A method for identifying AB-type cultivated varieties of rubber trees based on chloroplast SNP markers of rubber tree leaves
By screening the SNP sites in the rubber chloroplast genome, especially the C/A variant site at position 147 from SEQ ID No. 1, the problem of difficult to identify high-yield resistant rubber tree varieties in the prior art is solved, and efficient variety identification and breeding process are achieved.
Patent Information
- Application Number
- CN202510157298.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-13
- Publication Date
- 2025-07-08
- Estimated Expiration
- 2045-02-13
AI Technical Summary
现有技术难以有效筛选和鉴定高产抗性橡胶树栽培品种,影响橡胶树育种进程。
By screening and analyzing the SNP sites in the genome of rubber tree chloroplasts, especially the C/A natural variant sites located at position 147 from SEQ ID No. 1 from 5', it is used to identify high-quality rubber tree species, and kits and gene chips are provided for detection.
The accurate identification of high-quality rubber tree species has been achieved, the molecular marker library has been expanded, the efficiency of breeding of excellent rubber tree varieties has been improved, and the breeding process has been enhanced.
Smart Images

Figure CN119614745B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of molecular markers, and particularly relates to a method for identifying AB-type cultivated varieties of rubber trees based on chloroplast SNP markers of rubber leaves. Background Art
[0002] Natural rubber mainly comes from Hevea brasiliensis, which is an important industrial raw material and military strategic material, and is widely used in fields such as transportation, medical and health, and national defense industry. Due to its excellent properties in elasticity, abrasion resistance, impact resistance, etc., it still cannot be replaced by synthetic rubber so far. Hevea brasiliensis is native to the Amazon Basin in Brazil. After multiple introductions, it is now widely cultivated in tropical regions of Asia. Historically, there were two relatively famous introductions of rubber trees. In 1876, the British Wickham collected rubber tree germplasm in Brazil, then brought the seeds and seedlings to the Kew Garden in the UK for breeding, and then planted them in Sri Lanka, and subsequently introduced them to Southeast Asian countries such as Malaysia, Indonesia, and Thailand for planting. The second time was in 1981 when the International Rubber Research and Development Board (IRRDB) organized the collection and introduction of rubber tree germplasm. In addition, it also includes other germplasms of the genus Hevea that are available in major rubber-producing countries. After years of introduction, cultivation, and screening of cross-breeding varieties, China has developed multiple cold-resistant, wind-resistant, and high-yielding varieties, including high-yielding varieties such as Reyan 879 and Reyan 73397, wind-resistant high-yielding varieties such as Reyan 917, and cold-resistant high-yielding varieties such as Yunyan 774. Among them, the Reyan 879 super high-yielding variety has a yield per mu increased by more than 50% compared to the control, and it is the variety with the highest yield per unit area in the world at present.
[0003] With the continuous progress of sequencing technology, the genomes of more and more rubber tree varieties, germplasms, and rubber tree species have been analyzed, laying a solid foundation for further carrying out genomic selection and molecular-assisted breeding to accelerate the rubber breeding process. Recently, the Rubber Research Institute of the Chinese Academy of Tropical Agricultural Sciences, where our team is located, jointly with the Sanya Nanfan Research Institute of Hainan University and Lanzhou University, conducted research on the genetic diversity and latex production evolution of rubber tree germplasms. We completed high-quality genome analysis and pan-genome component research on 3 cultivated varieties of Hevea brasiliensis (high-yield and high-susceptible), 2 wild germplasms of Hevea brasiliensis (medium-yield and high-susceptible), and another 3 different species of the genus Hevea (low-yield and high-resistant), elucidated the genetic structure and phylogenetic relationships of three types of rubber tree germplasm resources preserved in the world's major rubber-producing countries, and discovered the generation of the rubber elongation factor / small rubber particle protein (REF / SRPP) large gene cluster. By searching NCBI and the National Genomics Data Center of China, we found that there were hundreds of genome re-sequencing data of different varieties and wild germplasms. Among them, the data released in September 2023 with the project number PRJCA004986 had the largest data volume, including more than 100 cultivated varieties and more than 200 wild germplasm materials. Mining and analyzing these data is conducive to screening effective SNP marker loci and laying a foundation for further assisting in the high-yield and resistance breeding of rubber trees.
[0004] Chloroplasts are the sites where green plants carry out photosynthesis and have an independent genetic system. Their genetic structure is relatively stable and gene recombination occurs less frequently. Therefore, chloroplast genome sequences are widely used in plant phylogeny and species identification. Plant genome re-sequencing mostly uses leaves as materials. Mesophyll cells contain a large number of chloroplasts, and in addition, the chloroplast genome size is very small, only about 100 kb. Therefore, compared with the nuclear genome, only a small amount of leaf re-sequencing data can be used for chloroplast genome assembly and SNP analysis. Rubber tree cultivated varieties all originate from the screening of wild germplasms in the Brazilian Amazon Basin and generally have characteristics such as high yield and stress resistance. By comparing and analyzing the chloroplast genomes of cultivated varieties and wild germplasms to screen effective SNP marker loci, the process of high-yield and stress-resistant breeding of rubber trees will be accelerated. Summary of the Invention
[0005] The purpose of the present invention is to provide SNP loci that can be used for high-yield rubber tree varieties, enrich the molecular markers available for breeding excellent rubber tree varieties, and provide new ideas for the high-yield breeding of rubber trees.
[0006] The present invention provides an application of an SNP marker locus for identifying high-yielding rubber tree varieties in the breeding of high-yielding rubber tree varieties. The SNP locus is located at the 147th position from the 5'-end of the sequence shown in SEQ ID No.1, and there is a natural variation of C / A at this locus, specifically: 5'-ATACAAAGAAAGATATCTCTGTTTACAACAGAAAAACTCTCCTCTGATGAATTGTATAATCGTTGGAATTATAAGAATGAACAAAAAAAGAAAATCCTAAATAATGAATTTATAAATTTTTGAAAAAATTTAAAGAGTAATAAATTCAAATTAATAAAAAAATTAATGCATAAAATAAATAAAATAAGAGATAAGAAGAGATGCGACCACTTCCTACATATTTTATACCCTCTCCTACAAAGAAACTGGTAACACCGACCCCATTGGTGA-3'; its corresponding wild-type sequence is as shown in SEQ ID No.2, specifically: 5'-ATACAAAGAAAGATATCTCTGTTTACAACAGAAAAACTCTCCTCTGATGAATTGTATAATCGTTGGAATTATAAGAATGAACAAAAAAAGAAAATCCTAAATAATGAATTTATAAATTTTTGAAAAAATTTAAAGAGTAATAAATTAAAATTAATAAAAAAATTAATGCATAAAATAAATAAAATAAGAGATAAGAAGAGATGCGACCACTTCCTACATATTTTATACCCTCTCCTACAAAGAAACTGGTAACACCGACCCCATTGGTGA-3'.
[0007] Preferably, the SNP locus is related to the latex yield of rubber trees. When the base of the SNP locus is C, it indicates that the rubber tree is a high-yielding variety.
[0008] Preferably, the high yield means that the latex yield > 50 mL per cut.
[0009] The present invention also provides a method for identifying high-yielding rubber tree varieties, comprising the following steps:
[0010] Amplify the DNA of the sample to be tested, perform SNP locus polymorphism detection using the SNP locus described in the above technical solution, genotype the sample to be tested according to the detection result of the SNP locus. When the base of the SNP locus is C, it indicates that the sample is a high-yielding rubber tree variety.
[0011] The present invention also provides the use of an SNP marker locus for identifying high-yielding rubber tree varieties in the preparation of a product for identifying high-yielding rubber tree varieties, wherein the SNP locus is located at the 147th position from the 5'-end of the sequence shown in SEQ ID No.1, and there is a natural variation of C / A at this locus.
[0012] Preferably, the product includes a kit and / or a gene chip.
[0013] The present invention also provides a kit for identifying high-yielding rubber tree varieties, and the kit includes the SNP locus described in the above technical solution.
[0014] The present invention also provides the use of an SNP marker locus for identifying high-yielding rubber tree varieties in constructing a rubber tree gene library, wherein the SNP locus is located at the 147th position from the 5'-end of the sequence shown in SEQ ID No.1, and there is a natural variation of C / A at this locus.
[0015] Advantages of the present invention:
[0016] By searching NCBI and the National Genomics Data Center of China, the present invention found that there are hundreds of genome resequencing data of different varieties and wild germplasms. Among them, the data released in September 2023 with the project number PRJCA004986 has the largest amount, including more than 100 cultivated varieties and more than 200 wild germplasm materials. By mining and analyzing these data, it is beneficial to screen effective SNP marker loci, laying a foundation for further assisting in high-yield and disease-resistant breeding of rubber trees.
[0017] The SNP locus provided by the present invention is related to latex yield. When the base at this locus is C, it indicates that the rubber tree is a high-yielding variety; when the latex yield of the rubber tree > 50 mL / cut, it is a high-yielding variety; this locus can be used for breeding high-yielding rubber tree varieties, expanding the molecular marker library for breeding excellent rubber tree varieties. Brief Description of the Drawings
[0018] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required to be used in the embodiments.
[0019] Figure 1 It is the phylogenetic tree of 670 chloroplast genome sequences of 335 samples in Example 1;
[0020] Figure 2 It is the heat map of cluster analysis of 299 core SNP loci of 335 samples in Example 2;
[0021] Figure 3 It is the heat map of cluster analysis of 25 SNP loci in Example 2. Detailed Embodiments
[0022] To further illustrate the present invention, a method for identifying rubber tree AB-type cultivated varieties based on chloroplast SNP markers of rubber tree will be described in detail below in conjunction with the accompanying drawings and embodiments, but they should not be construed as limiting the scope of protection of the present invention.
[0023] The present invention downloaded the genome resequencing data of 335 rubber tree cultivated varieties and wild germplasms from the National Genomics Data Center, used the GetOrganelle software to assemble the chloroplasts of a total of 335 materials, including 127 cultivated varieties and 208 wild germplasms, and then used the snippy software to screen and analyze the core SNPs with the chloroplast genome of the main rubber tree cultivar Reyan 73397 as a reference. Finally, the Heatmap analysis tool of the TBtools software was used to perform clustering analysis on the core SNPs to screen out the SNP sites between the cultivated varieties and wild germplasms. The methods described in the following embodiments are all conventional methods unless otherwise specified.
[0024] Example 1
[0025] Chloroplast assembly of 335 materials
[0026] Downloaded the genome resequencing data of 335 rubber tree cultivars and wild germplasms from the National Genomics Data Center (https: / / ngdc.cncb.ac.cn / ) to the local server (project number: PRJCA004986). The chloroplast genomes of each sample were assembled using the GetOrganelle software. The specific command was: get_organelle_from_reads.py -1 CRR286406_f1.fastq.gz -2 CRR286406_r2.fastq.gz -F embplant_pt -o CRR286406 -R 15 -t 20 --reverse-lsc. The chloroplast genomes of 335 samples were obtained. The chloroplast genome of each sample included two configurations, namely embplant_pt.K85.complete.graph1.1.path_sequence.fasta and embplant_pt.K85.complete.graph1.2.path_sequence.fasta, which were named CRR286406_1 and CRR286406_2 respectively (other samples were named in the same way). The specific commands were: ll|grep CRR|awk '{print"cat "$NF" / *complete.graph1.1.path_sequence.fasta>Result / "$NF"_1"}'|sh and ll|grep CRR|awk '{print"cat "$NF" / *complete.graph1.2.path_sequence.fasta>Result / "$NF"_2"}'|sh. Then, 670 sequences of 335 samples were merged into a single fasta file named CRR286-cp.fasta using the cat command. Multiple sequence alignment was performed using the mafft software. The command was: mafft CRR286-cp.fasta>CRR286-cp.fasta.mafft. Then, a phylogenetic tree was constructed using the fasttree software. The command was: fasttree CRR286-cp.fasta.mafft>CRR286-cp.fasta.mafft.tree. The obtained phylogenetic tree file CRR286-cp.fasta.mafft.tree was transferred to a personal computer, and the phylogenetic tree was viewed and displayed using the Figtree software. As Figure 1 shown, a total of 335 chloroplast genome sequences in the branch where CRR286406_2 is located were selected for subsequent SNP analysis.
[0027] Example 2
[0028] SNP Analysis of Chloroplast Genomes of 335 Materials
[0029] Based on the phylogenetic tree of the chloroplast whole-genome sequences constructed in Example 1, 335 chloroplast genome sequences in the branch where CRR286406_2 is located were selected, and the core SNP analysis was performed using the software snippy. The specific command is: snippy --outdir CRR286364_1a --ref. / CRR286406_2 --ctgs CRR286364_1 --cpus 10. Taking the command with CRR286364_1 as an example, the chloroplast genome sequence CRR286406_2 of the cultivated variety Reyan 73397 was used as the reference genome, and the above command analysis was performed on 335 chloroplast genome sequences respectively; then the core SNP analysis was carried out, and the specific command is: snippy-core CRR286348_1a CRR286348_2a CRR286349_1a CRR286349_2a CRR286350_1a... (a total of 335 folder names). The analysis result obtained the core.tab file, which is the core SNP matrix file, including a total of 299 core SNP sites. Using the sed command, A, T, C, and G were replaced with numbers 1, 2, 3, and 4 respectively. The specific command is: more core.tab|sed -e's / A / 1 / g' -e's / T / 2 / g' -e's / C / 3 / g' -e's / G / 4 / g'>core.tab.xlsx. Transfer the core.tab.xlsx to a personal desktop computer, open it with Excel, select all and perform selective paste in a new sheet, check the transpose, and delete the first row to obtain the SNP site matrix. Using the Heatmap analysis tool of TBtools software, a heatmap was drawn for the transposed core.tab.xlsx file, and column clustering analysis was performed. As Figure 2 shown, where Cul is a cultivated variety material obtained by large-scale cultivation of high-yield and resistant materials selected and cultivated from wild germplasms; WAC, WRO, and WMG represent wild germplasm materials collected from three regions in Brazil. Through comparative analysis, it was found that 25 SNP sites could divide the high-yield varieties into two complementary types, as Figure 3As shown in the figure, two complementary types are named as A type (A class) and B type (B class) respectively. An SNP locus covering both A and B types is named as AB type (AB class) SNP locus. Among them, the A type includes 5 SNP loci, the B type includes 19 SNP loci, and the AB type includes 1 SNP locus. It is represented in the structural form of s-Thermospermae 73397 chloroplast genome physical position - cultivar genotype / wild germplasm genotype. The variation information is as follows: s116127-C / A, which is located at the 147th position from the 5' end of the sequence shown in SEQ ID No.1, and there is a natural variation of C / A at this locus.
[0030] Through the collection and download of resequencing data, chloroplast genome assembly and SNP screening and analysis, the present invention obtained chloroplast genome SNP loci that can effectively distinguish cultivars from wild germplasms. Through the cluster analysis of the screened SNPs in this study, high-yielding varieties can be divided into three types: A type, B type and AB type. Among them, A type and B type are two complementary types, while AB type contains both A type and B type at the same time. The latex yields of rubber trees of cultivars of A type, B type and AB type are higher than those of wild types.
[0031] Using s116127-C / A provided by the present invention for wild germplasm samples numbered WAC-1~WAC-33, WRO-1~WRO-53, WMG-1~WMG-29 and cultivar samples numbered Cul-1~Cul-127, when the base of the SNP locus is C, the sample is a cultivar of AB type, and when the base of the SNP locus is A, the sample is a variety of ab type. The latex yield of AB type rubber trees is higher than that of ab type; the results are shown in Tables 1~2, where Cul is a cultivar material, and WAC, WRO and WMG represent wild germplasm materials collected from three regions in Brazil.
[0032] Table 1 Identification results of WAC-1~WAC-33, WRO-1~WRO-53, WMG-1~WMG-29
[0033]
[0034] Table 2 Identification results of Cul-1~Cul-127
[0035]
[0036] Among the 115 wild germplasm materials in Table 1, a total of 11 samples were detected as AB type. As can be seen from Table 2, among the cultivar samples numbered Cul-1~Cul-127, 124 were AB type, and the results are consistent with Figure 3They match. It can be seen that by using s116127-C / A provided by the present invention, AB-type cultivated varieties with higher latex yields can be identified and distinguished from ab types; this locus covers 97.64% (124 / 127) of the tested cultivated varieties and can also be used to identify potential high-yield and disease-resistant planting materials from wild germplasms, which can greatly improve the breeding process.
[0037] Test Example 1
[0038] Some varieties were selected, and their latex yields were collected and expressed as the volume of latex that could be collected per cut, and then the screening results of the present invention were verified, as shown in Tables 3 to 4 below.
[0039] Table 3 Latex Yields of Samples of WAC-1 to WAC-33, WRO-1 to WRO-53, and WMG-1 to WMG-29
[0040]
[0041] Table 4 Latex Yields of Samples of Cul-1 to Cul-93
[0042]
[0043] Combining Tables 1 to 4, it can be seen that among 242 samples, 135 AB-type cultivated varieties were screened out using the SNP locus of the present invention, and among them, a total of 81 samples had latex yields > 50 mL / cut and belonged to high-yield varieties.
[0044] There are certain differences between the screening results and the yield results. This is because there are many factors affecting the yield, such as climate conditions, pests and diseases, planting management methods, and tapping techniques, etc., which can all cause deviations in the yield results. Among the germplasms screened using the SNP markers of the present invention, 60% are high-yield varieties, which can show that the SNP locus provided by the present invention is related to the latex yield of rubber trees, and the SNP locus provided by the present invention can be used to screen high-yield germplasms of rubber trees.
[0045] Although the above embodiments have described the present invention in detail, they are only a part of the embodiments of the present invention, not all embodiments. People can also obtain other embodiments based on this embodiment without creative efforts, and these embodiments all belong to the protection scope of the present invention.
Claims
1. Use of a reagent for detecting SNP sites in identifying high-yielding varieties of rubber trees, characterized in that, The SNP locus is located at the 147th position from the 5'-end of the sequence shown in SEQ ID No.1, and there is a natural C / A variation at this locus; the SNP locus is related to the latex yield of rubber trees; when the base of the SNP locus is C, it indicates that the rubber tree is a high-yielding variety, and the high yield means that the latex yield > 50 mL per tapping.
2. A method for identifying high-yield rubber tree varieties, characterized in that, It includes the following steps: Amplify the DNA of the sample to be tested, detect the SNP locus polymorphism using the SNP locus described in claim 1, genotype the sample to be tested according to the detection result of the SNP locus. When the base of the SNP locus is C, it indicates that the sample is a high-yielding variety of rubber tree, and the high yield means that the latex yield > 50 mL per tapping.
Citation Information
Patent Citations
SNP marker related to rubber yield of rubber tree trunk and application of SNP marker
CN105861498A
SNP (Single Nucleotide Polymorphism) site combination related to breeding traits of rubber trees and application of SNP site combination
CN118813855A