Application of PtoELF3.1 gene in creation of non-dormancy evergreen poplar

Abstract

The invention discloses an application of a PtoELF3.1 gene in creation of non-dormancy evergreen poplar, and belongs to the fields of biotechnology and molecular biology, and the poplar ELF3.1 gene is a protein encoding an amino acid sequence as shown in SEQ ID No.1. A PtoELF3.1 gene is targeted through a CRISPR / Cas9 gene editing system, and a populus tomentosa Ptoelf3.1 mutant strain is obtained. Compared with a populus tomentosa wild type (WT) plant, the Ptoelf3.1 mutant plant still keeps the phenotype of evergreen and non-dormancy of terminal buds and lateral buds under the short-day condition in autumn and winter. The invention shows that the poplar is insensitive to a short-day condition due to knockout of the PtoELF3.1 gene, and the response to seasonal change is lost, so that the growth state of evergreen and non-dormancy is maintained. The method has great application prospects in the aspects of improving photosynthetic carbon sequestration of forest trees, increasing the wood yield and creating ornamental tree germplasm.

Description

Technical Field

[0001] The invention belongs to the fields of biotechnology and molecular biology, and specifically relates to the application of a poplar biological clock gene PtoELF3.1 in seasonal growth regulation. Background Art

[0002] Trees growing in temperate and northern forests have obvious seasonal characteristics, that is, they sprout in spring, grow vigorously in summer, enter dormancy and leaf fall in autumn, and maintain dormancy in winter. Poplar (Populus L.) is a fast-growing tree species used as the main timber and landscaping in my country. Its growth has typical seasonal characteristics. Its growth stops and it goes dormant in autumn and winter, which restricts its photosynthetic carbon fixation and wood production. Seasonal growth is mainly regulated by two major environments, namely photoperiod and temperature. Among them, the short-day conditions in autumn are the main factor for poplars to enter dormancy. When trees perceive short-day conditions, the apical meristem stops growing, and the bud scales formed by stipule metamorphosis wrap the apical meristem and leaf primordium to adapt to the low temperature stress in winter (Maurya and Bhalerao, 2017; Singh et al., 2017). However, continuous low temperatures in winter are necessary to break dormant buds. Low temperature treatment causes dormant buds to return to a state of ecological dormancy, enabling them to respond to the long-day warm conditions in spring, thereby breaking buds and budding, and resuming a new round of growth. Perennial trees experience this cycle of growth and dormancy, which is crucial to their ability to adapt to different latitudes and altitudes. The further north you go, or the higher the altitude at which trees grow, the earlier they enter growth cessation and the later they sprout in the spring (Nilsson, 2022). Therefore, studying the regulatory mechanisms of seasonal growth in trees is important for creating diverse forest germplasm that can adapt to climate change and meet human needs.

[0003] The biological clock is considered to be an important mechanism for connecting with the external environment and is involved in regulating all aspects of plant growth and development. At present, the biological clock system can be simplified into three processes: input pathway, core oscillator, and output pathway. The core oscillator of the plant biological clock is mainly composed of three interlocking transcription-translation feedback loops, namely the morning loop, the central loop, and the evening loop (Wei Hua, Wang Yan, Liu Baohui, Wang Lei, 2018). The biological clock can help organisms predict the periodic changes in the environment and adjust their life activities in advance to enhance their environmental adaptability and optimize their growth economy. LHY and CCA1 are MYB-like transcription factors expressed in the morning, which can inhibit the transcription of biological clock-related genes expressed from morning to evening. The evening feedback loop is mainly regulated by GI, EC (Evening Complex) and TOC1. The evening complex (EC) is composed of proteins encoded by EARLY FLOWERING 3 (ELF3), ELF4 and the transcription factor encoding gene LUXARRHYTHMO (LUX), which can directly regulate plant growth. The complex is diurnally regulated, reaching its peak at dusk (Nusinow et al., 2011; Nakamichi, 2020). ELF3, as a scaffold protein, directly binds to ELF4 and LUX. LUX, as a MYB-like transcription factor, can recruit EC to the promoters of target genes and inhibit the expression of these genes. ELF3 and LUX have been reported to participate in the output pathways of maintaining and regulating rhythmic oscillations and photoperiodic flowering in model plants Arabidopsis, soybean, rice, and corn (Yu et al., 2008; Yang et al., 2013; Lu et al., 2017; Bu et al., 2021; Zhao et al., 2023). However, the function of the poplar circadian clock gene ELF3 in tree growth remains unclear, and whether it plays a role in the seasonal growth of poplars deserves further study. Summary of the invention

[0004] The technical problem to be solved by the present invention is to provide a method for changing the dormancy period in the seasonal growth process of poplars, losing sensitivity to short-day light, extending the growth period of trees and increasing biomass.

[0005] The technical solution of the present invention is: the application of the poplar PtoELF3.1 gene in regulating the transition of the non-dormant period during the seasonal growth process of poplars, and the poplar PtoELF3.1 gene is a gene encoding a protein with the amino acid sequence shown in SEQ ID No.1.

[0006] Furthermore, the application is to knock out the PtoELF3.1 gene through the CRISPR / Cas9 editing system, thereby obtaining poplar germplasm that does not enter a dormant period and remains evergreen under short-day conditions in autumn.

[0007] Furthermore, the nucleotide sequence of the poplar PtoELF3.1 gene is shown in SEQ ID No.2.

[0008] A method for constructing a poplar plant line that does not enter an autumn dormancy period comprises the following steps:

[0009] (1) Using CRISPR / Cas9 editing technology, an editing vector targeting the poplar PtoELF3.1 gene was constructed;

[0010] (2) Genetic transformation of Populus tomentosa: The editing vector constructed in step (1) was transferred into sterile young wild-type Populus tomentosa leaves using the Agrobacterium-mediated leaf disc method.

[0011] (3) Identification of transgenic plants: positive plants were identified through poplar tissue culture and DNA extraction.

[0012] Furthermore, the editing vector targeting the PtoELF3.1 gene expresses the sgRNA of the nucleotide sequence shown in SEQ ID No. 3 and / or 4.

[0013] A sgRNA targeting the poplar PtoELF3.1 gene, wherein the sgRNA nucleotide sequence is shown in any one of SEQ ID No. 3 or SEQ ID No. 4.

[0014] A gene editing vector expressing sgRNA of the nucleotide sequence shown in SEQ ID No.3 and / or SEQ ID No.4.

[0015] The present invention provides an application of the biological clock gene PtoELF3.1 in the regulation of sensing seasonal changes. The PtoELF3.1 gene in Populus tomentosa was gene-edited using CRISPR / Cas9 transgenic technology, causing base deletion or insertion in the target site of the PtoELF3.1 gene. The results showed that in the Ptoelf3.1-L1 mutant, there was 1 base insertion in the T1 target site of the PtoELF3.1 gene, and 3 base deletions in the T2 target site. In the Ptoelf3.1-L2 mutant, there were a total of 104 base deletions from the T1 target site to the T2 target site of the PtoELF3.1 gene. Under long-day conditions of normal greenhouse culture, the number of lateral branches of the Ptoelf3.1 mutant plants was significantly increased compared with the wild-type plants. After culturing the wild-type WT and Ptoelf3.1 mutant materials of Populus tomentosa under long-day conditions (16h light / 8h dark) for 2 months, part of the materials were transferred to short-day conditions (8h light / 16h dark) for treatment, and the other part of the materials (control group) continued to be cultured under long-day conditions. After about 3 weeks of short-day treatment, it was found that the growth of the apical buds of WT poplars stopped, while the apical buds of Ptoelf3.1 mutant plants still maintained a high growth activity under short-day conditions. After 15 weeks of short-day treatment, the apical buds of WT poplars had entered an internal dormant state, while the Ptoelf3.1 mutant materials were still in a growing state. Under natural outdoor light conditions in Chongqing, WT plants stopped growing and entered a dormant state in October and November, while the Ptoelf3.1 mutant had not entered dormancy by the end of December. Combined indoor and outdoor experiments showed that the Ptoelf3.1 mutant plants had lost their perception of the photoperiod and could still maintain growth under short-day conditions (autumn and winter), remaining evergreen and leafless, which could increase the photosynthetic carbon fixation and biomass accumulation of trees.

[0016] Compared with the prior art, the present invention has the following beneficial effects:

[0017] The invention shows that knocking out the PtoELF3.1 gene can change the dormancy period transition during the seasonal growth of poplars. Not entering dormancy and maintaining an evergreen state under short-day conditions in autumn has great application prospects for extending the growth period of trees and improving photosynthetic carbon fixation and biomass accumulation. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 .Creation of Populus tomentosa Ptoelf3.1 mutant material; (A) Gene structure of Populus tomentosa PtoELF3.1 and design of sgRNA targets (T1, T2); (B) Analysis of genotype sequencing results of Populus tomentosa Ptoelf3.1 mutant materials (two strains, L1 and L2).

[0019] Figure 2. Phenotypic observation of Populus tomentosa Ptoelf3.1 mutant; (A) Growth phenotype of Populus tomentosa wild type (WT) and Ptoelf3.1 mutant plants under long-day conditions; (B) Statistical analysis of the number of lateral branches of WT and Ptoelf3.1 plants; (C) Terminal bud phenotype of WT and Ptoelf3.1 plants after short-day (SD, 8 h light / 16 h dark) treatment in the greenhouse; (D) Phenotypic observation of Populus tomentosa WT and Ptoelf3.1 plants cultivated in the wild in Chongqing in winter. DETAILED DESCRIPTION

[0020] The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples are purchased from commercial channels unless otherwise specified.

[0021] (1) Construction of CRISPR / Cas9 knockout vector for PtoELF3.1 gene

[0022] First, the sequence of the Populus tomentosa ELF3.1 gene (gene ID: Potri.006G233800) was downloaded from the Phytozome database, and gene-specific primers were designed. Using the cDNA library of Populus tomentosa as a template, the Populus tomentosa PtoELF3.1 gene was amplified and sequenced to obtain an accurate PtoELF3.1 gene sequence (such as SEQ ID No.2, and the encoded protein is such as SEQ ID No.1). Then, the SnapGene Viewer software was used to design the PtoELF3.1 gene-specific target sequence (design sgRNA). In order to ensure the efficiency of gene editing, two optimal target sequences were designed for each gene.

[0023] Table 1 Designed sgRNA sequences

[0024] Target genes Target T1 Target T2 PtoELF3.1 GAGGGCCTAGAGCTCCCCCAAGG ACTAGCGACTTAGCTCCTACAGG

[0025] These target sequences were then linked into the pYLCRISPR / Cas9P35S-N vector through homologous recombination, and the vector was verified to be correct by PCR sequencing before transformation into Agrobacterium.

[0026] (2) Genetic transformation and genotype identification of Populus tomentosa

[0027] Using Populus tomentosa as the recipient material, the successfully constructed CRISPR / Cas9 vector was introduced into poplar leaves through the Agrobacterium-mediated leaf disc method, and positive transgenic plants with kanamycin resistance were screened through poplar tissue culture.

[0028] First, the successfully constructed CRISPR / Cas9 vector was transferred into Agrobacterium GV3101 and cultured on YEP solid medium (containing 50 mg / L Kan + 40 mg / L Rif) in a 28°C incubator for 2 days. Then, a single clone was picked and inoculated into YEP liquid medium (containing 50 mg / L Kan + 40 mg / L Rif) and cultured overnight at 28°C in a shaking incubator until OD600 was 0.8-1.0. The overnight cultured Agrobacterium was inoculated into YEP liquid medium (containing 50 mg / L Kan + 400 mg / L Rif) at a ratio of 1:50 and cultured in a shaking incubator at 28°C until OD600 was 0.8-1.0. 600 to 0.4-0.6; then centrifuge in a 4℃ low-temperature centrifuge, 4000rpm, 10min, collect the bacteria, resuspend the bacteria with WPM resuspension added with AS, add the resuspension to 50mL, and shake and culture in a 28℃ shaker for 40min for transformation. Select sterile poplar leaves with good growth, cut into 4-6mm leaf discs in a clean bench, put them into the shaken cultured bacterial solution for infection for 7-10min, shake 3 times during the period, then use sterile paper to absorb the bacterial solution on the surface of the leaf disc, and then place it on the co-culture medium for dark culture for 2 days. After 2 days, transfer to a culture medium with kanamycin resistance for dark culture for about 4 weeks, until callus grows and is transferred to a budding medium with kanamycin resistance. When the adventitious buds grow to about 2cm, cut them off and transfer them to a rooting medium with kanamycin to induce rooting.

[0029] In order to identify its genotype, plant leaves were taken and DNA was extracted using the CTAB method. Gene fragments were amplified using specific primers of the PtoELF3.1 gene containing the target sequence, and accurate genotype information was obtained by PCR sequencing. The specific results were: there was a 1-base insertion in the T1 target site of the PtoELF3.1 gene in the Ptoelf3.1 mutant L1, and a 3-base deletion in the T2 target site. There was a 104-base deletion between the T1 target site and the T2 target site of the PtoELF3.1 gene in the Ptoelf3.1 mutant L2 ( Figure 1 ).

[0030] (3) Observation of seasonal growth phenotype of Populus tomentosa Ptoelf3.1 mutant

[0031] After culturing the wild-type WT and Ptoelf3.1 materials of Populus tomentosa under long-day conditions (16 h light / 8 h dark) for 2 months, part of the materials were transferred to short-day conditions (8 h light / 16 h dark) for treatment, and the other part of the materials continued to be cultured under long-day conditions as the control group. Figure 2As shown in the figure, under long-day conditions, the number of lateral branches of Ptoelf3.1 mutant plants was significantly increased compared with wild-type (WT) plants. After about 3 weeks of short-day treatment, the terminal buds of WT poplars experienced growth arrest and gradually formed dormant buds, that is, bud scales wrapped around the apical meristem and leaf primordium. However, Ptoelf3.1 mutant plants did not form dormant buds and still maintained high growth activity under short-day conditions ( Figure 2 ). Populus tomentosa WT and Ptoelf3.1 mutants were planted in outdoor fields in Beibei District, Chongqing, and it was found that WT had entered dormancy and shed its leaves in December of winter. However, the terminal buds of Ptoelf3.1 plants continued to grow, maintaining an evergreen state. The present invention shows that knocking out the PtoELF3.1 gene can change the phenology of poplars, eliminate their dormancy period transitions during seasonal growth, and make poplars insensitive to short-day conditions. The present invention uses CRISPR / Cas9 technology to target and edit the PtoELF3.1 gene to create evergreen, non-dormant poplar germplasm, thereby improving photosynthetic carbon fixation and tree biomass accumulation, while also providing material for creating ornamental forest germplasm.

Claims

1. Application of the poplar PtoELF3.1 gene in regulating the transition from dormancy to dormancy during seasonal growth of poplars, wherein the poplar PtoELF3.1 gene is a gene encoding a protein having an amino acid sequence shown in SEQ ID No.

1.

2. The use according to claim 1, characterized in that: The application is to knock out the PtoELF3.1 gene through the CRISPR / Cas9 editing system, thereby obtaining poplar germplasm that does not enter a dormant period and remains evergreen under short-day conditions in autumn.

3. The use according to claim 1 or 2, characterized in that: The nucleotide sequence of the poplar PtoELF3.1 gene is shown in SEQ ID No.

2.

4. A method for constructing a poplar strain that does not enter autumn dormancy, characterized in that: The steps include: (1) Using CRISPR / Cas9 editing technology, an editing vector targeting the poplar PtoELF3.1 gene was constructed; (2) Genetic transformation of Populus tomentosa: The editing vector constructed in step (1) was transferred into sterile young wild-type Populus tomentosa leaves using the Agrobacterium-mediated leaf disc method. (3) Identification of transgenic plants: positive plants were identified through poplar tissue culture and DNA extraction.

5. The method according to claim 4, characterized in that The editing vector targeting the poplar PtoELF3.1 gene expresses the sgRNA of the nucleotide sequence shown in SEQ ID No. 3 and / or 4.

6. A sgRNA targeting the poplar PtoELF3.1 gene, characterized in that: The sgRNA nucleotide sequence is shown in any one of SEQ ID No. 3 or SEQ ID No.

4.

7. A gene editing vector, characterized in that: Expressing sgRNA of the nucleotide sequence shown in SEQ ID No.3 and / or SEQ ID No.4.

Images