma V, Hsieh MH, Chawla A, Murali R, Pandol SJ, Habtezion A. Nat Commun. 2015 May 18; 6:7158.

[0256] Mode of administration

[0257] In some embodiments, the composition is administered intravenously to the subject's circulatory system. In some embodiments, the composition is infused in a suitable fluid and administered into a subject's vein.

[0258] In some embodiments, the composition is administered intra-arterially to the subject's circulatory system. In some embodiments, the composition is infused in a suitable fluid and administered into an artery of the subject.

[0259] In some embodiments, the composition is administered to the subject by intrathecal administration. In some embodiments, the composition is administered via injection into the spinal canal, or into the subarachnoid space so that the composition reaches the cerebrospinal fluid (CSF).

[0260] In some embodiments, the composition is administered to a subject by intranasal administration. In some embodiments, the composition can be insufflated via the nose in the form of topical or systemic administration. In certain embodiments, the composition is administered in the form of a nasal spray.

[0261] In some embodiments, the composition is administered to the subject by intraperitoneal administration. In some embodiments, the composition is infused in a suitable liquid and injected into the peritoneum of the subject. In some embodiments, the intraperitoneal administration causes the composition (e.g., the extracellular vesicle in the composition) to be distributed to the lymphatic vessels. In some embodiments, the intraperitoneal administration causes the composition (e.g., the extracellular vesicle in the composition) to be distributed to the thymus, spleen, and / or bone marrow. In some embodiments, the intraperitoneal administration causes the composition (e.g., the extracellular vesicle in the composition) to be distributed to one or more lymph nodes. In some embodiments, the intraperitoneal administration causes the composition (e.g., the extracellular vesicle in the composition) to be distributed to one or more of the cervical lymph nodes, inguinal lymph nodes, mediastinal lymph nodes, or sternal lymph nodes. In some embodiments, the intraperitoneal administration causes the composition (e.g., the extracellular vesicle in the composition) to be distributed to the pancreas.

[0262] In some embodiments, the composition is administered to a subject via periocular administration. In some embodiments, the composition is injected into periocular tissue. Periocular drug administration includes subconjunctival, anterior chamber sub-Ton's capsule, posterior chamber sub-Ton's capsule, and retrobulbar administration routes.

[0263] In some embodiments, the composition is administered to the same subject by multiple routes of administration. In some embodiments, the multiple routes of administration include intravenous administration, intraarterial administration, intrathecal administration, intranasal administration, intraperitoneal administration, and / or periocular administration. In a preferred embodiment, the multiple routes of administration include intravenous administration and intraperitoneal administration.

[0264] In certain embodiments, the dose of extracellular vesicles is between 1 ng and 10 ng, 10 ng and 100 ng, 100 ng and 1 μg, 1 μg and 5 μg, 5 μg and 10 μg, 10 μg and 50 μg, 50 μg and 75 μg, 75 μg and 100 μg, 100 μg and 150 μg, 150 μg and 200 μg, 200 μg and 300 μg, 300 μg and 500 μg, 500 μg and 1 mg, or 1 mg and 10 mg.

[0265] The composition may be administered once to the subject. Alternatively, multiple administrations may be performed over a period of time. For example, the subject may be given two, three, four, five or more administrations. In some embodiments, administrations may be given as needed, for example, for as long as the duration of symptoms associated with the disease, disorder or condition. In some embodiments, repeated administrations may be specified for the remainder of the subject's life. The treatment period may vary and may, for example, be no more than one year, six months, three months, two months, one month, two weeks, one week, three days, two days, or no more than one day.

[0266] In certain embodiments, a dose of extracellular vesicles is administered at intervals such as once daily, every other day, once a week, twice a week, once a month, or twice a month.

[0267] In some embodiments, the pharmaceutical composition is administered at a frequency sufficient to effectively increase the concentration of the immunomodulatory component in the target cell or tissue above a level associated with symptoms of the disease, disorder, or condition.

[0268] In some embodiments, the composition is administered at least twice during the treatment period so as to treat a disease, disorder or illness, or to improve its symptoms. In some embodiments, the composition is administered at least twice during the treatment period so as to treat a disease, disorder or illness, or to prevent its symptoms. In some embodiments, a sufficient number of pharmaceutical compositions are administered during the treatment period so that a sufficient amount of immunomodulatory components are delivered to a target cell or tissue during treatment. In some embodiments, a sufficient number of pharmaceutical compositions are administered during the treatment period so that a sufficient amount of immunomodulatory components are delivered to a target cell or tissue during treatment, so as to prevent, alleviate, improve or delay one or more symptoms of a disease, disorder or illness. In some embodiments, increasing the concentration of immunomodulatory components in a target cell or tissue includes increasing peak concentrations, and in other embodiments, it includes increasing average concentrations. In some embodiments, a substantial increase during treatment can be determined by comparing the treatment period before or after the treatment period in a subject or by comparing the measurements performed in a population undergoing treatment with the measurements performed in a matched untreated control population.

[0269] In some embodiments, the pharmaceutical composition is administered a sufficient number of times per treatment period such that the increased concentration of the immunomodulatory component in the target cell or tissue continues for at least about one week, two weeks, three weeks, four weeks, one month, two months, three months, four months, five months, six months, or more than six months. In some embodiments, the pharmaceutical composition is administered a sufficient number of times per treatment period such that the increased concentration of the immunomodulatory component in the target cell or tissue continues for at least as long as the treatment period.

[0270] In some embodiments, the time interval between repeated administrations during the treatment period is no longer than the time it takes for the number of circulating extracellular vesicles to decrease to less than about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95% of the number of extracellular vesicles present in the administered pharmaceutical composition.

[0271] In some embodiments, the method of treatment further comprises injecting one or more doses of non-therapeutic extracellular vesicles before injecting a suitable therapeutic dose of extracellular vesicles with a therapeutic agent. In certain embodiments, non-therapeutic extracellular vesicles are administered separately from therapeutic extracellular vesicles and administered at a dose different from that of therapeutic extracellular vesicles. In certain embodiments, the dose of non-therapeutic extracellular vesicles is greater than the dose of therapeutic extracellular vesicles. In certain other embodiments, the dose of non-therapeutic extracellular vesicles is less than the dose of therapeutic extracellular vesicles. In certain embodiments, the dose of non-therapeutic extracellular vesicles is the same as the dose of therapeutic extracellular vesicles. In various embodiments, the method of injecting non-therapeutic extracellular vesicles before injecting a suitable dose of therapeutic extracellular vesicles reduces the renewal of therapeutic extracellular vesicles in the liver, lungs, and / or spleen. See co-owned PCT application PCT / US2017 / 047794, which is incorporated herein by reference for all purposes.

[0272] An effective amount of the composition is provided based at least in part on the target tissue, target cell type, mode of administration, physical characteristics of the extracellular vesicles (e.g., size, and in some cases, the extent of delivery of the molecule), and other determinants. Generally, an effective amount of the composition provides an effective target cell cellular response. Increased efficiency can be demonstrated by increased cell transfection (i.e., the percentage of cells transfected with the extracellular vesicle components), increased cellular response, or reduced innate immune response in the host subject.

[0273] The dosage and frequency of administration of the extracellular vesicles and their pharmaceutical compositions can be determined, for example, by the attending physician based on various factors such as severity of the disease, age, sex and diet of the patient, severity of any inflammation, time of administration and other clinical factors. In an embodiment, intravenous administration is initiated at the lowest effective dose and the dose is increased over a preselected time course until a positive effect is observed. Subsequently, incremental dose increases are limited to levels that produce an effective corresponding increase, while taking into account any side effects that may occur.

[0274] Additional embodiments

[0275] Further aspects and embodiments are provided in the following numbered items.

[0276] 1. An extracellular vesicle comprising one or more nucleic acid molecules that inhibit at least one gene and thereby increase macrophage polarization from an M2 phenotype to an M1 phenotype.

[0277] 2. The extracellular vesicle of embodiment 1, wherein the extracellular vesicle is an exosome.

[0278] 3. The extracellular vesicle of embodiment 1 or 2, wherein the nucleic acid is an inhibitory RNA.

[0279] 4. The extracellular vesicle of any one of embodiments 1-3, wherein the inhibitory RNA is antisense RNA, siRNA, ShRNA, miRNA, lncRNA, or pre-miRNA.

[0280] 5. The extracellular vesicle of any one of embodiments 1-4, wherein the at least one gene is selected from the group consisting of:

[0281] KRAS, HRAS, NRAS, HIF1-α, HIF1-β, Sp1, P300, LKB1, AMPK, STAT3, STAT6, n-MYC and c-MYC, HCAR1, A2AB, IDO, TDO, arginase, glutaminase, and PKM2.

[0282] 6. The extracellular vesicle of embodiment 5, wherein the gene is KRAS.

[0283] 7. The extracellular vesicle of embodiment 6, wherein the nucleic acid is an inhibitory RNA targeting wild-type human KRAS.

[0284] 8. The extracellular vesicle of embodiment 7, wherein the inhibitory RNA also targets mouse Kras G12D .

[0285] 9. The extracellular vesicle of any one of embodiments 1-8, wherein the macrophage is a tumor-resident macrophage.

[0286] 10. The extracellular vesicle of embodiment 9, wherein the tumor is a pancreatic tumor.

[0287] 11. The extracellular vesicle of any one of embodiments 1-10, further comprising an additional immunomodulatory component.

[0288] 12. The extracellular vesicle of embodiment 11, wherein the additional immunomodulatory component is a small molecule drug, an antibody, or a therapeutic protein.

[0289] 13. The extracellular vesicle of embodiment 12, wherein the antibody is an immune checkpoint inhibitor.

[0290] 14. A pharmaceutical composition comprising the extracellular vesicles according to any one of embodiments 1-13.

[0291] 15. A method for treating a disease in a patient in need thereof, the method comprising administering to the patient the extracellular vesicles of any one of embodiments 1-13 or the pharmaceutical composition of embodiment 14, thereby treating the disease in the patient.

[0292] 16. The method of embodiment 15, wherein the disease is cancer.

[0293] 17. The method of embodiment 15 or 16, wherein the patient is a human.

[0294] 18. The method of any one of embodiments 1-17, wherein the nucleic acid is an inhibitory RNA targeting a proto-oncogene.

[0295] 19. The method of embodiment 18, wherein the proto-oncogene is human KRAS.

[0296] 20. The method of embodiment 19, wherein the cancer is pancreatic cancer.

[0297] 21. The method of any one of embodiments 15-20, further comprising performing at least a second therapy.

[0298] 22. The method of embodiment 21, wherein the second therapy comprises surgery, chemotherapy, radiotherapy, cryotherapy, hormone therapy, or immunotherapy.

[0299] 23. The extracellular vesicle of any one of the preceding embodiments, wherein the M2 macrophage is a tumor-associated macrophage selected from the group consisting of M2a, M2b, and M2c macrophages.

[0300] 24. The extracellular vesicle of any of the preceding embodiments, wherein the M1 macrophages exhibit increased secretion of inflammatory cytokines and chemokines selected from the group consisting of INFγ, IL-12, IL-23, TNFα, IL-6, IL-1, CSCL9, CXCL10, and CXCL11 compared to the M2 macrophages before polarization.

[0301] 25. The extracellular vesicle of any of the preceding embodiments, wherein the M1 macrophages exhibit reduced secretion of immunosuppressive cytokines and chemokines selected from the group consisting of IL-10, TGFβ, PGE2, CCL2, CCL17, CCL18, CCL22, and CCL24 compared to the M2 macrophages before polarization.

[0302] 26. The extracellular vesicle of any one of the preceding embodiments, wherein the M1 macrophages express increased tumor-associated antigens compared to the M2 macrophages before polarization.

[0303] 27. The extracellular vesicle of any one of the preceding embodiments, wherein the M1 macrophages have increased affinity for CD8 + Stimulation of T cells and / or natural killer cells.

[0304] 28. A method of treating pancreatic cancer in a subject, the method comprising: administering to the subject extracellular vesicles comprising an inhibitory RNA targeting human wild-type KRAS; wherein the treatment increases the percentage of tumor-resident macrophages polarizing from an M2 phenotype to an M1 phenotype to an increase compared to treatment with an inhibitory RNA targeting human wild-type KRAS. G12D Higher levels of polarization percentage were observed in patients treated with inhibitory RNA.

[0305] Example

[0306] The following examples are presented in order to provide one of ordinary skill in the art with a complete disclosure and description of how to make and use the invention, and are not intended to limit the scope of what the inventors regard as their invention, nor are they intended to represent that the following experiments are all or the only experiments performed. Every effort has been made to ensure accuracy with respect to the numbers used (e.g., amounts, temperatures, etc.), but some experimental errors and deviations should be taken into account. Unless otherwise indicated, parts are parts by weight, molecular weight is average molecular weight, temperature is in degrees Celsius, and pressure is at or near atmospheric pressure. Standard abbreviations may be used, such as bp, base pairs; kb, kilobase; pl, picoliter; s or sec, seconds; min, minutes; h or hr, hours; aa, amino acids; nt, nucleotides; etc.

[0307] Unless otherwise indicated, the practice of the present invention will adopt conventional methods of protein chemistry, biochemistry, recombinant DNA technology and pharmacology within the skill of the art. Such techniques are fully explained in the literature. See, for example, TECreighton, Proteins: Structures and Molecular Properties (WH Freeman and Company, 1993); A Lehninger, Biochemistry (Worth Publishers, Inc., currently added); Sambrook et al., Molecular Cloning: A Laboratory Manual (2nd Edition, 1989); Methods In Enzymology (S. Colowick and N. Kaplan, Academic Press, Inc.); Remington's Pharmaceutical Sciences, 21st Edition (Easton, Pennsylvania: Mack Publishing Company, 2005); Carey and Sundberg Advanced Organic Chemistry 3rd Edition (Plenum Press) Volumes A and B (1992).

[0308] Example 1: Knockdown of transcription factors in M2 macrophages

[0309] method:

[0310] Isolation of monocytes from PBMCs:

[0311] Receive 50 ml of buffy coat

[0312] Pipette 15 ml of polysucrose into a 50 ml STEMCELL SepMate tube

[0313] Dilute the buffy coat in PBS 2mM EDTA to a final volume of approximately 250 mL

[0314] Pour the diluted buffy coat sample into the Sepmate tube until the final volume in the tube is approximately 45-50 ml

[0315] Centrifuge the tubes at 1000 g for 15 min with a brake on one tube

[0316] • Aspirate plasma from the spin tube and collect the buffy coat into a 50 ml conical tube with an auxiliary pipette.Fill the tube with PBS / EDTA and centrifuge at 500 g for 3 min to pellet the cells.

[0317] • If red blood cells are highly present, resuspend cells in 10 ml ACK lysis buffer (ThermoFisher, Cat. No. A1049201) and incubate at room temperature for 3 minutes (manufacturer's protocol).Fill tubes with PBS / EDTA and centrifuge at 500 g for 3 minutes.

[0318] The tubes were racemized at 400 x g for 5 min and the pellets were washed again with PBS EDTA and re-pelleted

[0319] • The pellet was resuspended in RoboSep buffer (STEMCELL, Cat. No. 20104) and cells were counted (approximately 500 million PBMCs generated from one buffy coat) using a 1:1 dilution with Trypan Blue (Thermofisher).

[0320] Isolate CD14+ monocytes using the EasySep Human Monocyte Enrichment Kit (STEMCELL, Cat. No. 19059RF) according to the manufacturer's protocol (approximately 10% of total cells were isolated as monocytes)

[0321] · Plate 5 million monocytes in RPMI 10% FBS 1% Anti Anti + 40ng / ml M-CSF in one plate

[0322] Macrophage Differentiation and Polarization:

[0323] (Adopted from https: / / www.atsjournals.org / doi / full / 10.1165 / rcmb.2015-0012OC)

[0324] The plated cells were cultured for 5-6 days at 37C, 5% CO2 in RPMI-1640 10% FBS 1% Anti Anti 1% PenStrep + 40ng / ml M-CSF (Biolegend). 5 ml of the same fresh medium was added on day 1 and day 3 after plating. On day 5, polarizing cytokines were added as follows (together with 40ng / ml MSCF; all cytokines were added at 20ng / ml):

[0325] M0: No cytokines

[0326] M2a: IL-4

[0327] M2c: IL-10

[0328] M2++: Il4, Il10, TGFb

[0329] M1: IFN-g + LPS (100 ng / ml)

[0330] ·TAM: 75% Panc-1 supernatant

[0331] Incubate cells with cytokines for 24 hours

[0332] On day 6, aspirate the medium, wash the cells with PBS, then add 10 ml PBS 5 mM EDTA (ice cold) per plate and incubate at 4C for 30 min.

[0333] • Gently scrape the cells from the plate and count them.

[0334] • Next, 50,000 cells / well were plated in 96-well plates with corresponding cytokines against different macrophage populations (see above) in RPMI-1640 10% FBS 1% Anti Anti 1% PenStrep + 40ng / ml M-CSF (Biolegend) for 24 hours before starting treatment.

[0335] Exosome purification:

[0336] Exosomes were collected from the supernatant of high-density suspension cultures of HEK293 SF cells after 9 days. The supernatant was filtered and fractionated by anion exchange chromatography and eluted in a step gradient of sodium chloride. The peak fraction with the highest protein concentration contained exosomes and contaminating cellular components. The peak fraction was separated and purified by ultracentrifugation in Optiprep TM The cells were further fractionated on a (60% iodixanol w / v) density gradient.

[0337] The exosome fraction was concentrated by ultracentrifugation at 133,900 x g for 3 hours at 4°C in 38.5 mL Ultra-Clear (344058) tubes for SW 32Ti rotor. The pelleted material was resuspended in 1 mL PBS and 3 mL Optiprep TM The final iodixanol concentration was 45%. TM Gradients: Prepare a 4-layer sterile gradient in a 12 mL Ultra-Clear (344059) tube for a SW 41Ti rotor using 4 mL of 45% iodixanol containing resuspended material, 3 mL of 30% iodixanol, 2 mL of 22.5% iodixanol, 2 mL of 17.5% iodixanol, and 1 mL of PBS. TM The gradient was ultracentrifuged at 150,000 x g at 4 °C for 16 hours to separate the exosome fraction. Ultracentrifugation produces a top fraction known to contain exosomes, a middle fraction containing medium-density cell debris, and a bottom fraction containing high-density aggregates and cell debris. Next, the exosome layer was gently collected from the top 3 mL of the tube.

[0338] The exosome fraction was diluted in about 32 mL PBS in a 38.5 mL Ultra-Clear (344058) tube and ultracentrifuged at 133,900 x g for 3 hours at 4° C. to pellet the purified exosomes. The pelleted exosomes were then resuspended in a minimal volume of PBS (about 200 μL) and stored at 4° C.

[0339] Many solid tumors are characterized by myeloid cell-rich infiltrates, which often contain tumor-associated macrophages characterized as having an alternatively activated or M2 phenotype. M2 macrophages express high levels of phosphorylated STAT3 and STAT6 that promote expression of the metabolic enzyme arginase (Arg1). To confirm that knockdown of key M2 genes alters the M2 phenotype of differentiated macrophages in vitro, mouse RAW264.7 macrophages were polarized to the M2 state as described above. Increasing amounts of targeted STAT3, STAT6, CEBPβ-1, CEBPβ-2, Pi3Kγ, or KRAS were used. 的siRNA (12.5nM, 25nM, 50nM and 100nM) were transfected into cultured polarized macrophages. Figure 1 ), and knockdown of each M2 gene resulted in a concomitant decrease in Arg1 ( Figure 2 ), which confirmed that the M2 phenotype can be altered by reducing the expression of upstream regulators.

[0340] Example 2: Differential exosome uptake by macrophage subtypes

[0341] Macrophage subtypes are characterized by alterations in metabolic and other phenotypic activities. To understand whether certain macrophage subtypes preferentially take up exosomes, six macrophage subpopulations (M0, M1, M2a, M2c, M2++, and TAM) were incubated with increasing levels of HEK293SF-derived exosomes engineered to express luminal GFP. Exosome uptake was determined by measuring total cellular GFP intensity in a live cell analysis system (Essen Bioscience). Figure 3 As shown in , when all macrophage subtypes showed exosome uptake, M0 macrophages were the least efficient in uptake of exosomes compared to other macrophage subtypes, while M2++ macrophages were substantially more efficient in uptake of exosomes.

[0342] Because M2 macrophages efficiently take up exosomes, we investigated whether ASO-loaded exosomes target intracellular macrophage targets more effectively than ASOs alone (e.g., more effectively knock down gene expression of target genes and downstream effector molecules within gene signaling pathways). 2'-Methoxyethyl (MOE) single-stranded DNA / RNA ASOs targeting STAT3 and carrying a Cy5 fluorescent tracer and a 5' cholesterol linker were generated. HEK293SF exosomes were mixed with fluorescent ASOs labeled with cholesterol, and free ASOs were removed by ultracentrifugation and removal of the ASO-containing supernatant. M2 and M0 macrophages were plated at equal density and incubated with concentration-matched free ASOs or ASO-loaded exosomes (Exo-ASOs), as measured by total fluorescence intensity. Total cell fluorescence was measured over 48 hours and was used Live cell analysis system for quantification. Figure 4 As shown in , M2 macrophages more readily took up both free ASO and Exo-ASO compared to M0 macrophages. Interestingly, both M0 and M2 macrophages took up Exo-ASO more efficiently, suggesting that delivery of ASO to M2 macrophages can be enhanced by loading on exosomes.

[0343] To determine whether macrophages take up exosomes or Exo-ASOs differentially in vivo compared with other cell types, naive mice were given 1x10 11 or 1x10 12 One hour after injection, total peritoneal cells were isolated and characterized by flow cytometry for GFP positivity in different immune cell subsets (i.e., B cells, dendritic cells, neutrophils, natural killer (NK) cells, T cells, and macrophages). Figure 5AAs shown in Figure 2, macrophages were the main cell type taking up fluorescent exosomes at both doses. To determine whether this difference occurs in the disease setting, B16F10 tumor-bearing mice were injected with a single dose of Cy5-labeled Exo-ASO or native unlabeled exosomes. The injected tumors were isolated, dissociated, and measured by flow cytometry. Figure 5B As shown in, macrophages take up Exo-ASOs much more easily than tumor cells (greater than about 100 times the overall Cy5 signal), indicating that Exo-ASO delivery can reach macrophage populations in several composite cell mixtures. In addition, the preferential uptake of Exo-ASOs by macrophages compared to another test cell type (B cells, dendritic cells, neutrophils, natural killer (NK) cells, and T cells) makes it possible to deliver ASOs targeting macrophages, the method comprising administering an Exo-ASO composition to a subject, wherein macrophages present in the subject preferentially take up the administered composition (compared to, for example, B cells, dendritic cells, neutrophils, natural killer (NK) cells, and other immune cell subsets of T cells). This enhanced macrophage specificity of the Exo-ASO composition improves the safety of the administered composition by reducing the effects in off-target cells.

[0344] Example 3: Exosome-mediated delivery of antisense oligonucleotides potently dysregulates macrophage transcriptional networks and change the polarization

[0345] Previous experiments have shown that exosome-mediated delivery of ASOs can be an effective method to alter macrophage gene expression patterns. HEK293SF-derived exosomes purified according to the above method were loaded with one of five different cholesterol-tagged ASOs targeting STAT3 (4.1, double-chain MOE chemistry; 5.1 and 5.2, single-chain O-methyl chemistry; 5.3 and 5.4, single-chain MOE chemistry). The ASO sequences are shown in Table 0. M2-polarized mouse RAW264.7 cells were incubated with 5 μM free cholesterol-tagged ASO or 1×10 5 or 1x10 6 Incubation of polarized macrophages with unmodified exosomes loaded with cholesterol-tagged ASOs. STAT3 transcript levels were measured 24 hours after treatment, revealing comparable or superior knockdown of STAT3 with Exo-ASO treatment compared to free ASO. Unmodified exosomes incubated with polarized macrophages had no effect on STAT3 expression ( Figure 6 ). To examine the downstream targets of STAT3, ARG1 transcript levels were measured 48 hours after treatment. Figure 7 As shown in Figure 2, STAT3 knockdown in the presence of free ASO or Exo-ASO resulted in a robust repression of Arg1 exceeding 90% in several cases ( Figure 7). M2-polarized RAW264.7 cells were incubated with high (4 μM) and low (0.4 μM) ASOs or Exo-ASOs targeting STAT3, KRAS, and C / EBPβ. Figure 8A-8C As shown in the results, Exo-ASO samples were equally potent (STAT3) or more potent (KRAS, C / EBPβ) at all doses tested ( Figure 8A-8C ). The ASO sequences are shown in Table 0.

[0346] This result demonstrates that Exo-ASOs are effective modulators of macrophage expression networks and can provide superior, differential modalities compared to administration of free ASOs for various therapeutic applications. A method of modulating gene expression in macrophages, the method comprising administering an Exo-ASO to a subject, wherein the ASO targets the gene, and wherein the modulation is equal to or greater than the modulation produced by administering an equimolar amount of a free ASO targeting the gene. Another embodiment includes a method of inhibiting gene expression in macrophages, the method comprising administering an Exo-ASO to a subject, wherein the ASO targets the gene, and wherein the inhibition is equal to or greater than the inhibition produced by administering an equimolar amount of a free ASO targeting the gene. Another embodiment includes a method of repressing a downstream target of a gene in a macrophage, the method comprising administering an Exo-ASO to a subject, wherein the ASO targets the gene, and wherein the repression is equal to or greater than the repression produced by administering an equimolar amount of a free ASO targeting the gene. Yet another embodiment includes a method of altering polarization of a macrophage population, the method comprising administering an Exo-ASO to a subject, wherein the ASO targets a gene expressed in the macrophages, and wherein the change in polarization is equal to or greater than the change in polarization produced by administering an equimolar amount of a free ASO targeting the gene. In such embodiments, the change in polarization can be a change from an M2 phenotype to an M1 phenotype.

[0347] To test the effects of Exo-ASOs in human cells, primary human macrophages were polarized to an M2 phenotype and treated with varying doses of free STAT3 ASOs or STAT3 Exo-ASOs. Using macrophages from three independent human donors, Exo-ASOs continued to more potently repress STAT3 transcription levels 24 hours after treatment ( Fig.9A Compared with free ASO, Exo-ASO also significantly regulated CD163, a downstream human marker of M2 polarization ( Fig. 9B ). Human M2 macrophages were also treated with 4 μM free ASO or Exo-ASO targeting HIF1α, Pi3Kγ, CEBP / β, STAT6, and STAT3. Fig.10As shown in Figure 2, all treatment groups caused repression of target genes, but in all cases, Exo-ASO was more potent than free ASO treatment. Importantly, Exo-ASO knockdown of any of the macrophage targets resulted in a robust reduction in CD163 expression ( Fig.11 ), demonstrating that exosome-mediated ASO delivery robustly and reproducibly perturbs important macrophage signaling networks.

[0348] The functional result of M2 macrophage polarization is the reduction of proinflammatory cytokines, which contribute to the pro-tumorigenic microenvironment. Therefore, the transformation of macrophages from M2 phenotype to M1 phenotype should cause enhanced proinflammatory signaling. The transformation of M2 macrophages to M1 state can be induced by LPS, which causes the induction of cytokines including IL-12 and IL-23. STAT3 is a negative regulator of this cytokine expression network, so we tested whether STAT3 inhibition can further enhance the production of proinflammatory cytokines in the presence of LPS. M2 polarized human macrophages were treated with 4 μM free STAT3 ASO, 4 μM STAT3 Exo-ASO, 4 μM scrambled Exo-ASO, natural exosomes or C188-9 (i.e., small molecule inhibitors of STAT3). After 24 hours, the culture medium was replaced with a culture medium containing 10 ng / ml LPS, and the supernatant was separated after 24 hours. As shown in Figure 12, LPS induced the secretion of IL-12 and IL-23 (LPS 10 ng / ml group vs. no LPS group). Treatment with STAT3 Exo-ASO, but not free STAT3 ASO, further enhanced the expression of each cytokine, suggesting that Exo-ASO can more potently induce a promotional effect on the M1 phenotype in response to relevant immunomodulatory signals.

[0349] Dysregulation of STAT3, STAT6, and other macrophage regulatory pathways induces widespread changes in gene expression patterns. To understand the differential global impact of Exo-ASO treatment, Nanostring mRNA profiling was performed on human M2 macrophages at their steady state and in response to treatment with unmodified exosomes (EVs only) and concentration-matched ASOs and Exo-ASOs. Normalized mRNA counts from a human bone marrow innate immunity panel confirmed that STAT3 transcripts were reduced following both free ASO and Exo-ASO treatment ( Fig.13A After ASO treatment, the downstream marker CD163 ( Fig.13D )、TGFβ( Fig. 13C ) and STAT6( Fig.13D ) have all been forcefully adjusted downwards.

[0350] Robust repression of TGFβ (<85%) is a key regulator of M2 macrophage polarization (Yang and Zhang Journal of Hematology & Oncology (2017) 10:58). We examined the effects of STAT3, STAT6, and CEBP / β Exo-ASO treatment on TGFβ expression. Human M2 polarized macrophages were treated with exosomes loaded with ASOs targeting STAT3 (both MOE and LNA chemistries), ASOs targeting STAT6 (MOE chemistries), and ASOs targeting CEBP / β (MOE chemistries). In all cases, TGFβ levels were significantly reduced after treatment with submicromolar amounts of ASOs ( Fig.14 ). These results demonstrate that exosome-mediated delivery of ASOs to a number of macrophage polarization regulators may result in robust, stable dysregulation of cellular programs that may have implications in many cancer treatments. Importantly, each of the newly identified macrophage targets, including KRAS as a regulator of this process, has been characterized as "undruggable" targets because their roles in disease and other cellular processes are well recognized, but safe, effective treatments have evaded classical approaches to drug development.

[0351] Example 4: In vivo wild-type KRAS inhibition leads to increased macrophage polarization in an orthotopic mouse pancreatic cancer model oxidative stress and decreased tumor size.

[0352] method :

[0353] Production and isolation of KRAS exosomes: An electroporation method was used to insert KRAS siRNA constructs into exosomes without functionally damaging the exosomes. Exosomes were isolated from human fetal kidney (HEK) 293SF suspension cells grown in chemically defined medium using an established ultracentrifugation method (Kahlert et al., 2014). TM The purity and homogeneity of the exosomes were verified by RT-PCR, transmission electron microscopy, and CD9 immunogold labeling (80-150 nm diameter particles). Sucrose gradient ultracentrifugation and qPCR were also performed to verify the presence and abundance of KRAS siRNA. Exosomes containing scrambled siRNA were also generated.

[0354] RNAi strategy. The KRAS siRNA sequence targeting mouse wild-type KRAS contained TT nucleotide overhangs to enhance silencing efficiency. Alexa Fluor was also labeled at the 3' end on the sense strand of the RNAi 647 fluorophore to track its delivery.

[0355] Mice and Imaging. Female athymic nu / nu mice (Charles Rivers) between 4 and 6 weeks of age were housed individually in ventilated cages at 21°C-23°C and 40%-60% humidity on a 12 h light-dark cycle. Mice were given free access to irradiated diet and sterilized water. Under general anesthesia, tumorigenic human pancreatic Panc-1 (Kras asp12 (Rejiba et al., 2007; Sun et al., 2001)) cells or BXPC-3 cells (10 6 , resuspended in 10 μl PBS) was injected into the pancreatic tail. For in situ tumor size / volume analysis, Living Image version 4.4 (Caliper Life Sciences) was used to quantify all tumor calculations. A circular target region (ROI) around the pancreas and tumor was defined and set as a standard for comparing all images within the same experimental group. In addition, exposure conditions (time, aperture, platform position, binning) were kept consistent for all measurements in all experimental groups. Then, for all experimental groups, subsequent tumor measurements (p / sec / cm 2 Mice were imaged regularly and randomly divided into treatment groups. Mice received 2x10 8 Prior to injection, exosomes were electroporated with 2 μg siRNA and washed with PBS.

[0356] Histology, histopathology and immunohistochemistry. The tissue was fixed in formalin and processed for paraffin embedding. Tissue sections of 5 μm thickness were cut and stained with hematoxylin and eosin (H&E) and Mason's trichrome (Masson's richrome, MTS) (Leica). For histopathological scoring, H&E stained slides were scored based on the morphological stages of pancreatic cancer: normal, pancreatic intraepithelial neoplasia (PaNIN) and pancreatic ductal adenocarcinoma (PDAC). For each tissue section, the percentage score for each of the three stages (normal, PaNIN, PDAC) was manually obtained by a pancreatic histology expert in a blind evaluation manner, and then the score was averaged to obtain a total score within 100 points for each group. Subsequently, for each mouse in each group, the average of these percentage scores was taken. Tumor tissue sections were also stained for macrophages (using pan-macrophage markers (e.g., F4 / 80 antibodies and / or M2 and M1 specific cell markers for detecting tumor-resident macrophages)).

[0357] Assays for characterization of macrophage phenotypes. Blood samples and tumor samples were collected from mice. Macrophages were isolated and stained for M1 and M2 marker analysis by flow cytometry. Macrophages were stained for pan-macrophage markers as well as M2 phenotype cell surface markers (e.g., YM1, FIZZ1, Dectin-1, and / or MGL) and M1 phenotype cell surface markers. M2 and M1 macrophages were then counted and classified for further analysis (such as quantitative PCR) to detect expression of cytokines and / or miRNA expression of miRNAs associated with the M1 phenotype and / or M2 phenotype.

[0358] Results from xenograft experiments and orthotopic tumor volume analysis demonstrated that exosomes containing KRAS wild-type siRNA effectively reduced the size of pancreatic tumors and increased the number of M1 phenotype tumor-associated macrophages compared with exosomes with scrambled siRNA, indicating that administration of exosomes containing inhibitory RNA targeting human wild-type KRAS is effective for treating cancer.

[0359] surface

[0360]

[0361]

[0362]

[0363]

[0364]

[0365]

[0366]

[0367]

[0368]

[0369]

[0370]

[0371]

[0372]

[0373]

[0374]

[0375]

[0376]

[0377]

[0378]

[0379]

[0380]

[0381]

[0382]

[0383]

[0384]

[0385]

[0386] The present invention has been described with respect to representative embodiments, which are to be regarded as illustrative embodiments and not limiting the scope of the invention, which is defined solely by the claims. All references to publications, including scientific publications, papers, textbooks, patent applications, and filed patents, are hereby incorporated by reference for all purposes.

Claims

1. An extracellular vesicle comprising one or more immunomodulatory components, wherein the one or more immunomodulatory components, when in contact with a macrophage, selectively repolarize the macrophage from an M2 phenotype to an M1 phenotype.

2. The extracellular vesicle of claim 1, wherein the one or more immunomodulatory components inhibit at least one macrophage target gene.

3. The extracellular vesicle of claim 1 or 2, wherein the extracellular vesicle is an exosome.

4. The extracellular vesicle of any one of claims 1 to 3, wherein the immunomodulatory component is a nucleic acid.

5. The extracellular vesicle of claim 4, wherein the nucleic acid is an inhibitory RNA.

6. The extracellular vesicle of claim 5, wherein the inhibitory RNA is antisense RNA, siRNA, shRNA, miRNA, lncRNA, primary miRNA or precursor miRNA.

7. The extracellular vesicle of claim 4, wherein the nucleic acid is an antisense oligonucleotide (ASO).

8. A pharmaceutical composition comprising the extracellular vesicles according to any one of claims 1 to 7.

9. A method for treating a disease in a patient in need thereof, the method comprising administering to the patient the extracellular vesicles of any one of claims 1-7 or the pharmaceutical composition of claim 8, thereby treating the disease in the patient.

10. A method for regulating gene expression in macrophages, the method comprising: The macrophages are contacted with extracellular vesicles comprising one or more immunomodulatory components that inhibit at least one gene and thereby increase polarization of the macrophages from an M2 phenotype to an M1 phenotype compared to contacting the macrophages with an equimolar amount of the immunomodulatory component alone.

Images