Application of sisalagenin in preparation of medicine for treating influenza and viral pneumonia thereof

Abstract

The invention discloses an application of sisalagenin in preparation of a medicine for treating influenza and viral pneumonia thereof, the influenza virus is influenza A, and the viral pneumonia is influenza A viral pneumonia. The tigogenin (Tigogenin) can be used for reducing the expression of influenza virus mRNA (messenger ribonucleic acid) and influenza virus NP (natriuretic peptide) protein in vitro. The lung tissue inflammation pathology caused by influenza virus can be inhibited in vivo, and the lung index is reduced. The tigogenin has an obvious inhibition effect on replication of influenza viruses, so that the tigogenin provided by the invention provides a new medicine for treating influenza and viral pneumonia thereof.

Description

Technical Field

[0001] The invention belongs to the field of pharmaceutical chemistry, in particular to an antiviral drug molecule targeting influenza A virus NP protein and a preparation method thereof. Background Art

[0002] Influenza A virus (IAV) infection can cause respiratory diseases. It has a wide range of hosts and is highly contagious. In the past 100 years, there have been several IAV pandemics around the world, causing at least tens of millions of deaths. Influenza causes seasonal outbreaks and unpredictable pandemics every year, with high morbidity and mortality, seriously threatening human public health security.

[0003] At present, the neuraminidase inhibitors of anti-influenza virus drugs in the world are mainly M2 enzyme inhibitors, including oseltamivir, zanamivir, peramivir, and laninamivir, all of which are sialic acid derivatives. The advantage is good activity, but the disadvantage is that there are many chiral centers in the structure and the synthesis is complicated. In addition, the four neuraminidase inhibitor drugs on the market have various mutants with drug resistance, such as the H274Y subtype of H1N1 or H5N1 and the W119V subtype of H3N2 influenza virus, which are the most common M mutants. They are resistant to zanamivir and oseltamivir, which seriously limits the synergistic application of the oral drug oseltamivir. Therefore, it is urgent to develop a new generation of new targets suitable for influenza viruses and their traditional Chinese medicine inhibitors.

[0004] Sisal sapogenin Tigogenin is an effective ingredient extracted from the Anemarrhena Rhizoma in the patented formula of Yinqiao Baidu Powder by the laboratory through preliminary network pharmacology. Its main component is Tigogenin, and its chemical name is 5α, 25D-spirostane-3b hydroxyl. It is a pharmaceutical intermediate and important raw material for the synthesis of steroid hormone drugs. Pharmacological studies have shown that sisal sapogenin has obvious anti-inflammatory, antibacterial, hemostatic, anti-aging and hypoglycemic biological activities. The patent application with publication number CN118852316A discloses a sisal sapogenin derivative, a preparation method and its application in hypoglycemic drugs or preparations; in addition, another public patent application states: a preparation method of Tigogenin-cellobioside and its heptaacetate, and patent search information of a pharmaceutical composition containing Tigogenin-cellobioside. However, there is no research reporting the mechanism of action and preventive and therapeutic effects of sisal sapogenin in anti-influenza virus.

[0005] The present invention is the first to discover that sisal sapogenin has the use of resisting influenza A virus. Experimental results show that sisal sapogenin affects the replication of the virus by inhibiting the expression content of influenza virus mRNA and NP protein, and has anti-influenza virus effect in vivo and in vitro, revealing that it has the prospect of being developed into a drug for treating influenza and viral pneumonia induced by influenza. Summary of the invention

[0006] The purpose of the present invention is to overcome the shortcomings of the prior art and provide a new use of sisal sapogenin. The sisal sapogenin has significant anti-influenza A virus activity and can be developed as a new generation of anti-influenza virus drugs with broad application prospects.

[0007] In order to achieve the above object, the present invention provides, on one hand, use in anti-influenza virus drugs, wherein the influenza virus is influenza A virus.

[0008] Another aspect of the present invention provides sisal sapogenin for use in the preparation of a compound for inhibiting the infection and replication of influenza virus pneumonia.

[0009] The present invention also provides sisal sapogenin which inhibits the expression of M gene of influenza virus H1N1 to achieve antiviral effect.

[0010] The invention also provides the inhibitory effect of sisal sapogenin on influenza virus NP protein.

[0011] The sisal sapogenin also inhibits the expression of influenza virus pneumonia in mice in vivo.

[0012] In summary, the present invention has the following advantages and effects compared with the prior art:

[0013] 1. Sisal saponins can inhibit the infection of influenza A virus H1N1 to cells and have a wide range of antiviral activity

[0014] 2. Sisal saponin has low cytotoxicity and has a significant advantage in the inhibition rate of H1N1 infected cells at an almost non-toxic microdose (12.5ng / ml concentration). It can be used as a safe, effective and cost-effective antiviral drug for development.

[0015] 3. Sisal saponin can act on the NP protein target of influenza virus and has a significant inhibitory effect on its expression.

[0016] 4. Sisal saponins can inhibit the inflammatory pathology of lung tissue caused by influenza virus and reduce the lung index.

[0017] To achieve the above object, the present invention provides the following solutions:

[0018] The present invention provides the use of sisal sapogenin in the preparation of anti-influenza virus drugs, and the structural molecular formula of the sisal sapogenin is:

[0019]

[0020] Sisal saponin molecular structure

[0021] The present invention discloses the following technical effects:

[0022] The invention discloses the use of sisal sapogenin in preparing a drug for treating influenza and viral pneumonia thereof, wherein the influenza virus is influenza A and the viral pneumonia is influenza A viral pneumonia. The sisal sapogenin has a significant inhibitory effect on influenza virus, reduces the expression of influenza virus NP protein, and can inhibit the inflammatory pathology of lung tissue in mice with viral pneumonia infected by influenza virus. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In the accompanying drawings, unless otherwise specified, the same reference numerals throughout the multiple drawings represent the same or similar parts or elements. These drawings are not necessarily drawn to scale. It should be understood that these drawings only depict some embodiments disclosed in the present application and should not be regarded as limiting the scope of the present application.

[0024] Figure 1 Toxicity detection of Tigogenin on A549 cells

[0025] Figure 2 Tigogenin Anti-Influenza Virus Activity Detection

[0026] Figure 3 PCR detection of the inhibitory effect of Tigogenin on H1N1 M gene

[0027] Figure 4 WB detection of the inhibitory effect of Tigogenin on H1N1 NP protein

[0028] Figure 5 Immunofluorescence detection of the inhibitory effect of Tigogenin on H1N1 NP protein

[0029] Figure 6 Effect of Tigogenin on the weight change of H1N1 influenza mice

[0030] Figure 7 Effect of Tigogenin on lung index of H1N1 influenza mice

[0031] Figure 8 Tigogenin on pathological sections of H1N1 influenza mice DETAILED DESCRIPTION

[0032] In order to better understand the content of the present invention, the application of sisal sapogenin in resisting influenza A virus is further explained below in combination with experiments and experimental results.

[0033] Materials cells and viruses used in the present invention:

[0034] Cell lines and virus strains: Human non-small cell lung cancer cells A549 [A-549] (CL-0016) were provided by Wuhan Punosai Life Science Co., Ltd., and influenza virus A / FM1 / 47 / (H1N1) was provided by the Science and Technology Innovation Center of Guangzhou University of Chinese Medicine. Reagents: F-12K medium (GIBCO), penicillin-streptomycin double antibody (GIBCO), fetal bovine serum (GIBCO), PBS solution (GIBCO), 0.25% EDTA trypsin (GIBCO), dimethyl sulfoxide (sigma), TPCK-treated trypsin (sigma), thiazolyl blue (sigma), etc. All virus-related experiments were performed in a biosafety level 2 laboratory.

[0035] Example 1

[0036] In this example, the cytotoxicity of sisalgenin was detected.

[0037] The MTT method was used to detect the cytotoxicity of sisal saponins. The specific method is as follows:

[0038] A549 cells were seeded in 96-well plates, 100 μl per well, and the cell concentration was 2×10 5 / ml, cultured in a 37℃, 5% CO2 incubator for 24h, the next experiment can be carried out when the cells grow to 80-90%. Use DMSO as a solvent to dissolve the active ingredients of sisal saponin, add F-12K cell culture medium to dilute the drug to a concentration of 1mg / ml, and use a 0.22um filter to filter and sterilize it as the mother solution, dilute it in 5 times, and a total of 8 gradient concentrations of the drug solution. After A549 cells grow to 80-90%, add the prepared drug solution, 100ul per well, 5 replicates for each concentration, and set up a 6-well blank control group and a 10-well normal control group. After continuing to culture in the incubator for 48h, use a multifunctional microplate reader to detect the absorbance at 490nm. The cell survival rate is used as an indicator of the toxicity of sisal saponin to A549 cells

[0039] Cell survival rate (%) = absorbance of drug group - absorbance of blank group / absorbance of normal group - absorbance of blank group * 100%

[0040] The results are as follows Figure 1 As shown in the figure, sisal sapogenin has almost no toxicity to A549 cells within the concentration range of 200 ng / ml. The drug concentration selected in the experimental study of the present invention is within 12.5 ng / ml, which is within the safe and non-toxic concentration range.

[0041] Example 2

[0042] This example tests the in vitro anti-influenza A virus activity of sisal saponins.

[0043] The specific method is as follows:

[0044] A549 cells were collected at a concentration of 2×10 5 100ul / ml were inoculated into 96-well plates, and cultured in a 37°C, 5% CO2 incubator for 24h. When the cells reached 80-90% growth, the next step of the experiment could be performed. 50 The cells were infected with the virus dilution of the FM1 strain of influenza A virus (containing 1ug / ml TPCK). After the virus was adsorbed for 2 hours, the virus solution was discarded, washed with PBS, and the gradient dilution of sisal saponin was added, 100ul per well, and cultured for 48 hours. The antiviral activity of sisal saponin was determined by the protective effect of sisal saponin on cells, including observing the inhibition of virus-induced cytopathic effect (CPE) of sisal saponin and detecting the survival rate of cells, and further calculating the half effective concentration IC 50 , Oseltamivir was used as a positive control.

[0045] The results are as follows Figure 2 As shown: Sisal saponin has a significant inhibitory effect on influenza virus H1N1 at a concentration of 6.25ng / ml, with an inhibition rate of more than 90%.

[0046] Example 3

[0047] This example evaluates the inhibition of influenza A virus replication by sisal sapogenin.

[0048] In order to evaluate the inhibitory effect of sisal sapogenin on influenza virus replication, the present invention uses three experiments, q-PCR, Western blotting and immunofluorescence, to detect the effects of sisal sapogenin on the replication of M gene and NP protein of influenza virus from the expression levels of genes and proteins, respectively. The specific methods are as follows:

[0049] A549 cells were seeded in 6-well plates with 2 ml per well and a cell concentration of 3 × 10 5 The cells were divided into 6 groups, namely normal group, virus group, oseltamivir group, low-dose Tigogenin group, medium-dose Tigogenin group and high-dose Tigogenin group, with 3 replicates in each group. The cells were cultured in a 37°C, 5% CO2 incubator for 24 h. When the cell growth was 80-90%, the plates were washed with PBS. 1 ml of virus dilution was added to the groups other than the normal group, with a concentration of 100 TCID 50 , the plate was thrown after 2 hours of virus adsorption, and Tigogenin was used at high, medium and low modeling concentrations: 0.0125μg / ml, 0.00625μg / ml, and 0.003125μg / ml. After 48 hours of incubation in 1ml in each well, RNA was extracted to detect the expression level of related genes.

[0050] Primers were designed as follows:

[0051] H1N1 M Gene:

[0052] Forward primer CTAAGGCTATGGAGCAAAT

[0053] Reverse primer CACTGGAGCTAGGATGAGT

[0054] IL-6 gene:

[0055] Forward primer GAACTCCTTCTCCACAAGCG

[0056] Reverse primer CCGTCGAGGATGTACCGAAT

[0057] The results are as follows Figure 3 As shown, compared with the positive drug oseltamivir, Tigogenin has obvious therapeutic effects on different genes at low, medium and high concentrations. Although there are fluctuations in the treatment trends of different low, medium and high concentrations, considering the experimental errors, overall, Tigogenin has obvious therapeutic effects on genes related to viral infection.

[0058] Western-blot was used to detect the expression level of related signaling pathway proteins in cells: cells were collected to extract total protein of cells / lung tissues and the protein concentration was determined. Samples were loaded, sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) was performed, and the membrane was transferred using a semi-dry electrotransfer device. After blocking, the relevant target protein [virus-related protein (NP)] was added; overnight at 4°C. The membrane was washed 3 times, and horseradish peroxidase-labeled secondary antibody diluted in the rinse solution was added and shaken. The PVDF membrane was incubated with shaking at room temperature. ECL color development, X-ray film exposure, and the results were observed after development, fixing, and scanning. Image-J software was used to analyze the absorbance of the target bands of the scanned image, and the absorbance ratio of each target band to B-action was the relative expression level of the target protein.

[0059] result Figure 4 As shown: When the protein expression of NP protein was detected in the Tigogenin-treated group, the protein expression was reduced to varying degrees, indicating that Tigogenin has the effect of treating influenza virus.

[0060] Immunofluorescence detection: The modeling method is as described above. After the cells are cultured in the incubator for 48 hours, fix and permeabilize: the coverslips with cells crawled on the culture plate are washed with 1×PBS 3 times, fixed with 4% paraformaldehyde for 15 minutes, and washed with 1×PBS 3 times, each time for 3 minutes. 0.5% Triton X-100 (prepared with 1×PBS) is used to permeabilize the cells for 15 minutes at room temperature, and the slides are washed with 1×PBS 3 times, each time for 3 minutes. Blocking: 1×PBS is blotted with absorbent paper, 5% normal serum (similar to or similar to the species of the secondary antibody) is added to the slides, and blocked at room temperature for 1 hour. Antibody incubation: The blocking solution is absorbed with absorbent paper, and no washing is done. A sufficient amount of diluted primary antibody is added to each slide and placed in a humidified box, and incubated overnight at 4°C. Add fluorescent secondary antibody: Wash the slides 3 times with PBST, 3 minutes each time, blot the excess liquid on the slides with absorbent paper, then add the diluted fluorescent secondary antibody, incubate in a wet box at 37°C for 1 hour, and wash the slides 3 times with PBST, 3 minutes each time. Fix and take pictures: Counterstain the nucleus: Add DAPI and incubate in the dark for 5 minutes, stain the nucleus of the specimen, and wash off the excess DAPI with PBST 5 minutes × 4 times. Blot the liquid on the slides with absorbent paper, seal the slides with sealing solution containing anti-fluorescence quencher, and observe and collect images under a fluorescence microscope.

[0061] The results are as follows Figure 5 As shown: Tigogenin has a good inhibitory effect on viral expression in the detection of Influenza gene expression compared with the virus group, and the results are statistically significant.

[0062] Example 4

[0063] This example studies the anti-influenza virus effect of sisal saponin Tigogenin in vivo.

[0064] 60 4-week-old SPF BALB / C female mice weighing 12-15 g were randomly divided into a normal group, a virus group, an oseltamivir group, an E7820 group, a low-dose Tigogenin group, and a high-dose Tigogenin group, with 10 mice in each group. Adaptive feeding was performed for one day, and 15 LD 50 The infected mice were anesthetized with FM1 virus dilution of high concentration and intranasally injected with Tigogenin at a low dose of 10 mg / Kg and a high dose of 20 mg / Kg, twice a day for 4 days. After the mice became ill, their body weight and lung wet weight were weighed, and the lung index was calculated and the lung tissue pathology section experiment was conducted.

[0065] The results are as follows Figure 8As shown: Compared with the normal group, the interstitial congestion, edema and inflammatory infiltration of the mice infected with influenza virus increased significantly, and the Tigogenin and oseltamivir control groups were alleviated to varying degrees. Asterisks indicate significant levels, *P<0.05, **P<0.01, ***P<0.001.

[0066] The above is only a specific implementation of the present application, but the protection scope of the present application is not limited thereto. Any technician familiar with the technical field can easily think of various changes or substitutions within the technical scope disclosed by the present invention, which should be included in the protection scope of the present application. Therefore, the protection scope of the present application should be based on the protection scope of the claims.

Claims

1. Application of sisal saponin (Tigogenin) in the preparation of drugs for treating influenza and viral pneumonia.

2. The use according to claim 1, characterized in that: The influenza is influenza A, and the viral pneumonia is pneumonia induced by influenza A virus.

3. Use of sisal sapogenin according to claim 1 in the preparation of a drug for inhibiting the replication of influenza A virus in host cells, wherein the drug can inhibit the expression of the M gene and NP protein of N1N1.

4. The use of sisal sapogenin according to claim 1 in preparing a drug for treating influenza and viral pneumonia, characterized in that: The drug can inhibit the inflammatory pathology of lung tissue caused by influenza virus and reduce the lung index.

Images