Human interleukin 5 alpha receptor IL5RA mRNA detection primer probe set, kit and application

Abstract

The invention provides a human interleukin 5 alpha receptor IL5RA mRNA (messenger Ribonucleic Acid) detection primer probe group, a kit and application, and belongs to the technical field of biological detection. A detection primer probe group is limited to comprise IL5RA-F, IL5RA-R and a probe I5-Probe, the expression level of human interleukin 5 alpha receptor (IL5RA) mRNA is detected in cooperation with an RNA one-step method, the content change of IL5RA can be sensitively detected, and compared with an immunological detection method, the detection sensitivity can be greatly improved, a low-concentration clinical sample can be detected, and the detection method has the advantages that the detection time is shortened, and the detection cost is reduced. The detection range can span at least five orders of magnitude, the accuracy of the detection result is improved, and at least 80 persons can be detected within one hour, so that the treatment effect can be dynamically monitored and evaluated more accurately and quickly in an earlier stage.

Description

Technical Field

[0001] The present invention belongs to the field of biological detection technology, and in particular relates to a primer probe group, a kit and an application of a human interleukin 5α receptor IL5RA mRNA detection kit. Background Art

[0002] Interleukin 5 (IL-5) is a major factor involved in the maturation and differentiation of eosinophils (EOS), and its action is mediated by the specific receptor interleukin 5 receptor α chain (IL-5Rα). As a Th2-type cytokine, interleukin 5 (IL-5) is mainly released and produced by Th2 cells, sensitized mast cells and mature EOS in the lungs, and plays an important role in the differentiation, proliferation and maturation of EOS in the bone marrow. The action of IL-5 is mediated by a heterodimeric receptor complex. The complex includes the cytokine binding site - the ligand-specific IL-5 receptor α chain (IL-5Rα) and a signal transduction β subunit. Since this specific IL-5Rα is expressed on the surface of mature EOS and basophils, the binding of IL-5 to these cells is specific. IL-5R is mainly expressed on the surface of mature EOS, and CD34 in the bone marrow of asthma patients is highly expressed. + The number of cells and Eo / BCFU increases, and IL-5Rα and IgE high-affinity receptors can also be expressed on their surfaces. The upregulation of these receptor levels can enable the cells to bind to IL-5 in the circulation and promote the formation of EOS. At the same time, IL-5 may promote the expression of IL-5Rα on the surface of EOS and its precursor cells, thereby increasing the maturation of EOS, further releasing IL-5, generating circulation, and expanding its effect. At present, most interleukin 5α receptor tests are antigen-antibody tests, but there are many problems, such as the inability of antigens and antibodies to bind effectively, the detection substrate is not sensitive enough, resulting in low or no signal, etc. There is an urgent need for a detection method with better detection effect and higher sensitivity. Summary of the invention

[0003] In view of this, the object of the present invention is to provide a primer probe set, a kit and an application for detecting human interleukin 5α receptor IL5RA mRNA.

[0004] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0005] The present invention provides a detection primer probe set for human interleukin 5α receptor IL5RAmRNA, wherein the detection primer probe set comprises IL5RA-F, IL5RA-R and probe I5-Probe;

[0006] The nucleotide sequence of the IL5RA-F is shown in SEQ ID NO.1, the nucleotide sequence of the IL5RA-R is shown in SEQ ID NO.2, and the nucleotide sequence of the probe I5-Probe is shown in SEQ ID NO.3.

[0007] Preferably, the primer-probe set further comprises primers and probes for detecting the internal reference gene GAPDH, the primers for GAPDH comprise GAPDH-F and GAPDH-R, and the probe is G-Probe;

[0008] The nucleotide sequence of the GAPDH-F is shown in SEQ ID NO.4, the nucleotide sequence of the GAPDH-R is shown in SEQ ID NO.5, and the nucleotide sequence of the G-Probe is shown in SEQ ID NO.6.

[0009] Preferably, the 5' ends of the probes I5-Probe and G-Probe are labeled with different fluorescent labeling groups, and the 3' ends are labeled with a quenching group.

[0010] Preferably, the fluorescent labeling group includes FAM or JOE, and the quenching group includes BHQ1.

[0011] The present invention provides the use of the detection primer probe group in preparing a kit for detecting human interleukin 5α receptor IL5RA mRNA.

[0012] The invention provides a kit for detecting the expression level of human interleukin 5α receptor IL5RA mRNA. The kit comprises the primer probe set, PCR reaction solution, enzyme mixture, human interleukin 5α receptor IL5RA standard, ROX reference dye and nuclease-free water.

[0013] Preferably, the amplification system includes the following components at final concentrations: 2-3 μL of nuclease-free water, 8-12 μL of PCR reaction solution, 0.3-0.8 μL of enzyme mixture, 0.01-0.2 μL of ROX reference dye, 1-3 μL of a mixture of detection primer probe sets, and 3-8 μL of human interleukin 5α receptor IL5RA standard.

[0014] Preferably, the mixture of the detection primer probe set contains components with the following concentrations:

[0015] IL5RA-F 0.5~1.5μM, IL5RA-R 0.5~1.5μM, I5-Probe 1~2μM, GAPDH-F 1~3μM, GAPDH-R 1~3μM, G-Probe 2~4μM.

[0016] Preferably, the PCR amplification program of the kit includes: 42°C for 30 min; 95°C for 1 min; 95°C for 5 s, 60°C for 31 s, and 40 cycles.

[0017] Compared with the prior art, the present invention has the following beneficial effects:

[0018] The present invention provides a primer probe group, a kit and an application for detecting human interleukin 5α receptor IL5RA mRNA. The RNA one-step method is used to detect the expression level of human interleukin 5α receptor (IL5RA) mRNA. On the one hand, it can determine whether the patient's asthma and chronic sinusitis with nasal polyps symptoms are caused by the interleukin 5 pathway and guide the dosage. On the other hand, it can dynamically monitor the effect of anti-IL-5 drug treatment, and provide a detection method with high accuracy, wide detection range and high sensitivity for the detection of IL-5R protein. The primer probe group of the present invention does not need to be reverse-transcribed separately, which greatly reduces the risk of aerosol contamination. Compared with the immunological detection method, the detection sensitivity of the present invention is high, and low-concentration clinical samples can be detected. It can sensitively detect changes in the content of IL5RA, and the detection range can span at least 5 orders of magnitude, which increases the accuracy of the test results. At least 80 people can be tested within 1 hour, so that the treatment effect can be dynamically monitored and the efficacy evaluation can be performed earlier, more accurately and faster. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 is the plasmid map of the pGM-T vector;

[0020] Figure 2 IL5RAmRNA TaqMan real-time fluorescence quantitative RT-PCR standard curve;

[0021] Figure 3 This is the precision test result diagram, where 1: 1.0×10 6 copies / μL; 2: 1.0×10 3 copies / μL;

[0022] Figure 4 This is a graph showing the detection accuracy of the primer probe set for detecting human interleukin 5α receptor IL5RAmRNA;

[0023] Figure 5 This is a graph showing the detection sensitivity results of the primer probe set for detecting human interleukin 5α receptor IL5RAmRNA;

[0024] Figure 6 These are the results of clinical sample testing, where 1 is GAPDH mRNA before treatment of case 1; 2 is GAPDH mRNA after treatment of case 1; 3 is IL5RA mRNA before treatment of case 1; 4 is IL5RA mRNA after treatment of case 1.

[0025] Figure 7 This is a low-precision amplification curve when the primers and probes are not designed properly. DETAILED DESCRIPTION

[0026] The present invention provides a detection primer probe set for human interleukin 5α receptor IL5RA mRNA, wherein the detection primer probe set comprises IL5RA-F, IL5RA-R and probe I5-Probe;

[0027] The nucleotide sequence of the IL5RA-F is shown in SEQ ID NO.1:

[0028] SEQ ID NO.1: GTACGATGTTCAAGTGAG;

[0029] The nucleotide sequence of the IL5RA-R is shown in SEQ ID NO.2:

[0030] SEQ ID NO.2: GCTTGTGTTCATCATTTC;

[0031] The nucleotide sequence of the probe I5-Probe is shown in SEQ ID NO.3:

[0032] SEQ ID NO. 3: AGGTTGGCTCCACTCACTCC.

[0033] Preferably, the primer-probe set further comprises primers and probes for detecting the internal reference gene GAPDH, the primers for GAPDH comprise GAPDH-F and GAPDH-R, and the probe is G-Probe;

[0034] The nucleotide sequence of GAPDH-F is shown in SEQ ID NO.4:

[0035] SEQ ID NO.4: GACAACAGCCTCAAGATCATC;

[0036] The nucleotide sequence of the GAPDH-R is shown in SEQ ID NO.5:

[0037] SEQ ID NO.5: CGCCACAGTTTCCCGGAG;

[0038] The nucleotide sequence of the G-Probe is shown in SEQ ID NO.6:

[0039] SEQ ID NO. 6: ACTCATGACCACAGTCCATGCCAT.

[0040] In the present invention, the 5' ends of the probes I5-Probe and G-Probe are labeled with different fluorescent labeling groups, and the fluorescent labeling groups are preferably FAM or JOE; the fluorescent protein at the 5' end of the probe I5-Probe is preferably FAM, and the fluorescent protein at the 5' end of the G-Probe is preferably JOE; the 3' ends of the probes I5-Probe and G-Probe are labeled with a quenching group, and the quenching group is preferably BHQ1.

[0041] The present invention provides the use of the detection primer probe group in preparing a kit for detecting human interleukin 5α receptor IL5RA mRNA.

[0042] The present invention provides a kit for detecting the expression level of human interleukin 5α receptor IL5RA mRNA, wherein the kit preferably comprises the primer probe set, PCR reaction solution, enzyme mixture, human interleukin 5α receptor IL5RA standard, ROX reference dye and nuclease-free water.

[0043] In the present invention, the amplification system includes the following components with final concentrations: the amount of nuclease-free water added is preferably 2-3 μL, more preferably 2.2-2.7 μL, and more preferably 2.4 μL; the amount of PCR reaction solution added is preferably 8-12 μL, more preferably 9-11 μL, and more preferably 10 μL; the amount of enzyme mixture added is preferably 0.3-0.8 μL, more preferably 0.4-0.6 μL, and more preferably 0.5 μL; the amount of ROX reference dye added is preferably 0.01-0.2 μL, more preferably 0.05-0.15 μL, and more preferably 0.1 μL, the amount of the mixed solution of the detection primer probe group added is preferably 1-3 μL, more preferably 1.5-2.5 μL, and more preferably 2 μL; the amount of human interleukin 5α receptor IL5RA standard added is preferably 3-8 μL, more preferably 4-6 μL, and more preferably 5 μL.

[0044] In the present invention, the mixed solution of the detection primer probe set contains the following components in concentration:

[0045] The concentration of IL5RA-F is preferably 0.5 to 1.5 μM, more preferably 0.7 to 1.2 μM, and even more preferably 1 μM;

[0046] The concentration of IL5RA-R is preferably 0.5 to 1.5 μM, more preferably 0.7 to 1.2 μM, and even more preferably 1 μM;

[0047] The concentration of probe I5-Probe is preferably 1 to 2 μM, more preferably 1.2 to 1.8 μM, and even more preferably 1.5 μM;

[0048] The concentration of GAPDH-F is preferably 1 to 3 μM, more preferably 1.5 to 2.5 μM, and even more preferably 2 μM;

[0049] The concentration of GAPDH-R is preferably 1 to 3 μM, more preferably 1.5 to 2.5 μM, and even more preferably 2 μM;

[0050] The concentration of G-Probe is preferably 2 to 4 μM, more preferably 2.5 to 3.5 μM, and even more preferably 3 μM.

[0051] In the present invention, the enzyme mixture preferably includes a hot-start Taq enzyme and a reverse transcriptase, and the enzyme activity ratio of the hot-start Taq enzyme to the reverse transcriptase is preferably 3-7:1-3, more preferably 4-6:1.5-2.5, and more preferably 5:2, that is, the enzyme activity of the hot-start Taq enzyme is preferably 3-7 U / μL, more preferably 4-6 U / μL, and more preferably 5 U / μL; the enzyme activity of the reverse transcriptase is preferably 1-3 U / μL, more preferably 1.5-2.5 U / μL, and more preferably 2 U / μL. Hot-start Taq enzyme is a heat-resistant hot-start Taq DNA polymerase. It uses its 3'→5' polymerase activity to add deoxymononucleotides in dNTP to the 3'-OH end one by one with DNA as a template; at the same time, it uses its 5'→3' exonuclease activity to both identify and eliminate mismatched primer ends, which is related to the correction function in the replication process, and hydrolyze nucleotides from the 5' end. It can also work through several nucleotides to remove mismatched nucleotides, thereby achieving chain replacement during chain extension and cutting off the replaced probe; reverse transcriptase can reverse transcribe mRNA into cDNA for PCR reaction.

[0052] In the present invention, the PCR reaction solution preferably includes dNTP mix, MgCl2 and a buffer, wherein the dNTP mix is ​​a mixture of dATP, dTTP, dCTP and dGTP, and the concentrations of the dATP, dTTP, dCTP and dGTP are independently preferably 0.1 to 1 mM, more preferably 0.1 to 0.5 mM, and more preferably 0.4 mM; the concentration of MgCl2 is preferably 3 to 20 mM, more preferably 3.5 to 8 mM, and more preferably 4 mM; the buffer is preferably a Tris-HCl buffer, and the concentration is preferably 10 to 100 mM, more preferably 40 to 60 mM, and more preferably 50 mM, and the pH of the Tris-HCl buffer is preferably 8.

[0053] The present invention also includes measuring the expression of human interleukin 5α receptor IL5RA mRNA based on a standard curve prepared according to the standard substance. The standard curve of the present invention uses the logarithmic value of the copy number as the abscissa (x) and the Ct value as the ordinate (y): y = -3.31865x + 36.09281 (|r| = 0.99965).

[0054] In the present invention, the sources of human interleukin 5α receptor IL5RA mRNA include human blood, nasal secretions, bronchial washings, saliva or tear samples.

[0055] In the present invention, the PCR amplification program of the kit is preferably: 42°C for 30 min; 95°C for 1 min; 95°C for 5 s, 60°C for 31 s, and 40 cycles.

[0056] Sources

[0057] dNTP mix was purchased from ThermoFisher, catalog number: R0192;

[0058] Interleukin 5α receptor IL5RA standard was purchased from Nanjing GenScript Biotechnology Co., Ltd.;

[0059] The whole blood total RNA kit was purchased from Hangzhou Xinjing Biological Reagent Development Co., Ltd., catalog number: 5201050;

[0060] HiScribe T7 HighYield RNA Synthesis Kit was purchased from New England Biolabs, catalog number: E2050S;

[0061] Fluorescence quantitative PCR instrument was purchased from Shanghai Hongshi Medical Technology Co., Ltd.;

[0062] -80°C low-temperature refrigerator was purchased from ThermoFisher, USA;

[0063] High-speed low-temperature desktop centrifuge was purchased from Eppendorf, Germany;

[0064] Qubit 3 Fluorometer was purchased from ThermoFisher, USA;

[0065] pGM-T ligation kit was purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd., catalog number: VT202-01;

[0066] HiScribe T7 High Yield RNA Synthesis Kit was purchased from NEW ENGLAND BioLabs, catalog number: E2040S.

[0067] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0068] Example 1

[0069] 1) Shanghai Sunny Biotechnology Co., Ltd. was commissioned to synthesize the primers and probes shown in SEQ ID NOs. 1 to 6.

[0070] 2) Preparation of standard products

[0071] In vitro transcription: pGM-T ligation kit was used to construct IL5RA plasmid DNA with pGM-T as the vector (commissioned to Nanjing GenScript Biotechnology Co., Ltd. for construction and synthesis, see Figure 1 ), and IL5RA plasmid DNA was transcribed into mRNA in vitro using HiScribe T7 HighYield RNA Synthesis Kit.

[0072] According to the copy number calculation formula: copy number = [6.02 × 10 23 × RNA concentration (ng / μL) × 10 -9 ] / [RNA length (bp) × 340], calculate the initial RNA copy number. Dilute with nuclease-free water to 1.0 × 10 9 copeies / μL, which is the IL5RA standard.

[0073] 3) Whole blood RNA extraction and dilution: EDTA anticoagulated whole blood samples were used to extract total blood RNA using a whole blood total RNA kit, quantified using a Qubit 3 fluorometer, and then diluted to 20 ng / μL with nuclease-free water.

[0074] 4) TaqMan real-time fluorescence quantitative PCR

[0075] Using standard / whole blood RNA as template, prepare 20 μL system: 2.4 μL nuclease-free water, 10 μL PCR reaction solution, 0.5 μL enzyme mixture, 0.1 μL ROX reference dye, 2 μL mixture of primer probe set and 5 μL standard or RNA.

[0076] Program: 42℃30min; 95℃1min; 95℃5s, 60℃31s, 40 cycles. Set the detection of fluorescein: FAM, JOE, reference fluorescence: ROX, reaction system: 20μL, fluorescence signal collection: 60℃31s.

[0077] 5) Generation of standard curve

[0078] The IL5RA standard was diluted in a 10-fold gradient, and 1.0×10 7~1.0×10 1 copeies / μL was used as a template, and each dilution was repeated 2 times for TaqMan real-time fluorescence quantitative RT-PCR detection to generate a standard curve.

[0079] The results are as follows Figure 2 As shown, with the copy number logarithm value as the horizontal axis (x) and the Ct value as the vertical axis (y), the regression equation is: y = -3.31865x + 36.09281 (|r| = 0.99965), indicating that the copy number logarithm value of the standard equation has a very high correlation with the Ct value.

[0080] 6) Precision testing

[0081] Select 1.0×10 6 copies / μL, 1.0×10 3 The standard sample with 10 copies / μL was used as a template, and 10 replicates were performed for each concentration. TaqMan real-time fluorescence quantitative RT-PCR detection was performed 10 times. The coefficient of variation of the logarithmic value of each concentration was calculated for statistical analysis to analyze the precision of the detection method.

[0082] The results are shown in Table 1 and Figure 3 As shown, the coefficient of variation of each concentration logarithm is 0.231% and 0.789%, respectively, which is less than 5%, indicating that the TaqMan real-time fluorescence quantitative RT-PCR detection method established in the present invention has excellent precision.

[0083] Table 1 Precision test results

[0084]

[0085] 7) Accuracy test

[0086] Select 1.0×10 5 The 1000 copies / μL standard was used as a template, and three replicates were used to perform TaqMan real-time fluorescence quantitative RT-PCR detection three times, and the absolute deviation of the logarithmic value of each concentration was calculated. The results are shown in Table 2 and Figure 4 As shown, the absolute deviations of the logarithmic values ​​of each concentration were -0.086, -0.085, and -0.057, respectively, which were within the range of ±0.5, indicating that the TaqMan real-time fluorescence quantitative RT-PCR detection method established in the present invention has excellent accuracy.

[0087] Table 2 Accuracy test data

[0088]

[0089] 8) Sensitivity test

[0090] Select 10.0 copies / μL standard as template, 25 replicates, and perform 25 TaqMan real-time fluorescence quantitative RT-PCR tests to check whether amplification occurs and analyze the sensitivity of the detection method.

[0091] The results are shown in Table 3 and Figure 5 As shown, a total of 25 detection results were obtained (i.e., the amplification curve showed an upward trend), and the detection rate at a concentration of 10.0 copies / μL reached 100%, indicating that the TaqMan real-time fluorescence quantitative RT-PCR detection method established by the present invention has a high sensitivity, and the minimum detected copy number is <10 copies / μL.

[0092] Table 3 Sensitivity detection Ct value results

[0093] 32.61 33.13 33.02 32.09 33.05 33.16 32.86 32.64 33.04 32.91 33.01 27.87 32.77 32.88 32.76 33.23 32.87 33.18 33.32 26.84 33.10 32.73 33.07 33.02 32.98

[0094] 9) Clinical sample testing

[0095] Whole blood samples from patients and healthy subjects were taken for whole blood RNA extraction and dilution according to the above steps, and TaqMan real-time fluorescence quantitative RT-PCR detection was performed according to the above steps.

[0096] Compared with a domestic brand of human interleukin 5 receptor (IL5R) detection kit (enzyme-linked immunosorbent assay), the results are shown in Table 4 and Figure 6 As shown, the TaqMan real-time fluorescence quantitative RT-PCR detection method established by the present invention has better sensitivity and specificity than a domestic brand of human interleukin 5 receptor (IL5R) detection kit, and can effectively monitor the treatment effect.

[0097] Table 4 Comparison of clinical sample testing experiments

[0098]

[0099] 10) Results of amplification using other non-optimal primers and probes

[0100] The primers and probes in the system used in the present invention in 6) were replaced with the following non-optimal primers and probes, and the other steps were the same as 6), and the detection precision after replacing the primers and probes was tested. The results are shown in Table 5 and Figure 7 When the primer and probe design is unreasonable, the Ct values ​​of 10 repetitions of low precision are quite different (the consistency of the amplification curve is poor during the exponential growth period); and the coefficient of variation of the logarithmic value of the concentration of low precision exceeds 5%, reaching 7.409%.

[0101] The non-optimal primer and probe sequences are as follows:

[0102] F:SEQ ID NO.7:GAGTGGTTTGTCATTGTG;

[0103] R:SEQ ID NO.8:CAGCTTTCTCATAGTTAGTG;

[0104] PROBE:SEQ ID NO.9:ACCATCTGCTTCATCTTGTTAATTCTC.

[0105] Table 5 Amplification with non-optimal primers and probes

[0106] Theoretical copy number Mean log copy number SD CV <![CDATA[1.0×10 3 ]]> 2.823 0.209 7.409％

[0107] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A primer probe set for detecting human interleukin 5α receptor IL5RA mRNA, characterized in that: The detection primer probe set includes IL5RA-F, IL5RA-R and probe I5-Probe; The nucleotide sequence of the IL5RA-F is shown in SEQ ID NO.1, the nucleotide sequence of the IL5RA-R is shown in SEQ ID NO.2, and the nucleotide sequence of the probe I5-Probe is shown in SEQ ID NO.

3.

2. The primer probe set according to claim 1, characterized in that: The primer-probe set also includes primers and probes for detecting the internal reference gene GAPDH, the primers for GAPDH include GAPDH-F and GAPDH-R, and the probe is G-Probe; The nucleotide sequence of the GAPDH-F is shown in SEQ ID NO.4, the nucleotide sequence of the GAPDH-R is shown in SEQ ID NO.5, and the nucleotide sequence of the G-Probe is shown in SEQ ID NO.

6.

3. The primer probe set according to claim 2, characterized in that: The 5' ends of the probes I5-Probe and G-Probe are labeled with different fluorescent labeling groups, and the 3' ends are labeled with a quenching group.

4. The primer probe set according to claim 3, characterized in that: The fluorescent labeling group includes FAM or JOE, and the quenching group includes BHQ1.

5. Use of the detection primer probe set according to any one of claims 1 to 4 in preparing a kit for detecting human interleukin 5α receptor IL5RA mRNA.

6. A kit for detecting the expression level of human interleukin 5α receptor IL5RA mRNA, characterized in that: The kit comprises the primer probe set according to any one of claims 1 to 4, a PCR reaction solution, an enzyme mixture, a human interleukin 5α receptor IL5RA standard, a ROX reference dye and nuclease-free water.

7. The kit according to claim 6, characterized in that The amplification system includes the following components with final concentrations: 2-3 μL of nuclease-free water, 8-12 μL of PCR reaction solution, 0.3-0.8 μL of enzyme mixture, 0.01-0.2 μL of ROX reference dye, 1-3 μL of a mixture of detection primer probe sets, and 3-8 μL of human interleukin 5α receptor IL5RA standard.

8. The kit according to claim 7, characterized in that The mixed solution of the detection primer probe set contains the following components at the following concentrations: IL5RA-F 0.5~1.5μM, IL5RA-R 0.5~1.5μM, I5-Probe 1~2μM, GAPDH-F 1~3μM, GAPDH-R 1~3μM, G-Probe 2~4μM.

9. The kit according to claim 8, characterized in that The PCR amplification program of the kit includes: 42°C for 30 min; 95°C for 1 min; 95°C for 5 s, 60°C for 31 s, and 40 cycles.

Images