SNP molecular markers associated with lactation traits in buffaloes and their applications

Through whole-genome association analysis, the SNP molecular marker at the Chr11_66691407 site was screened out, and primers were designed for PCR amplification and sequencing, which solved the problem of low efficiency of traditional buffalo breeding and achieved efficient breeding and high milk yield buffalo breeding.

CN119614715BActive Publication Date: 2025-10-03GUANGXI ZHUANG AUTONOMOUS REGION BUFFALO INST
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411832972.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-13
Publication Date
2025-10-03
Estimated Expiration
2044-12-13

AI Technical Summary

Technical Problem

Traditional methods make it difficult to efficiently breed buffaloes with high lactation traits, and breeding progress is slow, costly, and inefficient.

Method used

Through genome-wide association analysis (GWAS), SNP molecular markers associated with peak milk production in buffaloes were screened out. The SNP molecular marker at the Chr11_66691407 site was marked as G or T, and specific primers were designed for PCR amplification and sequencing to detect the buffalo genotype, and GG buffaloes were selected for breeding.

Benefits of technology

It significantly improves the selection efficiency of buffaloes' peak milk production, shortens the breeding cycle, reduces costs, improves breeding efficiency, and can quickly select buffalo breeds with high milk production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119614715B_ABST
    Figure CN119614715B_ABST
Patent Text Reader

Abstract

The present invention discloses a SNP molecular marker associated with the lactation trait of buffaloes and its application. The SNP molecular marker is located at the 51st base of Chr11_66691407, the SNP molecular marker is G or T, and the nucleotide sequence of Chr11_66691407 is shown in SEQ ID NO. 1. The present invention obtains a SNP molecular marker with the highest correlation with the peak milk yield of buffaloes through DNA extraction and sequencing, genome alignment, and whole-genome association analysis. By studying the significant correlation between the genotype of the SNP molecular marker and the peak milk yield of buffaloes, it is found that the peak milk yield of GG buffaloes is better than that of buffaloes of other genotypes. The SNP molecular marker is used to assist in the selection of buffalo strains or varieties with peak milk yield characteristics, thereby shortening the breeding period and improving breeding efficiency. The buffaloes bred with peak milk yield characteristics can significantly increase the milk production of buffaloes.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of molecular markers, in particular to SNP molecular markers related to buffalo lactation traits and applications thereof. Background Art

[0002] my country boasts abundant buffalo genetic resources. Unlike the milk produced by familiar dairy cows (most commonly Black and White), buffalo milk is a specialty milk of superior quality and rich flavor, characterized by low production and high nutritional value. Buffalo milk has become the world's second-largest source of milk, after conventional cow's milk.

[0003] Buffalo milk products are highly sought after by consumers worldwide, primarily due to their higher milk fat and protein content compared to conventional cow's milk, resulting in a nutritional value 1.85 times higher than that of conventional cow's milk. Therefore, lactation-related traits are crucial economic traits for buffaloes and are also crucial phenotypic traits for buffalo breeding. Research has shown that for every kilogram increase in peak milk yield (peak milk yield refers to the highest daily milk production in a lactating cow during the current parity, measured in kilograms), milk production per parity can increase by 200-300 kilograms. Genetics play a significant role in determining peak milk yield in buffaloes.

[0004] Buffalo lactation is a typical quantitative trait. Due to the low heritability and multiple influencing factors of quantitative traits, traditional methods for breeding buffaloes with high lactation performance have been difficult and slow. However, with technological advancements and scientific developments, genome-wide association studies (GWAS) have provided new avenues for quantitative trait research. GWAS sequencing can identify genetic variants associated with economic traits in plants and animals, known as single nucleotide polymorphisms (SNPs), across the entire genome.

[0005] Therefore, by combining the buffalo whole-genome sequencing data obtained through genome resequencing, the high-quality buffalo genome assembly (UOA_WB_1), and buffalo lactation traits (peak milk yield), we can discover a large number of previously undiscovered SNPs associated with buffalo milk production (peak milk yield). This will improve our understanding of the molecular genetic mechanisms of complex traits, and screen for SNPs that influence peak milk yield for genetic breeding of buffaloes, thereby selecting high-protein milk-producing buffaloes. This can increase peak milk yield, improve the quality of buffalo dairy products, and ultimately promote the development of the buffalo milk industry. Summary of the Invention

[0006] The purpose of the present invention is to provide a SNP molecular marker related to the lactation trait of buffalo and its application, aiming to overcome the low milk production of buffaloes used in service and the defects of traditional buffalo breeding methods such as high difficulty, long cycle and slow progress.

[0007] To achieve the above object, the present invention provides a SNP molecular marker associated with the lactation trait of buffaloes, wherein the SNP molecular marker is located at the 51st base of Chr11_66691407, the SNP molecular marker is G or T, and the nucleotide sequence of Chr11_66691407 is shown in SEQ ID NO.1, and the specific details of SEQ ID NO.1 are as follows:

[0008] TAGTTTGAGCATTCTTTGGCATTGCCTTTCTTTGGGACTGGAATGAAAAC(T / G)GACCTTTTCCAGTCCTGTGGCCTCTGCTGAGTTTTCCAAATTTGCTGGCA.

[0009] Preferably, in the above technical solution, the lactation trait of buffaloes with the SNP molecular marker G is better than the lactation trait of buffaloes with the SNP molecular marker T.

[0010] Preferably, in the above technical solution, the dominant genotype individual of the SNP molecular marker is a GG buffalo individual.

[0011] A primer for amplifying the SNP molecular marker as described above, characterized in that the primer comprises an upstream primer and a downstream primer, the upstream primer is shown as SEQ ID NO.2, and the downstream primer is shown as SEQ ID NO.3, wherein SEQ ID NO.2 is specifically as follows: CCAACACCACAGTTCAAAAGCA; SEQ ID NO.3 is specifically as follows: CCATGGCATGATGGGAGGAT.

[0012] A kit for detecting the SNP molecular marker according to any one of claims 1 to 3, characterized in that the kit comprises an upstream primer and a downstream primer, the upstream primer is shown as SEQ ID NO.2, and the downstream primer is shown as SEQ ID NO.3, wherein SEQ ID NO.2 is specifically as follows: CCAACACCACAGTTCAAAAGCA; SEQ ID NO.3 is specifically as follows: CCATGGCATGATGGGAGGAT.

[0013] An application of the above-mentioned SNP molecular marker in buffalo molecular marker-assisted breeding.

[0014] A method for detecting the genotype of a buffalo using molecular biological techniques, the method comprising designing amplification primers based on the nucleotide sequences flanking the SNP molecular marker site as described above, using the genomic DNA of the buffalo individual to be bred as a template for amplification to obtain an amplified product, performing first-generation sequencing on the amplified product, typing the individual genotype according to the sequencing results, and obtaining the dominant genotype of the buffalo by exploring the association between the buffalo's peak milk production and the genotype.

[0015] Preferably, in the above technical solution, the dominant genotype is GG buffalo.

[0016] A method for utilizing the above-mentioned SNP molecular marker to assist in the selection and breeding of buffaloes with a peak milk production trait, the method comprising extracting genomic DNA from buffaloes to be selected and / or bred, detecting whether the base at position 66691407 of chromosome 11 is T or G, and genotyping the buffaloes to be selected and / or bred as TT type, TG type, or GG type. Based on the fact that the peak milk production of GG type buffaloes is much higher than that of TG type and TT type buffaloes, GG type buffaloes with a high peak milk production are selected for the next step of selection and / or breeding, thereby obtaining a buffalo strain with a peak milk production trait.

[0017] An application of the above method in molecular marker-assisted breeding of buffaloes.

[0018] Compared with the prior art, the present invention has the following beneficial effects:

[0019] This invention provides, for the first time, a single-nucleotide polymorphism (SNP) molecular marker significantly associated with peak milk production in buffaloes. This SNP molecular marker can be applied to genotyping of genes associated with peak milk production in buffaloes, providing a new molecular marker resource for marker-assisted selection of peak milk production in buffaloes and a new breeding method for accelerating the selection of high-quality buffaloes with high milk production. This breeding method allows for early selection of individuals directly at the genomic level, independent of phenotypic information. This significantly improves selection efficiency, accelerates the breeding process, saves intermediate feeding costs, improves breeding efficiency, and reduces breeding costs. It has broad application prospects in buffalo selection and / or breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] The purpose, features and advantages of the present invention will be further described with reference to the accompanying drawings and in conjunction with the embodiments.

[0021] Figure 1 is a Manhattan plot of peak milk yield of the genome-wide association analysis of the peak milk yield trait of buffaloes of the present invention;

[0022] Figure 2 This is a QQ plot of the genome-wide association analysis of the buffalo peak milk yield lactation traits of the present invention;

[0023] Figure 3is an electrophoresis diagram of the PCR amplification product of SEQ ID NO.1 in the embodiment of the present invention;

[0024] Figure 4 This is the sequencing map of the bases before and after the 66691407th position of chromosome 11 in the present invention. DETAILED DESCRIPTION

[0025] The terms "first," "second," "third," and the like are used herein to describe various parts, components, regions, layers, and / or segments, but these parts, components, regions, layers, and / or segments should not be limited by these terms. These terms are only used to distinguish one part, component, region, layer, and / or segment from another part, component, region, layer, and / or segment. Thus, a first part, component, region, layer, and / or segment described below could also be described as a second part, component, region, layer, and / or segment without departing from the scope of the present invention.

[0026] The terms used herein are for the purpose of describing specific embodiments only and are not intended to limit the present invention. Unless the context clearly indicates otherwise, the singular as used herein is intended to include the plural. It should also be understood that the term "comprising" specifically refers to a certain characteristic, field, integer, step, action, element, and / or component, but does not exclude the presence or addition of other characteristics, fields, integers, steps, actions, elements, components, and / or groups.

[0027] Unless otherwise defined, all terms used herein (including technical and scientific terms) have the same meanings as commonly understood by those skilled in the art. Dictionary terms should be interpreted as having the same meanings as those in the relevant technical literature and disclosed herein, and should not be interpreted in an idealized or overly formal sense.

[0028] The technical solutions in the embodiments of the present invention are clearly and completely described. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. All other embodiments derived by persons of ordinary skill in the art based on the embodiments of the present invention without inventive effort shall fall within the scope of protection of the present invention. Example 1

[0029] A SNP molecular marker associated with a lactation trait of a buffalo, wherein the steps of screening and obtaining the SNP molecular marker are as follows:

[0030] The sample data consisted of pedigrees, production records, and lactation trait records for one local buffalo, 46 ​​hybrid buffaloes, 31 buffaloes, and 42 Murrah buffaloes (a total of 120 buffaloes) raised at the Guangxi Buffalo Research Institute in China from 2000 to 2021. Peak milk yield was used as a lactation trait, with peak milk yield defined as the highest daily milk production in a lactating cow during the current parity, expressed in kilograms.

[0031] (1) Sample collection and sequencing:

[0032] Buffalo genomic DNA was extracted from buffalo blood using the phenol / chloroform method, and the integrity and yield of the buffalo genomic DNA were evaluated and verified by agarose gel electrophoresis.

[0033] Buffalo genomic DNA was digested with restriction endonucleases, and then barcoded sequencing adapters were added. The samples were mixed to construct a small fragment library (300-400 bp) and sequenced using the Illumina HiSeqTM 2000 system (Illumina, San Diego, CA).

[0034] (2) Phenotypic data collation and analysis: The phenotypic data collected in step (1) were statistically analyzed using R software. The statistical content included minimum value, maximum value, mean value, and standard deviation. The results are shown in Table 1.

[0035] Table 1 Statistical analysis of buffalo phenotypic measurement data

[0036] Number of records mean Standard deviation Minimum Maximum Peak milk volume (kg) 88 11.40 4.86 2.70 24.40

[0037] (3) DNA extraction and sequencing: Blood samples were collected from the jugular vein of buffaloes using a vacuum blood collector. Genomic DNA was extracted using the phenol / chloroform method described in the Molecular Cloning Experiment Guide IV. DNA purity was tested using an ultraviolet spectrophotometer. DNA samples that passed the test were sent to Guangzhou Kidio Biotechnology Co., Ltd. for simplified genome resequencing. The sequencing platform used was Illumina HiSeqTM 2000. The sequencing data was filtered to obtain valid information. The filtering criteria were as follows:

[0038] 1) Filter out reads containing adapter sequences;

[0039] 2) When reads containing N ratio greater than 10% are removed;

[0040] 3) Remove low-quality reads (bases with a quality value Q≤10 account for more than 50% of the entire read);

[0041] The effective data obtained after filtering were further evaluated for sequencing quality to check the error rate distribution. The sequencing error rate and accuracy results are shown in Table 2;

[0042] Table 2 Statistics of error rate and accuracy of buffalo genomic DNA resequencing

[0043] Numerical Clean Data (bp) HQ Clean Data (bp) Q20(%) Q30(%) GC (%) MIN 676186676 664759766 97.56 92.61 42.11 MAX 2965862268 2892808249 98.58 95.09 43.65 MEAN 1288934542 1261925441 98.07 93.83 43.01

[0044] (4) Genomic data alignment: The genomic data obtained by sequencing were aligned and analyzed using the bioinformatics analysis software BWA, SAMtools, and GATK. The reference genome was the fourth edition of the buffalo reference genome (GCA_003121395.1) (https: / / www.ncbi.nlm.nih.gov / datasets / genome / GCF_003121395.1 / ). The filtered reads were aligned to the reference genome using the alignment software bwa (0.7.12) using the mem algorithm with the alignment parameters -k32-M. After alignment, the results were marked using Picard (1.129) software (MarkDuplicates, etc.), but no filtering was performed. The average alignment rate of the population samples was 99.54%. Detailed data alignment information is shown in Table 3 below.

[0045] Table 3 Statistics of buffalo genome data comparison results

[0046] Sample All Reads Single Mapped Reads Paired Mapped Reads Unmapped Reads Mapping Ratio(%) MIN 4733340 563573 3117618 18945 98.98 MAX 20758964 5963456 16107506 88660 99.61 MEAN 9023692 2755223 6227138 41331 99.54

[0047] (5) SNP quality control and filtering: Variant variation refers to DNA sequence polymorphism caused by the insertion or deletion of a single nucleotide or several nucleotides at the genomic level. We used the UnifiedGenotyper module of the GATK (3.4-46) software to perform variant detection on multiple samples of the processed alignment files. The detected variants were filtered using VariantFiltration with the filtering parameters of -Window 4, -filter "QD < 4.0 || FS >60.0 || MQ < 40.0", and -G_filter "GQ < 20". After the above steps, a preliminary set of 2,012,270 SNP molecular markers was obtained.

[0048] Because rare alleles (alleles with very low frequency in the population), high deletion rates, high heterozygosity rates, and other sites can cause abnormalities in population analysis and genome-wide association analysis (linear models have very poor processing capabilities for extreme cases), which may cause the software to give incorrect results, the original marker sites are filtered using a self-written Perl script according to the following conditions:

[0049] 1) Removal of non-biallelic sites;

[0050] 2) Sites with minor allele frequency (MAF) less than 0.05 were removed;

[0051] 3) Sites with a deletion rate greater than 0.5 were removed;

[0052] 4) Sites with heterozygous ratios greater than 0.8 were removed.

[0053] The final 691,729 SNP molecular markers on the autosomes were used for subsequent association analysis.

[0054] (6) Genome-wide association analysis (GWAS): Principal component analysis was performed using GCTA software, followed by association analysis using GEMMA software combined with phenotypic information and genomic SNP information. Within a certain trait, individuals with phenotypic values ​​outside the mean ± 3 times the standard deviation were excluded, and the first three values ​​of the principal component and sex were added as covariates to the mixed linear model. The model is as follows:

[0055] y = Xα+Qβ+Kµ+e

[0056] Where y is the phenotype vector, X is the genotype matrix, α is the genotype effect vector, Q is the fixed effect matrix (in this study, the PCA score matrix), β is the fixed effect vector, K is the random effect matrix, primarily the kinship matrix, µ is the random effect vector, and e is the residual vector. For each SNP marker, we test whether α is 0. The probability p of α being 0 is used to measure the degree of association between the marker genotype and the phenotype. The smaller the p value, the lower the probability of α being 0, and the more likely the marker is associated with the trait.

[0057] The sites that reached the significant association level were extracted using R software, and the significance threshold was set as the Bonferroni-adjusted genome-wide significance (0.05 / 745,490=6.71×10 −8 ) to detect meaningful correlations. The information of these SNP molecular markers according to the above method is shown in Figure 1-2 ,from Figure 1 is a Manhattan plot of peak milk yield for buffalo peak milk yield traits, from Figure 1 It can be seen that there is a point above the dotted line above chromosome 11, indicating that the base at position 66691407 of chromosome 11 is most highly correlated with the peak milk production trait of buffaloes. Therefore, the screened SNP molecular marker related to the peak milk production of buffaloes is located at position 66691407 of chromosome 11. The SNP molecular marker and the preceding and following sequences are named Chr11_66691407. The sequence information of Chr11_66691407 is shown in Table 4.

[0058] Table 4 Sequence information of chromosomes where SNP molecular markers are located

[0059] chromosome physical location Reference genotype Variant genotype Associated phenotypes Effect type Significance SNP molecular marker before and after the base fragment sequence Chr11_66691407 66691407 T G Peak milk volume Positive effects 5.94E-09 TAGTTTGAGCATTCTTTGGCATTGCCTTTCTTTGGGACTGGAATGAAAAC(T / G)GACCTTTTCCAGTCCTGTGGCCTCTGCTGAGTTTTCCAAATTTGCTGGCA

[0060] Since the 51st base of Chr11_66691407 is associated with the peak milk production of buffaloes, it is used for buffalo selection and / or breeding for the peak milk production trait of buffaloes. The buffalo selection and / or breeding probably utilizes the SNP molecular marker of the 51st base of Chr11_66691407, designs primers on the nucleotide sequences on both sides thereof, collects blood and extracts genomic DNA when the buffaloes are born, uses the primers to perform genotyping on the buffaloes to be tested, and retains individuals with the genotype of the target trait to speed up the buffalo breeding. Example 2

[0061] A method for detecting buffalo genotype using molecular biology techniques, the method comprising the following steps:

[0062] (1) Blood was collected from the jugular vein of the selected buffaloes and genomic DNA was extracted using a blood genomic DNA extraction kit. The DNA concentration was measured using a nucleic acid concentration meter and the quality of the DNA sample was determined by 1% agarose gel electrophoresis (e.g. Figure 3 Amplification primers were designed for the selected candidate SNP sites on Chr11_66691407 (as shown in Table 5).

[0063] Table 5 Amplification primers designed for candidate SNP sites

[0064] SNP Primer Sequence (5'->3') Length / bp Start Stop Tm / ℃ GC% Chr11_66691407 F5'-CCAACACCACAGTTCAAAAGCA-3' 1271 66690421 66690442 60.09 45.45 Chr11_66691407 R5'-CCATGGCATGATGGGAGGAT-3' 1271 66691691 66691672 59.59 55.00

[0065] Note: F in the table refers to the upstream primer Forward primer, and R refers to the downstream primer Reverse primer

[0066] PCR amplification was performed using the above primers and buffalo blood genomic DNA as a template. A 50 μL PCR reaction system was used: 19 μL ddH2O, 25 μL Premix Taq™, 2.0 μL DNA template, and 2.0 μL each of the primers (upstream and downstream primers, both at 10 μmol / L).

[0067] PCR reaction conditions:

[0068] Pre-denaturation at 95°C for 4 min; denaturation at 94°C for 10 s, annealing at 55°C for 30 s, extension at 72°C for 1 min, for a total of 35 cycles; extension at 72°C for 5 min.

[0069] The PCR amplification products were purified using the Gel Extraction Kit from Shanghai Sangon Biotechnology Co., Ltd. Specific steps are described in the kit instructions. The purified PCR products were recovered and sent directly to BGI (Shenzhen) Biotechnology Co., Ltd. for next-generation sequencing. Genotyping of the individuals was performed based on the sequencing results. Genotyping results are shown in Table 6.

[0070] Table 6 Genotype frequency and allele frequency of SNP molecular markers in buffalo

[0071] SNP sites Genotype frequency Genotype frequency Genotype frequency Allele frequency Allele frequency Chr11_66691407 TT (0.793) TG (0.120) GG (0.087) T(0.853) G(0.147)

[0072] As can be seen from Table 6, the T allele frequency of the SNP molecular marker at the 51st base of Chr11_66691407 mutation site is 0.853, while the G allele frequency is 0.147. By comparison, it is found that the T allele frequency is significantly greater than the G allele frequency.

[0073] Table 7 Verification of SNPs significantly associated with peak milk yield in buffaloes

[0074] SNP Genotype (number of individuals) Peak milk volume (kg) Chr11_66691407 TT (52) <![CDATA[10.05±3.96 B ]]> Chr11_66691407 TG (8) <![CDATA[13.81±4.78 B ]]> Chr11_66691407 GG (6) <![CDATA[20.94±1.93 A ]]>

[0075] Note: Peak milk yield phenotype values ​​are expressed as "least square mean ± standard deviation". Data in the same column with different letters indicate significant differences (P<0.05); data with the same letters or no letters indicate no significant differences (P>0.05). SNP locus genotypes are arranged in the order of reference type, heterozygous type, and mutant type.

[0076] As can be seen from Table 7, through verification, it was found that the peak milk yield of buffaloes with the genotype GG at the 51st base of candidate Chr11_66691407 was significantly different from that of buffaloes with the genotype TG and TT, and the peak milk yield of buffaloes with the GG type was significantly higher than that of buffaloes with the TG or TT types. Furthermore, it was shown that when the SNP molecular marker at the 51st base of Chr11_66691407 was G, the milk production of buffaloes could be increased. Therefore, the 51st base of Chr11_66691407 can be used as a molecular marker to identify the peak milk yield of buffaloes, and used to assist in the selection of buffalo strains or varieties with peak milk yield characteristics. Applying the selected buffaloes to production can greatly increase the overall milk production of buffaloes.

[0077] Example 3

[0078] A method for breeding buffaloes with peak milk production traits using SNP molecular markers, the method comprising:

[0079] Extraction of genomic DNA: Blood was collected from the jugular vein of buffaloes at 3-6 months of age, and genomic DNA was extracted using a blood genomic DNA extraction kit.

[0080] Amplification primers designed using the SNP molecular marker of the 51st base of Chr11_66691407 are used to perform PCR amplification and sequencing using the genomic DNA as a template. The deoxynucleotide at the 66691407 position of chromosome 11 is measured to be T or G, and its genotype is further determined to be TT type, TG type or GG type. Since the peak milk yield of GG buffaloes is much higher than that of TG type and TT type buffaloes, buffalo individuals with the GG genotype are selected for the next step of selection and / or breeding, so as to shorten the breeding years for buffalo lines that obtain the peak milk yield trait and accelerate the breeding speed.

[0081] from Figure 4 It can be seen that the deoxynucleotide at position 66691407 of chromosome 11 is T.

[0082] The present invention can be implemented in various ways and is not limited to the embodiments described above. A person skilled in the art will appreciate that the present invention can be implemented in other specific ways without changing the technical concept or essential features of the present invention. Therefore, it should be understood that the embodiments described above are illustrative and not intended to limit the present invention.

Claims

1. Use of a reagent for detecting the genotype of a SNP site in assisted breeding of buffaloes, wherein the SNP site is located at the 51st base of SEQ ID NO.1, the base is G or T, and the breeding trait is peak milk yield, wherein: The peak milk yield of GG buffaloes was higher than that of TG buffaloes and TT buffaloes.

2. A method for using a reagent for detecting SNP locus genotypes to assist in breeding buffaloes with peak milk production traits, characterized in that: The method comprises extracting genomic DNA from buffaloes to be selected and / or bred, detecting whether the base of a SNP site is G or T, wherein the SNP site is located at the 51st base of SEQ ID NO.1, genotyping the buffaloes to be selected and / or bred as TT type, TG type or GG type, and selecting GG type buffaloes for the next step of selection and / or breeding based on the fact that the peak milk yield of GG type buffaloes is higher than that of TG type buffaloes and TT type buffaloes, thereby obtaining a buffalo strain with high peak milk yield.

Citation Information

Patent Citations

  • Obtaining method and application of SNP related to milk buffalo milk production traits

    CN111996262A

  • Genome wide qtls for milk yield in buffaloes

    IN201611021507A