Cloning of Translocation Recombinant Fragments in Wheat Zhongke 1878 Resistant to Fusarium Head Blight, Development of Molecular Markers and Their Application in Breeding

By integrating the 7EL anti-girard disease section of Changzeng Yanhuo 7EL into the wheat 6D chromosome, a recombinant chromosome 6DS·6DL/7EL was formed, and molecular markers and multiple PCR technology was developed, the problem of existing resistant wheat varieties in the Huanghuai winter wheat area was solved, rapid identification and breeding utilization were achieved, and the breeding process was significantly accelerated.

CN119614748BActive Publication Date: 2025-06-17INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510169528.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-02-17
Publication Date
2025-06-17
Estimated Expiration
2045-02-17

AI Technical Summary

Technical Problem

The existing resistant wheat varieties of gibberellia show inadequacy under the ecological conditions of the Huanghuai Winter wheat area and cannot meet the production requirements of the region.

Method used

By integrating the anti-griscariasis segment of Changsui Yanma 7EL into the end of the long arm of the wheat 6D chromosome through translocation, a new recombinant chromosome 6DS·6DL/7EL was formed, and specific molecular markers WE1820 and WE963 were developed. A rapid classification method was established using multiplex PCR technology to identify and utilize the recombinant chromosome of Zhongke 1878.

Benefits of technology

The rapid identification and breeding utilization of wheat Zhongke 1878 against gibberellosis has been achieved, which has significantly accelerated the selection and breeding process of wheat resistant varieties and adapted to the ecological conditions of the Huanghuai winter wheat area.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The present invention relates to the cloning of translocation recombinant fragments in wheat Zhongke 1878 resistant to Fusarium head blight, the development of molecular markers, and their breeding applications. Specifically, the present invention relates to specific molecular markers of wheat Zhongke 1878 resistant to Fusarium head blight, and the nucleotide sequence of the molecular markers is as shown in SEQ ID NO:4. The present invention also relates to the use of the molecular markers in the breeding and / or identification of wheat resistant to Fusarium head blight. In addition, the present invention also relates to the recombination site RS-6DL / 7EL in wheat Zhongke 1878 resistant to Fusarium head blight, and the nucleotide sequence of the recombination site RS-6DL / 7EL is as shown in SEQ ID NO:1. The present invention also relates to the use of the recombination site RS-6DL / 7EL as described above in the breeding and / or identification of wheat resistant to Fusarium head blight. The present invention is of great significance for wheat breeding for resistance to Fusarium head blight.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical fields of plant chromosome engineering and molecular breeding, and relates to the cloning of translocation recombinant fragments in Zhongke 1878, a wheat variety resistant to Fusarium head blight, the development of molecular markers, and their breeding applications. The new wheat variety resistant to Fusarium head blight - Zhongke 1878 carries a Fusarium head blight resistance segment from Thinopyrum elongatum. Among them, the 7EL segment of Thinopyrum elongatum is integrated into the end of the long arm of wheat chromosome 6D through translocation, forming a new recombinant chromosome 6DS·6DL / 7EL. The present invention discloses the specific sequence RS-6DL / 7EL of the recombination site of the wheat-Thinopyrum elongatum recombinant fragment 6DL / 7EL in Zhongke 1878, and develops a molecular marker WE1820 for identifying the recombination site of the recombinant chromosome 6DS·6DL / 7EL in Zhongke 1878. In addition, using the specific primer combination (WEW165-F, WEE1655-R, and WEW798-R) designed in the present invention, a rapid genotyping method based on multiplex PCR technology is established, which can efficiently identify the recombinant chromosome 6DS·6DL / 7EL of the wheat-Thinopyrum elongatum translocation line Zhongke 1878. This technical system can accelerate the breeding process of wheat varieties resistant to Fusarium head blight. Background Art

[0002] Wheat (Triticum aestivum L.) is one of the important food crops, and the maintenance and increase of its yield are important guarantees for food security. Wheat Fusarium head blight is one of the three major diseases in wheat production. Cultivating disease-resistant varieties is the most economical and environmentally friendly measure to control Fusarium head blight. However, the biggest challenge in the breeding process is the lack of disease-resistant resources. At present, Sumai 3 and its derivatives carrying the major resistance gene Fhb1 have been widely used in wheat Fusarium head blight resistance breeding worldwide. It is reported that more than 120 wheat varieties resistant to Fusarium head blight in China are related to Sumai 3. In addition, Chinese breeders have also selected disease-resistant varieties such as Yangmai series, Ningmai series, and Emai series, which have made important contributions to the prevention and control of Fusarium head blight. However, most of these varieties show characteristics such as strong spring habit, relatively tall plants, large leaves, loose plant type, and low tillering and ear formation rate, which are significantly different from the ecological requirements of the Huanghuai winter wheat region and cannot meet the production requirements of this region. Therefore, the development of wheat varieties resistant to Fusarium head blight suitable for breeding in the Huanghuai winter wheat region remains the focus and difficulty of current breeding work.

[0003] As a wild relative of wheat, Thinopyrum elongatum contains rich excellent gene resources, which can provide important assistance for wheat genetic improvement. The team led by Han Fangpu at the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences has been long committed to wheat distant hybridization research. Laboratory studies have shown that the long arm of chromosome 7E (7EL) of diploid Thinopyrum elongatum carries the Fusarium head blight resistance gene Fhb-7EL. The team used the method of irradiating the pollen of Chinese Spring-Thinopyrum elongatum telosomic addition line (CS-7EL) with physical rays to create wheat-Thinopyrum elongatum translocation lines, and 836 wheat-Thinopyrum elongatum translocation lines were screened from the offspring using fluorescence in situ hybridization technology. After years of multi-site disease resistance identification, multiple new wheat lines resistant to Fusarium head blight were finally selected and named the "Zhongke series", which have been successfully applied to wheat breeding. Among them, the new wheat line Zhongke 1878 is particularly prominent. The 7EL disease-resistant segment of Thinopyrum elongatum it carries was recombinantly integrated into the end of the long arm of wheat chromosome 6D, forming a new recombinant chromosome 6DS·6DL / 7EL, providing new gene resources and technical paths for wheat Fusarium head blight resistance breeding (see reference: Guo et al. Systemic development of wheat-Thinopyrum elongatum translocation lines and their deployment in wheat breeding for Fusarium head blight resistance. The Plant Journal. 2023;114:1475-1489). Zhongke 1878 participated in the national wheat breeding joint research variety comparison test, regional test and production test, and was approved by the state in 2024 (National Approval No. 20243007). At present, there is no relevant report on the recombinant sequence of the wheat-Thinopyrum elongatum recombinant fragment 6DL / 7EL in Zhongke 1878 and the rapid utilization system of the Fusarium head blight resistance gene. Summary of the Invention

[0004] The genomic resequencing data of the Chinese Spring-Thinopyrum elongatum telosomic addition line CS-7EL was aligned to the assembled genome of the wheat-Thinopyrum elongatum translocation line Zhongke 1878, and the nucleic acid sequences on both sides of the recombination point between wheat chromosome 6DL and Thinopyrum elongatum chromosome 7EL in Zhongke 1878 were successfully obtained. Based on this information, primers for specific sequences (RS-6DL / 7EL) of 2 kb on both sides of the 6DL / 7EL recombination site were designed to verify the recombination sequence by PCR, and a molecular marker WE1820 (composed of the primer pair WEW165-F and WEE1655-R) that recognizes this recombination site was successfully obtained. In the translocation line Zhongke 1878, the amplified fragment size of this molecular marker is 1820 bp, while no bands can be amplified in other common wheat varieties, proving the specificity of this marker.

[0005] Furthermore, by using the sequence from wheat 6DL on the left side of the 6DL / 7EL recombination site to perform Blast analysis on the Chinese Spring reference genome (Wheat Chinese Spring IWGSC RefSeq v2.1 pseudomolecules), it was determined that the recombination site is located at 462,150,207 bp on wheat chromosome 6D. Then, 1000 bp of the sequence from the Chinese Spring reference genome downstream of the recombination site was extracted, and a reverse primer WEW798-R was designed. Using the molecular marker WE963 (composed of the primer pair WEW165-F and WEW798-R), a 963-bp band can be amplified in common wheat varieties, indicating that there is no recombinant chromosome 6DS·6DL / 7EL from Zhongke 1878 in common wheat varieties.

[0006] In order to accelerate the breeding utilization of the Fusarium head blight-resistant segment of Thinopyrum elongatum in Zhongke 1878, the present invention combined the primers WEW165-F, WEE1655-R, and WEW798-R for multiplex PCR to establish a rapid genotyping technique for the recombinant chromosome 6DS·6DL / 7EL of the wheat-Thinopyrum elongatum translocation line Zhongke 1878. This technique is used in wheat Fusarium head blight resistance breeding and significantly accelerates the breeding process.

[0007] Specifically, the present invention provides the following technical solutions:

[0008] On the one hand, the present invention provides a specific molecular marker for Fusarium head blight-resistant wheat Zhongke 1878, and the nucleotide sequence of the molecular marker is as shown in SEQ ID NO:4.

[0009] On the other hand, the present invention provides a primer pair for detecting the specific molecular marker of Fusarium head blight-resistant wheat Zhongke 1878, and the sequences of the primer pair are as shown in SEQ ID NO:2 and SEQ ID NO:3.

[0010] On the other hand, the present invention provides the use of the molecular marker as described above in the breeding and / or identification of Fusarium head blight-resistant wheat.

[0011] On the other hand, the present invention provides a kit for breeding and / or identifying Zhongke 1878 of Fusarium head blight-resistant wheat, and the kit includes the primer pair as described above.

[0012] On the other hand, the present invention provides a method for breeding and / or identifying Zhongke 1878 of Fusarium head blight-resistant wheat, and the method includes the step of detecting a plant to be tested with the primer pair as described above.

[0013] In some embodiments, the method for detecting a plant to be tested is PCR detection.

[0014] In some embodiments, if a 1820bp band is amplified in the plant to be tested, it is determined that the plant to be tested is Zhongke 1878 of Fusarium head blight-resistant wheat.

[0015] On the other hand, the present invention provides a recombination site RS-6DL / 7EL in Zhongke 1878 of Fusarium head blight-resistant wheat, and the nucleotide sequence of the recombination site RS-6DL / 7EL is as shown in SEQ ID NO:1.

[0016] On the other hand, the present invention provides the use of the recombination site RS-6DL / 7EL as described above in the breeding and / or identification of Fusarium head blight-resistant wheat.

[0017] On the other hand, the present invention provides the use of the recombination site RS-6DL / 7EL as described above in the breeding and / or identification of Zhongke 1878 of Fusarium head blight-resistant wheat.

[0018] On the other hand, the present invention provides a method for breeding and / or identifying Zhongke 1878 of Fusarium head blight-resistant wheat, and the method includes designing primers for the recombination site RS-6DL / 7EL as described above and detecting a plant to be tested with the primers.

[0019] On the other hand, the present invention provides primers for detecting specific molecular markers of Zhongke 1878 of Fusarium head blight-resistant wheat, and the primers are designed for the recombination site RS-6DL / 7EL as described above.

[0020] On the other hand, the present invention provides a kit for breeding and / or identifying Zhongke 1878 of Fusarium head blight-resistant wheat, and the kit includes the primers as described above.

[0021] In some embodiments, breeding and / or identifying Zhongke 1878 of Fusarium head blight-resistant wheat further includes breeding and / or identifying hybrid offspring of Zhongke 1878 of Fusarium head blight-resistant wheat.

[0022] In some embodiments, the PCR reaction program for detecting a plant to be tested is as follows: pre-denaturation at 94°C for 5 minutes; denaturation at 94°C for 30 seconds, annealing at 60°C for 30 seconds, extension at 72°C for 30 seconds, running for 35 cycles; and finally extension at 72°C for 5 minutes.

[0023] On the other hand, the present invention provides a genotyping method for wheat, the method comprising performing multiplex PCR using primers SEQ ID NO: 2, 3 and 5, and if a fragment of 1820 bp in size is amplified, then the wheat to be tested is the Fusarium head blight-resistant wheat Zhongke 1878.

[0024] Definition

[0025] Molecular marker: A molecular marker refers to a technique for identifying and marking a specific DNA sequence by molecular biological methods (such as PCR, RFLP, SSR, etc.). It can be used as a tool to track specific variant sites in genes or genomes, and is thus used in aspects such as genetic analysis of traits, variety identification of crops, and genetic improvement. In the present invention, molecular markers WE1820 and WE963 are respectively used to identify the recombination site between wheat and Thinopyrum elongatum in Zhongke 1878 and the specific sequences of chromosomes without recombination in other common wheat varieties.

[0026] Genotyping: Genotyping refers to the process of identifying and classifying the genotypes of individuals through molecular markers or other genetic marker techniques. Through genotyping, specific genes or sequence variations carried by different individuals in the genome can be identified, thereby understanding their genetic backgrounds and related traits. In the present invention, genotyping techniques are used to identify the recombinant chromosome 6DS·6DL / 7EL in the wheat-Thinopyrum elongatum translocation line of Zhongke 1878, and whether other common wheat varieties carry this recombinant fragment.

[0027] Translocation line: A translocation line refers to a type of plant individual containing gene or gene fragment translocations formed through chromosomal rearrangements, chromosomal fragment transfers, etc. In the present invention, the wheat-Thinopyrum elongatum translocation line refers to the line Zhongke 1878 created by physically irradiating with rays to translocate the 7EL chromosome fragment of Thinopyrum elongatum with the 6D chromosome of wheat, thereby creating a recombinant chromosome 6DS·6DL / 7EL containing the Fusarium head blight-resistant gene Fhb-7EL.

[0028] Multiplex PCR: Multiplex PCR is a technique that simultaneously amplifies multiple target DNA fragments by designing multiple specific primers. It can amplify multiple genes or gene fragments in the same PCR reaction, thereby improving experimental efficiency and reducing sample consumption. In the present invention, through the multiplex PCR technique, in combination with primers WEW165-F, WEE1655-R, and WEW798-R, rapid genotyping and detection of the recombinant chromosome 6DS·6DL / 7EL in Zhongke 1878 were achieved, significantly accelerating the process of Fusarium head blight resistance breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 Shows the results of karyotype analysis of Zhongke 1878 chromosomes using fluorescence in situ hybridization (FISH) technology. In the experiment, the DNA of Thinopyrum elongatum was used as a probe, and specific regions on the Zhongke 1878 chromosomes were successfully identified and labeled. Through FISH analysis, Figure 1 It clearly shows the presence of the Thinopyrum elongatum 7EL chromosome fragment on the Zhongke 1878 chromosomes. This result proves the stable existence of the 7EL fragment of Thinopyrum elongatum in Zhongke 1878 and its successful translocation with wheat chromosome 6D, forming a new recombinant chromosome 6DS·6DL / 7EL.

[0030] Figure 2 Shows the identification results of the recombination sites of 6DL and 7EL in the wheat-Thinopyrum elongatum translocation line Zhongke 1878.

[0031] Figure 3 Shows the amplification results of molecular markers WE1820 and WE963 in Zhongke 1878 and common wheat.

[0032] Figure 4 Shows the amplification results of three-primer multiplex PCR in the hybrid offspring of Zhongke 1878. DETAILED DESCRIPTION OF THE INVENTION

[0033] To make the objectives, technical solutions, and advantages of the present invention clearer and more understandable, the following further elaborates on the present invention in detail with reference to specific embodiments and the accompanying drawings.

[0034] The wheat varieties used in the present invention are all materials that can be obtained by those skilled in the art through conventional means, such as through commercial channels, or obtained from breeding units or germplasm banks.

[0035] The inventors aligned the genome re-sequencing data of the Chinese Spring-Thinopyrum ponticum telosomic addition line CS-7EL to the assembled genome of the wheat-Thinopyrum ponticum translocation line Zhongke 1878, obtained the nucleic acid sequences on both sides of the recombination point between wheat chromosome 6DL and Thinopyrum ponticum chromosome 7EL in Zhongke 1878, designed primer pairs to verify the recombinant sequences by PCR using the sequences RS-6DL / 7EL of 2 kb on each side of the 6DL / 7EL recombination point, and obtained a molecular marker WE1820 (WEW165-F and WEE1655-R) that recognizes the specific sequence of the recombination site. The amplified fragment size in the translocation line Zhongke 1878 was 1820 bp, and no band was amplified in other common wheat varieties. At the same time, Blast analysis was performed on the Chinese Spring reference genome (Wheat Chinese Spring IWGSC RefSeq v2.1 pseudomolecules) using the sequence from wheat 6DL on the left side of the 6DL / 7EL recombination site, and it was determined that the recombination point between wheat 6DL and Thinopyrum ponticum 7EL was located at 462150207 bp on wheat chromosome 6D. A reverse primer WEW798-R was designed by extracting 1000 bp of the sequence downstream of the recombination site from the Chinese Spring reference genome. The molecular marker WE963 (WEW165-F and WEW798-R) could amplify a 963-bp band in common wheat varieties, indicating that there was no recombinant chromosome 6DS·6DL / 7EL from Zhongke 1878 in common wheat varieties. To accelerate the breeding utilization of the Fusarium head blight-resistant segment of Thinopyrum ponticum in Zhongke 1878, the present invention combined the primers WEW165-F, WEE1655-R, and WEW798-R for multiplex PCR, and established a rapid genotyping technique for the recombinant chromosome 6DS·6DL / 7EL of the wheat-Thinopyrum ponticum translocation line Zhongke 1878. This technique can accelerate the breeding process in wheat Fusarium head blight resistance breeding.

[0036] Example 1 Obtaining the nucleic acid sequences on both sides of the recombination point between wheat chromosome 6DL and Thinopyrum ponticum chromosome 7EL in Zhongke 1878

[0037] The inventors aligned the genome re-sequencing data of the Chinese Spring-Thinopyrum ponticum telosomic addition line CS-7EL to the assembled genome of the wheat-Thinopyrum ponticum translocation line Zhongke 1878, and obtained the nucleic acid sequences on both sides of the recombination point between wheat chromosome 6DL and Thinopyrum ponticum chromosome 7EL in Zhongke 1878.

[0038] Among them, the sequences of the recombination site RS-6DL / 7EL (the sequences of 2 kb on each side of the 6DL / 7EL recombination point, a total of 4000 bp) between wheat 6DL (underlined) and Thinopyrum ponticum 7EL (not underlined) in the wheat-Thinopyrum ponticum translocation line Zhongke 1878 are as follows:

[0039] GTTTGGCACCAGTATTATTATTTCTGTAGTTTTCCTCTCGAGGAGTCATGCAGACACTCGTTTGGCAC CAGTACTACTATTCTTGCAGTTTCCGCTCGAGGAGTCATTCGGACCCTCGTTTGGCACCCAGCATTTATTATCTCT ATGTCTGAACGCGCTGGTTAACTTGTTTATATGCTTCATGTTTACATTTGTTATATCTTATGTCCGAACTGTCTTG CGAGTACTTTCATAGTACTCACCTGGCTTGTTGATTTGGCCGGATGTTGACGAAGACGATCTCTTGGATGAAGAGT TTGATAGCGTGTCCGACGCCTAGAGGAGTCCCAGTCAGTCCTGCGCGATCCCGGATATTGGTCACTTGTATTATAT ACGCTTCCGCCACCTGTAATAAGTCTCCTCGAGCCTCACTCCAACGCTCGAAGAGCTGTAGTCTTCAGGAGTCATA TCACTCACTTCGCAGTGATATTCCCACCACTGTTATTATCGTGAGTTAGTAATTATGCCACCCTATCCGCCATCTT GTTTTATCGGCATGCATGTAATAAATTGTTGGGCAATTTCCGCTCAACTTTGTATTATATTCAGTACTCCTGGTAT TTTTCTTCTGTGACCATGATAGTGTCTACCAGTGAGAAGGGATTCTTCCTTACTGGTCCGTAAAAGGGATTGGTCT CTCAATAATTATATTATTGAAAAACCGGTCGTGACACTTCGACTTGAAGTCCTATCTCTAAGAAAGATTGCCGAGA ACACCAATGAGAACCTCATCGCTAAACAGTTACACCTGGAAGCTATGACCGACATGCTAGGCCGATCTCACAGCCT TGCTCAGCAGCTTGCACAGCAGTTTCCCGCAAGGCTAACCTTTCTTGAACTGTCTTGGAAGTGGCCTCGGTTCAGT ATTATTTTGTTACGCTGCAATGGTGCCCAGTTTTTGTAATCTGCTTCTTCGTTGCGCGTTATGATCACTGGTGGCA AACTTCGATGCCCAGTGGATGTAATATACCATAAATCCTTTATTGTATAGTGTAGGTTTATTCTTAGTTACTATGC CGTAATTTCTTTATTGTATAGAGTAGGTTTGTTCTTAATTCTTACTAGTTACTGCCATCATTCGCTATCTAAAAAA AATCAGATGTAGTCGACCGGGCCGAAACATTCGCCTCTAACGGGCCTAGTGTTTAGCGGGCCACAATTGGGTCGGC CTGCATCTTTCTTGGGCCTGAATCATTGGGGCCGTCACACTTTGCGCGAGGCCCACAACTTACACTGGCCTATATT TTAGTTGGGCCTTTTGTGGACCCAGCGCTTAGTTTCGCCCAGGTAGCGTTGGGCCATTAACAGGCTGAATATTGTA CTGGCCTGTAACGGCCCAGATGAAACCATGGGCCTTTAGTAGGCCGAATGCATATTGGGCCTCAATTTTCACTAGT CGTCGACGGGCCTTCAGCAGGCTGAAATGTAGACGGGGCCTTTTTGGGCCCAGTTATATCACGGGCAGTTACCAGG CCGAAACATATCTTGGGCCTTAGTTGGCCCACTGATATCATGGGCCTTTAAGAGGCCGAAAGCTTAGTACAGACAT CAACGTGCCGAATTATGCGACAGGCCTTTAACAGGCCCAAAGTTACGTTGGGCTTAACTGTTGCCACCTTTATCAC GGGCCGTTATTGGGCCCGATGTCCTGTCGGACCATATATGGCCCATGGGCAGCACGGGCCATTCCCAGGCCGAAAG TCACACCGGGCTGAAATGGGCCCATGTCTACATCGGGCCTCTAACAGGCCGAAAGTCACTGGGCTATAACTGGGCC CAAATATTCAGCGAACAATTAACGGGCGAGATCTGGCTTCGGGAAGTAAATGGGCCCAAATATTCAGCAAACAATT AACGGGCCAGATCTGGCTTCGGGCCGTAAATGGGCCTCTATTAAGGAGGCCGTTATTGGGCTGGCCCACTAGTACC TGAGTAAGTACTACGGGCCTTTGACTGGGCCG

[0040] Example 2 Obtaining and Verification of Molecular Markers for Identifying Specific Sequences of Recombination Point RS-6DL / 7EL

[0041] The inventors designed primer pairs to perform PCR verification on the recombinant sequence using the sequences RS-6DL / 7EL of 2 kb on each side of the above 6DL / 7EL recombination point, and obtained a molecular marker WE1820 (WEW165-F and WEE1655-R) for identifying specific sequences of the recombination site. The amplified fragment size in translocation line Zhongke 1878 was 1820 bp, and no bands were amplified in other common wheat varieties.

[0042] The primers are as follows:

[0043] WEW165-F: 5'-TAACGGGCGAGATCTGGCTTCGGGAA-3' (SEQ ID NO:2);

[0044] WEE1655-R: 5'-CCTCTTCTCACTATAACCTGGGCTCATCT-3' (SEQ ID NO:3).

[0045] The amplified sequence of molecular marker WE1820 is as follows:

[0046]

[0047] PCR amplification of the genome of the plant material to be tested, and materials that can amplify a 1820-bp fragment all contain the recombinant chromosome 6DS·6DL / 7EL derived from Zhongke 1878.

[0048] The plant materials to be tested include Zhongke 1878, Jimai 22, Zhoumai 36, Yannong 19, Beijing 8, Jiangdongmen, Sumai 3, Longmai 33, Funo, St2422 / 464, Mentana, Orofen, Early Preminum, Triumph, Lovrin10, Bima 4, Xinong 6028, Xiaoyan 6, Aifeng 3, Lumai 1, Mazhamai, Ningchun 4, Fan 6, Nongda 183, Shimai 14, Zhengmai 7698, Luohan 7, Shiluan 02-1.

[0049] Table 1 PCR System 1

[0050]

[0051] PCR reaction program: pre-denaturation at 94°C for 5 minutes; denaturation at 94°C for 30 seconds, annealing at 60°C for 30 seconds, extension at 72°C for 30 seconds, running for 35 cycles; finally, extension at 72°C for 5 minutes. The PCR amplification products can be stored at 16°C.

[0052] Electrophoresis detection system for PCR products: 1.2% agarose gel electrophoresis, voltage: 120V, time: 25 minutes, buffer: 1×TAE.

[0053] Meanwhile, the inventor used the sequence derived from wheat 6DL on the left side of the 6DL / 7EL recombination site to perform Blast analysis on the Chinese Spring reference genome (Wheat Chinese Spring IWGSC RefSeq v2.1 pseudomolecules), determined that the recombination point between wheat 6DL and Thinopyrum elongatum 7EL is located at 462150207 bp on wheat chromosome 6D, and extracted a 1000-bp sequence downstream of the recombination site from the Chinese Spring reference genome to design a reverse primer WEW798-R. Using the molecular marker WE963 (WEW165-F and WEW798-R), a 963-bp band can be amplified in common wheat varieties, indicating that there is no recombinant chromosome 6DS·6DL / 7EL derived from Zhongke 1878 in common wheat varieties.

[0054] WEW165-F: 5'- TAACGGGCGAGATCTGGCTTCGGGAA-3' (SEQ ID NO:2);

[0055] WEW798-R: 5'-TAGAGCCTTTCGCAAGCAAAGACAG-3' (SEQ ID NO:5).

[0056] Table 2 PCR System 2

[0057]

[0058] PCR reaction procedure: pre-denaturation at 94°C for 5 minutes; denaturation at 94°C for 30 seconds, annealing at 60°C for 30 seconds, extension at 72°C for 30 seconds, run for 35 cycles; finally, extension at 72°C for 5 minutes. The PCR amplification product can be stored at 16°C.

[0059] PCR product electrophoresis detection system: 1.2% agarose gel electrophoresis, voltage: 120V, time: 25 minutes, buffer: 1×TAE.

[0060] The amplified sequence of molecular marker WE963 is as follows:

[0061] TAACGGGCGAGATCTGGCTTCGGGAAGTAAATGGGCCCAAATATTCAGCAAACAATTAACGGGCCAGATCTGGCTTCGGGCCGTAAATGGGCCTCTATTAAGGAGGCCGTTATTGGGCTGGCCCACTAGTACCTGAGTAAGTACTACGGGCCTTTGACTGGGCCGACCTTTTTATATATGGGCATCTGTTGGGCCGTGCCACGTGTCCACGTATCATAGGTGCTTTGGGTCCAATGAGTGGATGACATCTATCCCAACGGTGAGCCGACACGTGTTTCCTCCAGCCAATGATGATTTTACACGTGGAAAATCCCCATTGGTCGGGGCTGTTAACGGGTTATCGGATCCAAAACCGGACCCGATAGCTTAACGGCGTTCCGTTATGGTGGATGCCACGTGTCGGTCACCCTTGACGAAAGCACTTCTGTGACGCGCGATTTATCGTCATGGAAGTGGACACTTTCGTGATGATAATTTTGGTAATGTCATGGAACACTTCTACGACAGCACAGGTATGACTATCTTGATTCTGTCATAAATTTGTCATGGATGTACATGCATGACAGAAAACGTAACCTACTGTGACAAACACGTATCATCACAGAAGTGTAGTTTTTTTGTAGTGAAGGGACAAGAGACACAGCAGTTTATCCTGGTTCGGGCCACCTTGCGGTGTAATACCCTACTCCAGCTTTGTGGTGGATTGCCTTAGGGGGCTGAGGATGAACTAGTACAGTGGTTGAGCAGCCTCAGGAGGTGAGGTGTTCTTGAGCTCGATGAGCTGGTGGAATGGTCAAGGTGGAATCCATCCCCTCCCCATGGTAGTGGCTAAGTCCTATTATAGTGGCCTTGGTCCTCTCCCCAAATGTAGGCGGGGAGGGATCCCACAATGGCCAAATTTGAAGGGGGACAACTAGTACAAGCTATCCTGACAAAAGCTGTCTTTGCTTGCGAAAGGCTCTA (SEQ ID NO:6)

[0062] The results of the above experiments are as Figure 3 shown. It can be seen from the figure that only a 1820bp fragment was identified in Zhongke 1878, and only a 963bp fragment was identified in other wheats.

[0063] Example 3 Rapid genotyping of recombinant chromosome 6DS·6DL / 7EL of Zhongke 1878

[0064] In order to accelerate the breeding utilization of the Fusarium head blight resistant segment of Thinopyrum elongatum in Zhongke 1878, the present invention combines primers WEW165-F, WEE1655-R and WEW798-R for multiplex PCR, and establishes a rapid genotyping technique for recombinant chromosome 6DS·6DL / 7EL of wheat-Thinopyrum elongatum translocation line Zhongke 1878. This technique can accelerate the breeding process in wheat Fusarium head blight resistance breeding.

[0065] Table 3 Three-primer multiplex PCR system

[0066]

[0067] PCR reaction procedure: Pre-denaturation at 94°C for 5 minutes; denaturation at 94°C for 30 seconds, annealing at 60°C for 30 seconds, extension at 72°C for 30 seconds, running 35 cycles; finally extension at 72°C for 5 minutes. The PCR amplification products can be stored at 16°C.

[0068] PCR product electrophoresis detection system: 1.2% agarose gel electrophoresis, voltage: 120V, time: 25 minutes, buffer: 1ⅹTAE.

[0069] The experimental results are as Figure 4 shown.

[0070] The specific embodiments described above have further detailed the purpose, technical solution and beneficial effects of the present invention. It should be understood that the above are only specific embodiments of the present invention and are not used to limit the present invention. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A specific molecular marker for the resistance to scab in wheat Zhongke 1878, characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID NO:

4.

2. A primer pair for detecting specific molecular markers of wheat Zhongke 1878 resistant to scab, characterized in that: The sequences of the primer pair are shown in SEQ ID NO:2 and SEQ ID NO:

3.

3. Use of the molecular marker according to claim 1 in the breeding and / or identification of wheat resistant to ergot.

4. A method for breeding and / or identifying wheat Zhongke 1878 resistant to ergot disease, the method comprising the step of detecting the plant to be tested using the primer pair according to claim 2.

5. The recombinant fragment RS-6DL / 7EL in the wheat Zhongke 1878 resistant to scab is characterized by: The nucleotide sequence of the recombinant fragment RS-6DL / 7EL is shown in SEQ ID NO:

1.

6. Use of the recombinant fragment RS-6DL / 7EL according to claim 5 in the breeding and / or identification of wheat resistant to ergot.

7. Use of the recombinant fragment RS-6DL / 7EL according to claim 5 in the breeding and / or identification of the ergot-resistant wheat Zhongke 1878.

8. A method for breeding and / or identifying wheat Zhongke 1878 resistant to scab, characterized in that: The method comprises the steps of designing primers for the recombinant fragment RS-6DL / 7EL according to claim 5, and using the primers to detect the plant to be tested.

9. A kit for breeding and / or identifying wheat Zhongke 1878 resistant to scab, characterized in that: The kit comprises the primer pair according to claim 2.

Citation Information

Patent Citations

  • Breeding method for scab-resistant translocation line of wheat-thinopyrum elongatum and molecular marker

    CN107119141A