Application of overexpressed HaFAB2 gene in increasing unsaturated fatty acid content of plant

Abstract

The invention relates to the technical field of gene engineering. The invention provides an application of an overexpressed HaFAB2 gene in increasing the unsaturated fatty acid content of a plant. The HaFAB2 gene provided by the invention can regulate the contents of different fatty acids in plants, improve the nutritional value of plant seeds and improve the stress resistance of the plants; the HaFAB2 gene can also help scientists to better understand a regulation mechanism of plant fatty acid metabolism, reveal a specific action mode and an influence path of fatty acid in a plant physiological process, and provide a theoretical basis and a practical reference for solving various related scientific problems of plant growth, stress resistance and the like.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and in particular to the application of overexpressing HaFAB2 gene in increasing the content of unsaturated fatty acids in plants. Background Art

[0002] Fatty acids are an extremely important type of substance in plants, and changes in their content are of great significance and can help scientists better understand the regulatory mechanism of plant fatty acid metabolism. On the one hand, from the perspective of reflecting the key nodes and rate-limiting steps of the metabolic pathway, the metabolic processes such as the synthesis, modification and degradation of fatty acids in plants are inherently complex, involving many links and the participation of multiple enzymes. On the other hand, in revealing the relationship between transcription factors and gene expression regulation, transcription factors can bind to the promoter regions of genes related to fatty acid metabolism to regulate the transcriptional activities of these genes, thereby affecting the synthesis and metabolism of fatty acids.

[0003] In the prior art, new varieties with stable target traits are cultivated mainly by screening natural varieties or mutant individuals produced by mutagenesis and performing multi-generation hybridization breeding. However, this method relies on existing genetic variation in nature, and the range of selection is relatively limited. The entire breeding process is extremely time-consuming, often requiring several years or even more than ten years, and the breeding efficiency is low. It is difficult to accurately and quickly change the fatty acid content and composition as expected, and it may be accompanied by linkage inheritance of other undesirable traits. Therefore, the art is in urgent need of a method for regulating the content of different fatty acids in plants that is simple to operate and has universal applicability. Summary of the invention

[0004] The purpose of the present invention is to provide an application of overexpressing HaFAB2 gene in increasing the content of unsaturated fatty acids in plants, regulating the content of different fatty acids in plants, improving plant stress resistance, and enhancing the nutritional value of plant seeds.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] The present invention provides application of HaFAB2 gene in regulating the content of different fatty acids in plants.

[0007] Preferably, the plant comprises Arabidopsis thaliana.

[0008] Preferably, the nucleotide sequence of the HaFAB2 gene is shown as SEQ ID NO.1; the nucleotide sequences of the amplification primers of the HaFAB2 gene are shown as SEQ ID NO.2 and SEQ ID NO.3.

[0009] Preferably, the fatty acid comprises one or more of pentadecanedioic acid, palmitic acid, arachidic acid, stearic acid, behenic acid, tetracosanoic acid, heptadecanedioic acid and oleic acid.

[0010] The present invention also provides the use of the HaFAB2 gene in improving plant stress resistance or seed quality.

[0011] Preferably, the method for improving plant stress resistance or seed quality is: overexpressing the HaFAB2 gene in the plant.

[0012] The present invention also provides a method for regulating the content of different fatty acids in plants, comprising the following steps: overexpressing the HaFAB2 gene in the plant.

[0013] The present invention also provides a method for constructing a HaFAB2 gene overexpression vector, the method comprising the following steps:

[0014] 1) The HaFAB2 gene and the overexpression vector pBWA(V)BS-OSGFP were recombined using homologous recombination to obtain the overexpression vector pBWA(V)BS-HaFAB2-OSGFP;

[0015] 2) The overexpression vector pBWA(V)BS-HaFAB2-OSGFP was transferred into plants through Agrobacterium-mediated method to overexpress the HaFAB2 gene.

[0016] Preferably, the Agrobacterium is EHA105.

[0017] The beneficial effects of the present invention are:

[0018] The present invention provides an application of the HaFAB2 gene in regulating the content of different fatty acids in plants. The HaFAB2 gene provided by the present invention can regulate the content of different fatty acids in plants, improve the nutritional value of plant seeds, and also improve plant stress resistance.

[0019] The present invention also provides a transgenic plant obtained by overexpressing the HaFAB2 gene, which can help scientists better understand the regulatory mechanism of plant fatty acid metabolism, reveal the specific action mode and impact path of fatty acids in plant physiological processes, and provide a theoretical basis and practical reference for solving many scientific problems related to plant growth, stress resistance, etc. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 is a map of the overexpression vector pBWA(V)BS-HaFAB2-OSGFP;

[0021] Figure 2 This is the PCR detection diagram of the expression vector bacterial solution;

[0022] Figure 3 This is the enzyme digestion detection diagram of the overexpression vector;

[0023] Figure 4 This is the subcellular localization map of HaFAB2;

[0024] Figure 5 This is the identification diagram of transgenic Arabidopsis;

[0025] Figure 6 The fatty acid composition of Arabidopsis thaliana overexpressing HaFAB2 (* represents p < 0.05, which is significantly different from the wild type). DETAILED DESCRIPTION

[0026] The present invention provides application of HaFAB2 gene in regulating the content of different fatty acids in plants.

[0027] In the present invention, the plant includes Arabidopsis thaliana.

[0028] In the present invention, the nucleotide sequence of the HaFAB2 gene is shown in SEQ ID NO.1;

[0029]

[0030] In the present invention, the nucleotide sequences of the amplification primers of the HaFAB2 gene are shown in SEQ ID NO.2 and SEQ ID NO.3; the nucleotide sequence of the SEQ ID NO.2 is (F): agaacaacatcaacaatggcgattc; the nucleotide sequence of the SEQ ID NO.3 is (R): atagcaactttcagagcttcacttc.

[0031] In the present invention, the binding position of the amplification primer of the HaFAB2 gene is within the HaFAB2 gene sequence and in its upstream and downstream untranslated regions, which is characterized by the capital letter portion in the sequence of SEQ ID NO.4:

[0032] AGAACAACATCAACAATGGCGATTCgcatcaatacggcgacgtttcaatcagacctgtaccgt

[0033] tcattcgcgtttcctcaaccgaaacctctcagatctcccaaattcgccatggcttccaccattggatccgccacaacga

[0034] aggttgaaagcaccaaaaagccctttacccctccaagggaggttcaccaacaggtgctacactcaatgccgccaca

[0035] aaagatcgaaatcttcaaatccatggagggttgggccgaagataacatattggttcacctaaagcctgtcgaaaaatg

[0036] ctggcaagcacaggatttcctaccagatcccgcatctgacggatttatggaacaagtggaggaattacgggctcgg

[0037] gctaaggagatccggatgattactttgttgttttggttggagatatgattactgaagaagcactgcctacttaccaaaca

[0038] atgcttaatactcttgatggtgtgcgtgatgagaccggggctagccctacttcttgggctatctggactcgggcttgga

[0039] ccgctgaagaaaacaggcacggtgatcttctacatcagtatctgtatcttagtgggcgggtcgacatgaggcagattc

[0040] agaagacaattcagtacctcattgggtctggaatggacccccggaccgaaaacagtccttaccttgggttcatctaca

[0041] cttcatttcaagagcgtgccaccttcatctctcacgggaaacacagcccggcacgcaaaggagcatggtgacgtgaa

[0042] gctggctcaaatgtgcggtataattgcagctgatgaaaaaaggcacgaaaccgctacacaaaaatagtagaaaaa

[0043] ctcttcgaaattgacccggacggcactgttctcgcttttgccgacatgatgaggaaaagatctccatgcctgcacact

[0044] tgatgtacgatgggcgtgatgataacctcttcgaaaatttctcagctgttgcccaaaggctcggtgtgtacactgcgaa

[0045] ggactatgcagacattctggagtttctggtgggccggtggaaggtggcggatttaaccgggctttctggtgaagggc

[0046] gtaaagcccaagactatgtgtgtgcgggctggccccaagaatcagaaggcttgaggagagactcggcaagggcg

[0047] aagtaagtgtgaacgttccgttcagctggatctttgatagaGAAGTGAAGCTCTGAAAGTTGCTAT.

[0048] In the present invention, the method for obtaining the HaFAB2 gene is to extract RNA from sunflower seeds and reverse transcribe it to synthesize cDNA, which is the nucleotide sequence of the HaFAB2 gene.

[0049] In the present invention, the amplification method of the HaFAB2 gene is: using amplification primers SEQ ID NO.2 and SEQ ID NO.3 to perform PCR on the HaFAB2 gene;

[0050] The PCR reaction system for amplifying the HaFAB2 gene is as follows: total volume 20 μL, cDNA 1 μL, Primer 1 μL each, 2×KOD PCR MasterMix 10 μL, ddH 2 O 7 μL;

[0051] The PCR amplification program for the HaFAB2 gene was as follows: 94°C for 3 min, 94°C for 30 s, 58°C for 30 s, 72°C for 90 s, for a total of 30 cycles, and finally an extension at 72°C for 7 min.

[0052] In the present invention, the fatty acid includes one or more of pentadecanedioic acid, palmitic acid, arachidic acid, stearic acid, behenic acid, tetracosanoic acid, heptadecanedioic acid and oleic acid;

[0053] The changes of the fatty acids are as follows: the contents of pentadecanedeoic acid, palmitic acid, arachidic acid, stearic acid, behenic acid and tetracosanoic acid are reduced; and the contents of heptadecanedeoic acid and oleic acid are increased.

[0054] The present invention also provides the use of the HaFAB2 gene in improving plant stress resistance or seed quality.

[0055] In the present invention, the method for improving plant stress resistance or seed quality is: overexpressing the HaFAB2 gene in plants.

[0056] The present invention also provides a method for regulating the content of different fatty acids in plants, comprising the following steps: overexpressing the HaFAB2 gene in the plant.

[0057] The present invention also provides a method for constructing a HaFAB2 gene overexpression vector, the method comprising the following steps:

[0058] 1) The HaFAB2 gene and the overexpression vector pBWA(V)BS-OSGFP were recombined using homologous recombination to obtain the overexpression vector pBWA(V)BS-HaFAB2-OSGFP;

[0059] 2) The overexpression vector pBWA(V)BS-HaFAB2-OSGFP was transferred into plants through Agrobacterium-mediated method to overexpress the HaFAB2 gene.

[0060] In the present invention, the steps of constructing the overexpression vector pBWA(V)BS-HaFAB2-OSGFP by homologous recombination are preferably:

[0061] ① Use Biorun Pfu PCR Mix to carry out PCR reaction, and the primer sequence used is preferably:

[0062] SEQ ID NO.5(F): aacacgggggactttgcaacatggcgattcgcatcaatacggcg,

[0063] SEQ ID NO.6(R): ccgctgtacagagcttcacttctctatcaaagatccagc,

[0064] SEQ ID NO.7(F): agtgaagctctgtacagcggccgcttcagg,

[0065] SEQ ID NO.8(R): tcctcgcccttcacgatacaaattgctgcggcagccgatcc;

[0066] The reaction system is preferably: Nuclease-free Water 20 μL, BiorunPfu PCR Mix 25 μL, Primer (+) (100 μM) 2 μL, Primer (-) (100 μM) 2 μL, Template 1 μL, total volume 50 μL;

[0067] The reaction procedure is preferably: 94°C for 5 min; 94°C for 30 s, 50°C for 45 s, 72°C for 39 s, 30 cycles; 72°C for 10 min;

[0068] The sol was recovered using a DNA gel recovery kit, and the PCR recovery product was obtained by dissolving it with a total volume of 40 μL of water. The gene sequencing primer used for the PCR recovery product is preferably: cttgaaatgaagtgtagatgaaccca (SEQ ID NO. 9), and it was used after the detection was correct;

[0069] ② Use BsaI to digest the vector pBWA(V)BS-OSGFP and incubate at 37°C for 1 hour. The digestion system is: Nuclease-free Water 13μL, 10×Buffer 2μL, BsaI 1μL, pBWA(V)BS-OSGFP 4μL. After the vector digestion product is purified with a PCR purification kit, the vector digestion product is recovered.

[0070] ③ The recovered vector digestion product and the PCR recovered product are subjected to a recombination reaction. The reaction system is preferably: Biorun2*EasyClone Mix 10 μL, PCR recovered product 5 μL, pBWA(V)BS-OSGFP 5 μL, 37°C for 30 hours to obtain a recombination reaction product;

[0071] ④Then the recombinant reaction product was transformed into Escherichia coli DH5α competent cells, and plaques were picked for PCR identification, primers: 35seq-F: ttcatttggagagaacacgggggac (SEQ ID NO.10); HaFAB2-412R: atcatccggaatctccttagc (SEQ ID NO.11).

[0072] In the present invention, the Agrobacterium is EHA105.

[0073] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0074] The reagents and consumables used in the present invention are from: Plant Total RNA Extraction Kit (Tiangen Biochemical Technology Co., Ltd.), ReverTra Ace qPCR RT Master Mix with gDNA Remover (TOYOBO), High-Fidelity Enzyme (Beijing Aidelai Biotechnology Co., Ltd.), Overexpression Vector pBWA(V)BS-OSGFP (Wuhan Boyuan Biotechnology Co., Ltd.), Biorun Pfu PCR Mix (Biorun), DNA Gel Recovery Kit (Axygen), PCR Purification Kit (Axygen), Agrobacterium EHA105 (Shanghai Weidi Biotechnology Co., Ltd.), Agrobacterium GV3101 (Shanghai Weidi Biotechnology Co., Ltd.), Escherichia coli DH5α Competent Cells (Shanghai Weidi Biotechnology Co., Ltd.), LB Liquid Medium (Shanghai Weidi Biotechnology Co., Ltd.), YEB Liquid Medium (Shanghai Weidi Biotechnology Co., Ltd.), LB Solid Medium (Shanghai Weidi Biotechnology Co., Ltd.).

[0075] Example 1 Acquisition of HaFAB2 gene

[0076] Total RNA from sunflower seeds was extracted using a plant total RNA extraction kit, and 0.5 μg of RNA was used to synthesize the first-chain cDNA using ReverTraAceqPCR RT MasterMix with gDNARemover.

[0077] According to the published information of sunflower genome database, the primers for amplification of sunflower HaFAB2 gene were designed. The primer sequences were F: agaacaacatcaacaatggcgattc (SEQ ID NO.2), R: atagcaactttcagagcttcacttc (SEQ ID NO.3). High-fidelity enzyme was used to amplify the open reading frame (ORF) sequence of HaFAB2 gene. The total PCR reaction system was 20 μL: cDNA 1 μL, Primer 1 μL each, 2×KOD PCR MasterMix 10 μL, ddH 2 O 7μL. The PCR amplification program was: 94℃3min; 94℃30s, 58℃30s, 72℃90s, a total of 30 cycles; finally 72℃ extension for 7min, the PCR product was recovered and connected to the pMD18-T vector, and after verification by bacterial liquid PCR, it was sent to Jilin Kumei Biotechnology Co., Ltd. for sequencing, and the sequence was determined to be the sunflower FAB2 gene after sequence comparison.

[0078] Example 2 Construction of HaFAB2 overexpression vector

[0079] The steps of constructing the overexpression vector pBWA(V)BS-HaFAB2-OSGFP by homologous recombination are as follows:

[0080] Biorun Pfu PCRMix was used to perform PCR reaction, and primers were designed based on the HaFAB2 gene and the overexpression vector pBWA(V)BS-OSGFP:

[0081] SEQ ID NO.5(F): aacacgggggactttgcaacatggcgattcgcatcaatacggcg,

[0082] SEQ ID NO.6(R): ccgctgtacagagcttcacttctctatcaaagatccagc,

[0083] SEQ ID NO.7(F): agtgaagctctgtacagcggccgcttcagg,

[0084] SEQ ID NO.8(R): tcctcgcccttcacgatacaaattgctgcggcagccgatcc;

[0085] SEQ ID NO.4(F) and SEQ ID NO.5(R) are primers for amplifying the HaFAB2 gene, and SEQ ID NO.6(F) and SEQ ID NO.7(R) are primers for amplifying the linker.

[0086] Reaction system: Nuclease-free Water 20μL, Biorun Pfu PCR Mix 25μL, Primer (+) (100μM) 2μL, Primer (-) (100μM) 2μL, Template 1μL, total volume 50μL;

[0087] Reaction program: 94°C for 5 min; 94°C for 30 s, 50°C for 45 s, 72°C for 39 s, 30 cycles; 72°C for 10 min;

[0088] The sol was recovered using a DNA gel recovery kit and dissolved in a total volume of 40 μL of water to obtain a PCR recovery product. The gene sequencing primer for the PCR recovery product was designed to be 644C: cttgaaatgaagtgtagatgaaccca (SEQ ID NO.9). After the test was correct, it was set aside for use.

[0089] The vector pBWA(V)BS-OSGFP was digested with BsaI and incubated at 37°C for 1 hour. Enzyme digestion system: Nuclease-free Water 13μL, 10×Buffer 2μL, BsaI 1μL, pBWA(V)BS-OSGFP 4μL. The vector digestion product was purified with a PCR purification kit and the vector digestion product was recovered.

[0090] The recovered vector digestion product and the PCR recovery product were recombined, the reaction system: Biorun 2*EasyClone Mix 10μL, PCR recovery product 5μL, pBWA(V)BS-OSGFP 5μL, 37℃ for 30h, to obtain the recombinant reaction product. The recombinant reaction product was then transformed into E. coli DH5α competent cells, and plaques were picked for PCR identification, primers: 35seq-F: ttcatttggagagaacacgggggac (SEQ ID NO.10); HaFAB2-412R: atcatccggaatctccttagc (SEQ ID NO.11), and then the bacterial solution was sent to Wuhan Boyuan Biotechnology Co., Ltd. for sequencing, and the plasmid was extracted from the correctly sequenced bacterial solution.

[0091] The HaFAB2 gene and the overexpression vector pBWA(V)BS-OSGFP were recombined using the homologous recombination method to obtain the overexpression vector pBWA(V)BS-HaFAB2-OSGFP (i.e., recombinant plasmid). Figure 1 As shown. After bacterial solution PCR, a specific electrophoresis band consistent with the fragment size was found at the specified position ( Figure 2 ), the recombinant plasmid was digested with EcoRV endonuclease, and the recombinant plasmid accuracy quality control chart ( Figure 3 ), it was found that the EcoRV restriction enzyme cutting bands were 1106bp, 2161bp, 2605bp, and 5324bp, respectively, which were consistent with the theoretical values, verifying that the overexpression vector was accurately constructed.

[0092] Example 3 Subcellular localization of HaFAB2

[0093] The overexpression vector pBWA(V)BS-HaFAB2-OSGFP plasmid was transformed into Agrobacterium GV3101 by electroporation. A single colony was picked and melted into 10 mL YEB liquid culture medium for growth. The culture was cultured at 170 rpm / min for 1 h. The bacterial solution was centrifuged at 4000 rpm / min for 4 min and the supernatant was discarded. The bacterial cells were placed in 10 mM MgCl 2 The cells were resuspended in a suspension of 50 μM AS (containing 120 μM AS) and the OD600 was adjusted to about 0.6. The bacterial solution was then injected into the lower epidermis of 4-week-old Nicotiana benthamiana leaves using a 1 mL syringe without a needle. The leaves were grown at 25°C in the dark for 2 days and the results were observed under a laser confocal microscope.

[0094] The overexpression vector pBWA(V)BS-HaFAB2-OSGFP was transiently transformed into tobacco using the above method. It can be seen that green fluorescence can only be observed in the chloroplasts of cells transformed with the HaFAB2 gene vector ( Figure 4 ), indicating that the HaFAB2 gene is expressed in the chloroplasts of tobacco leaves.

[0095] Example 4 Obtaining HaFAB2 transgenic strains

[0096] Take 50 μL of EHA105 Agrobacterium competent cells, add 1 μL of overexpression vector pBWA(V)BS-HaFAB2-OSGFP plasmid into it with a pipette, pipette to evenly distribute them, transfer the mixture for electroporation, so that the overexpression vector pBWA(V)BS-HaFAB2-OSGFP plasmid enters the EHA105 Agrobacterium competent cells. After completion, add 1 mL of LB liquid culture medium to evenly distribute the transfected EHA105 Agrobacterium in the culture medium, transfer the mixture to a 1.5 mL Ep tube, and incubate in a 30°C shaker for 30 minutes. Transfer 50 μL of the activated bacterial solution to LB solid culture medium and grow for 48 hours at 30°C in the dark. Bacterial liquid PCR, primer 35seqF: ttcatttggagagaacacgggggac (SEQ ID NO.10), HaFAB2-412R: atcatccggaatctccttagc (SEQ ID NO.11), prepare 1% agarose gel, and perform electrophoresis detection. When the electrophoresis bands of the positive control and the sample are clear and of the correct size, and the negative control has no bands, it indicates that the sample can proceed to the next step.

[0097] Place the bacterial precipitate in 200mL of resuspension solution (5% sucrose solution), adjust OD600 to 0.8-1.2, and add silwet-77 to the resuspension solution to a final concentration of 0.02%. Cut off the white inflorescences of Arabidopsis, and then soak all the inflorescences of Arabidopsis in the bacterial solution for 2-3 seconds, then seal the film, keep the environmental humidity at more than 90%, and grow in the dark at 25℃ for 24 hours. One cycle is 7 days of infiltration, and there are 3 cycles in total. Cultivate the infiltrated seedlings in an environment of 23℃ and 16 / 8 light intensity, and wait for seeds to form.

[0098] The overexpression vector pBWA(V)BS-HaFAB2-OSGFP was used to infect Arabidopsis thaliana inflorescences ( Figure 5 A), harvest Arabidopsis T0 generation seeds for resistance screening, the screening method is: the seeds are disinfected with 75% ethanol for 5 minutes, 10% sodium hypochlorite for 10 minutes, washed with sterile water 3 times, and evenly spread on a 1 / 2MS solid culture medium plate with kanamycin (50 mg / L) resistance, and placed at 4°C for 3 days. Take out the plate and place it at 22°C and 16 / 8 light conditions for 10 days. These seedlings that grow healthy green roots and true leaves may be resistant seedlings, and these resistant seedlings are transplanted into nutrient soil. ( Figure 5 B). After transplanting the resistant seedlings, the PCR test results showed that the target band could be amplified in the resistant seedlings ( Figure 5 C), indicating that the transgenic plant was successful. The qRT-PCR results showed that HaFAB2 had the highest expression level in the transgenic plant FAB2-6, followed by FAB2-4 and FAB2-7 ( Figure 5 D), FAB2-6 was selected for subsequent functional analysis of the HaFAB2 gene.

[0099] Example 5 Detection of fatty acid content in transgenic Arabidopsis

[0100] The rosette leaves of 4-week-old transgenic T3 Arabidopsis (FAB2-6) and wild-type Arabidopsis (WT) were taken, and the fatty acid content of the leaves of HaFAB2-overexpressing T3 Arabidopsis was determined by gas chromatography (GB / T 17377-2008). The results showed that the proportion of each fatty acid component in transgenic Arabidopsis was significantly changed compared with that in wild-type Arabidopsis (Col-0) ( Figure 6), among which the contents of pentadecanedenoic acid (C15:1), palmitic acid (C16:0), arachidic acid (C20:0), stearic acid (C18:0), behenic acid (C22:0), and tetracosanoic acid (C24:0) were significantly reduced; the contents of heptadecanedenoic acid (C17:1) and oleic acid (C18:1) were significantly increased, and the content of C18:1 increased the most, increasing by 9.29%; α-linolenic acid (C18:3) and linoleic acid (C18:2) did not change significantly. After overexpressing HaFAB2 in Arabidopsis, the proportion of total unsaturated fatty acids increased significantly.

[0101] As can be seen from the above examples, the present invention provides an application of overexpressing the HaFAB2 gene in increasing the content of unsaturated fatty acids in plants. The HaFAB2 gene provided by the present invention can regulate the content of different fatty acids in plants, improve the nutritional value of plant seeds, and improve plant stress resistance; the HaFAB2 gene can also help scientists better understand the regulatory mechanism of plant fatty acid metabolism, reveal the specific mode of action and impact path of fatty acids in plant physiological processes, and provide a theoretical basis and practical reference for solving many scientific problems related to plant growth, stress resistance, etc.

[0102] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Application of HaFAB2 gene in regulating the content of different fatty acids in plants.

2. The use according to claim 1, characterized in that: The plants include Arabidopsis thaliana.

3. The use according to claim 1, characterized in that: The nucleotide sequence of the HaFAB2 gene is shown as SEQ ID NO.1; the nucleotide sequences of the amplification primers of the HaFAB2 gene are shown as SEQ ID NO.2 and SEQ ID NO.

3.

4. The use according to claim 1, characterized in that: The fatty acid comprises one or more of pentadecanedioic acid, palmitic acid, arachidic acid, stearic acid, behenic acid, tetracosanoic acid, heptadecanedioic acid and oleic acid.

5. Use of the HaFAB2 gene according to any one of claims 1 to 4 in improving plant stress resistance or seed quality.

6. The use according to claim 5, characterized in that: The method for improving plant stress resistance or seed quality is: overexpressing the HaFAB2 gene in plants.

7. A method for regulating the content of different fatty acids in plants, characterized in that: The method comprises the following steps: overexpressing the HaFAB2 gene in plants.

8. A method for constructing a HaFAB2 gene overexpression vector, characterized in that: The construction method comprises the following steps: 1) The HaFAB2 gene and the overexpression vector pBWA(V)BS-OSGFP were recombined using homologous recombination to obtain the overexpression vector pBWA(V)BS-HaFAB2-OSGFP; 2) The overexpression vector pBWA(V)BS-HaFAB2-OSGFP was transferred into plants through Agrobacterium-mediated method to overexpress the HaFAB2 gene.

9. The construction method according to claim 8, characterized in that: The Agrobacterium is EHA105.

Images