Rabbit hemorrhagic disease virus subunit vaccine as well as preparation method and application thereof

Abstract

The invention discloses a rabbit hemorrhagic disease subunit vaccine as well as a preparation method and application thereof. The rabbit hemorrhagic disease subunit vaccine comprises a recombinant chimeric rabbit hemorrhagic disease virus VP60 subunit antigen, and the amino acid sequence of the rabbit hemorrhagic disease virus recombinant chimeric VP60 antigen is shown as a sequence 1 or a sequence 2 in a sequence table. The vaccine contains VP60 protein, does not contain rabbit hemorrhagic disease virions, and is high in safety; immune experiments show that specific antibodies for the rabbit hemorrhagic disease type 1 and the rabbit hemorrhagic disease type 2 can be provided respectively. The antigens aiming at the rabbit hemorrhagic disease type 1 pathogen and the rabbit hemorrhagic disease type 2 pathogen can be prepared only by one worker, the vaccine production process is simplified, the production cost is reduced, and the method has good application value.

Description

Technical Field

[0001] The present invention belongs to the field of medical technology, and in particular, relates to a rabbit hemorrhagic disease subunit vaccine, and a preparation method and application thereof. Background Art

[0002] Rabbit hemorrhagic disease (RHD) is a highly contagious and pathogenic rabbit disease caused by the rabbit hemorrhagic disease virus (RHDV), which is characterized by necrosis of the liver, intestines and lymphoid tissues and massive terminal intravascular coagulation. Classical RHDV mainly causes infection and death in adult rabbits (mortality rate as high as 80-90%), while RHDV2 has a wider host range of infection, not only infecting adult rabbits, but also infecting young rabbits under 30 days of age and causing a high mortality rate. Existing studies have shown that the cross-protection rate between RHDV1 and RHDV2 is low.

[0003] RHDV is an icosahedral, non-enveloped, positive-strand RNA virus belonging to the Caliciviridae family.

[0004] The RHDV genome consists of 7437 nucleotides, encoding two slightly overlapping open reading frames, ORF1 and ORF2. ORF1 encodes a polyprotein that produces a variety of nonstructural proteins and the capsid protein VP60, while ORF2 encodes the minor structural protein VP10. VP60 is the only capsid protein in RHDV, and the viral capsid contains 180 copies of VP60 (90 dimers). VP60 consists of three domains, including the N-terminal arm (NTR), the shell (S), and the protruding (P) domain, of which the P domain contains the determinants of virus-host receptor interaction and antigenic diversity. The P domain can be further divided into P1 and P2 subdomains, the latter of which is located in the outermost surface-exposed region of the viral capsid and is mainly composed of β-folds and 7 loop regions connecting them (Loop1 to Loop7). The loop region contains antigenic sites that can stimulate the body to produce specific protective antibodies.

[0005] The harm of rabbit hemorrhagic disease is becoming more and more serious. The disease has caused very serious economic losses to the rabbit industry and seriously affected the healthy development of the rabbit industry. Since there is no effective treatment for the disease, vaccination is the main means of controlling RHDV. The vaccines currently used for the prevention and control of rabbit hemorrhagic disease on the market are tissue inactivated vaccines and genetically engineered subunit vaccines. However, the inactivated RHDV vaccine is produced using the liver of rabbits infected with RHDV. Biological risks, animal welfare concerns and high costs are the main bottlenecks in the production and use of tissue inactivated vaccines. The existing genetically engineered subunit vaccines have solved such problems of inactivated tissue vaccines. At the same time, in order to solve the problem of low cross-protection between rabbit hemorrhagic disease type 1 and type 2, bivalent subunit vaccines for rabbit hemorrhagic disease type 1 and rabbit hemorrhagic disease type 2 have been developed in recent years. The production process of this bivalent vaccine requires the production process of two antigen components, which consumes two times of labor and materials, water and electricity, etc., and increases the production cost of the vaccine. Therefore, the scheme of chimerizing the epitopes of two different rabbit hemorrhagic disease viruses to form a new antigen has become a new development direction of multivalent vaccines, which will simplify the existing vaccine preparation process and effectively reduce production costs.

[0006] The purpose of the present invention is to display the protective epitopes on the VP60 antigens of rabbit hemorrhagic disease type 1 and rabbit hemorrhagic disease type 2 on heterotypic VP60 antigens, thereby obtaining the antigens required for a new bivalent subunit vaccine of rabbit hemorrhagic disease type 1 and type 2. Summary of the invention

[0007] The technical problem solved by the present invention is: by constructing a rabbit hemorrhagic disease virus VP60 antigen chimeric with a heterotypic protective epitope, a recombinant VP60 antigen with protective effects on both rabbit hemorrhagic disease type 1 and type 2 can be obtained with only one man-hour of labor, thereby being applied to a rabbit hemorrhagic disease bivalent subunit vaccine or a combination vaccine formed by a rabbit hemorrhagic disease bivalent subunit vaccine and other rabbit pathogens.

[0008] In order to solve the above technical problems, the present invention provides a rabbit hemorrhagic disease subunit vaccine capable of preventing both RHDV1 and RHDV2 viruses, and a preparation method and application thereof.

[0009] Therefore, one of the objects of the present invention is to provide two recombinant chimeric rabbit hemorrhagic disease virus VP60 antigens, both of which are chimeric proteins containing RHDV1 / RHDV2 antigenic epitopes, respectively named RHDV1VP60-R2L5 and RHDV2VP60-R1L1.

[0010] The second object of the present invention is to provide two amino acid and nucleotide sequences encoding the above two recombinant chimeric rabbit hemorrhagic disease virus VP60 antigens.

[0011] The third object of the present invention is to provide two recombinant expression vectors comprising the above nucleotide sequences.

[0012] The fourth object of the present invention is to provide a method for preparing the two aforementioned rabbit hemorrhagic disease virus VP60 recombinant antigens.

[0013] A fifth object of the present invention is to provide two rabbit hemorrhagic disease virus subunit vaccines and their combined vaccines with other rabbit pathogens.

[0014] The sixth object of the present invention is to provide a method for preparing a rabbit hemorrhagic disease virus subunit vaccine.

[0015] In order to achieve the above-mentioned purpose, the technical solution adopted by the present invention is as described below.

[0016] The present invention first provides two recombinant chimeric rabbit hemorrhagic disease virus VP60 antigens, both of which are chimeric proteins containing RHDV1 / RHDV2 antigen epitopes at the same time, and are named RHDV1VP60-R2L5 and RHDV2VP60-R1L1 respectively. The present invention also provides a construction strategy for the two chimeric proteins. Specifically, in the amino acid sequence of RHDV1VP60-R2L5, positions 404 to 411 are the amino acid sequences of the VP60 fragment of RHDV2, and the rest are the VP60 fragments of RHDV1. In the amino acid sequence of RHDV2VP60-R1L1, positions 301 to 319 are the VP60 fragments of RHDV1, and the rest are the VP60 fragments of RHDV2.

[0017] Preferably, the amino acid sequence of the chimeric protein RHDV1VP60-R2L5 is shown in Sequence 1, and the nucleotide sequence is shown in Sequence 3.

[0018] Preferably, the amino acid sequence of the chimeric protein RHDV2VP60-R1L1 is shown in Sequence 2, and the nucleotide sequence is shown in Sequence 4.

[0019] The present invention further provides a recombinant expression vector comprising the above nucleotide sequence.

[0020] The recombinant vector comprises the aforementioned nucleic acid molecule and, in addition, also comprises an expression regulatory sequence operably linked to the nucleic acid molecule sequence.

[0021] In the present invention, "vector" refers to a nucleic acid carrier into which a polynucleotide encoding a certain protein can be inserted and the protein can be expressed. The vector can transform, transduce or transfect the host cell so that the genetic material elements it carries can be expressed in the host cell. For example, vectors include: plasmids, phages, cosmids, artificial chromosomes, phages and animal viruses. The types of animal viruses used as vectors include lentiviruses, adenoviruses, herpes viruses, poxviruses, baculoviruses, papillomaviruses, etc. A vector may contain a variety of control expression elements, including promoter sequences, reverse transcription start sequences, enhancer sequences, selection elements and reporter genes. In addition, the vector may also contain a replication start site. The vector may also include components that assist it in entering the cell, such as viral particles, liposomes or protein shells, but not only these substances.

[0022] Furthermore, in a specific embodiment of the present invention, the recombinant expression vector is a recombinant expression vector containing the coding gene described in sequence 3 or sequence 4; preferably, the coding gene is transferred into pFastBac1, pFastBac dual or pDEST8, and the recombinant expression vector expressing the coding gene is screened.

[0023] The present invention also provides a recombinant baculovirus expressing the chimeric rabbit hemorrhagic disease virus VP60 antigen, which is obtained by transforming the above-mentioned recombinant expression vector into the DH10Bac host bacteria to obtain the Re-Bacmid shuttle plasmid, and then transfecting the Re-Bacmid plasmid into the host cell to obtain the recombinant baculovirus expressing the chimeric rabbit hemorrhagic disease virus VP60 antigen.

[0024] The term "host cell" in the present invention refers to cells that can be used to introduce nucleic acid molecules or vectors, including many cell types, such as prokaryotic cells such as Escherichia coli or Bacillus subtilis, fungal cells such as yeast cells or Aspergillus, insect cells such as S2 Drosophila cells Sf9, or fibroblasts, CHO cells, COS cells, BHK cells, HEK293 cells, etc.

[0025] Further, in a specific embodiment of the present invention, the host cell is a Sf9 insect cell.

[0026] The present invention also protects a recombinant chimeric rabbit hemorrhagic disease virus VP60 antigen composition, which is composed of a protein with an amino acid sequence as shown in sequence 1 in the sequence list and a protein with an amino acid sequence as shown in sequence 2 in the sequence list.

[0027] The present invention also provides a method for producing RHDV1VP60-R2L5 and RHDV2VP60-R1L1 chimeric proteins respectively using the Sf9 insect suspension cells described above, the method comprising culturing the host cells described above under suitable conditions and recovering the recombinant proteins, the method comprising the following steps: infecting host cells with the recombinant baculovirus expressing the chimeric rabbit hemorrhagic disease virus VP60 antigen respectively, harvesting the infected cell culture supernatant and host cell lysate multiple times, separating and purifying, and obtaining the recombinant chimeric rabbit hemorrhagic disease virus VP60 protein.

[0028] The present invention provides a rabbit hemorrhagic disease subunit vaccine, wherein the rabbit viral hemorrhagic disease recombinant subunit vaccine comprises the above-mentioned rabbit hemorrhagic disease virus VP60 recombinant antigen RHDV1VP60-R2L5 or RHDV2VP60-R1L1 and a pharmaceutically acceptable adjuvant, such as aluminum hydroxide adjuvant, aluminum phosphate adjuvant, potassium aluminum sulfate adjuvant, amorphous aluminum hydroxyphosphate sulfate adjuvant, MF59 adjuvant, AS03 adjuvant, AS01 adjuvant, MONTANIDE ISA 206VG, ​​MONTANIDE ISA 201VG, MONTANIDE ISA 51VG adjuvant. Preferably, aluminum hydroxide gel adjuvant is used.

[0029] It can be understood that the rabbit hemorrhagic disease bivalent subunit vaccine can also be used to prepare a multi-unit vaccine with other vaccines, including at least two of the above-mentioned rabbit hemorrhagic disease subunit vaccine, rabbit Pasteurellosis multocida vaccine, and rabbit Clostridium perfringens vaccine, such as rabbit Pasteurellosis multocida-rabbit hemorrhagic disease subunit vaccine (two-in-one vaccine), rabbit Clostridium perfringens disease-rabbit Pasteurellosis multocida-rabbit hemorrhagic disease subunit vaccine (three-in-one vaccine), etc.

[0030] Furthermore, the preparation method of the recombinant subunit vaccine of rabbit viral hemorrhagic disease is as follows: the effective antigen content of the RHDV1VP60-R2L5 or RHDV2VP60-R1L1 chimeric antigen is detected by a hemagglutination test method, and the effective antigen content of the RHDV1VP60-R2L5 or RHDV2VP60-R1L1 chimeric antigen is diluted to a hemagglutination value of 2 with physiological saline. 13 The recombinant subunit vaccine for rabbit hemorrhagic disease is prepared by mixing with an adjuvant in a volume ratio of 7:1 to 9:1. The recombinant subunit vaccine for rabbit hemorrhagic disease provided by the present invention can produce effective antibodies against RHDV1 / RHDV2 respectively when used for immunization of rabbits, has the advantages of strong immunogenicity, good safety, simple preparation process and low cost, and can be used to prevent and control the spread and prevalence of rabbit hemorrhagic disease. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 Schematic diagram of the structure of two recombinant pFastBac transfer vectors containing the rabbit hemorrhagic disease virus VP60 chimeric protein encoding gene. Figure 1A is a schematic diagram of the pFastBac-RHDV1VP60-R2L5 plasmid structure; Figure 1 B is a schematic diagram of the pFastBac-RHDV2VP60-R1L1 plasmid structure.

[0032] Figure 2 These are the results of PCR amplification and gel electrophoresis imaging of two ReBacmid shuttle vectors containing the rabbit hemorrhagic disease virus VP60 chimeric protein encoding gene. Lane M is Takara DL5000 Marker, and the molecular weight standards are 50,000 bp, 3,000 bp, 2,000 bp, 1,500 bp, 1,000 bp, 750 bp, 500 bp, 250 bp, and 100 bp. Lane A is the ReBacmid-RHDV1VP60-R2L5 plasmid PCR amplification band; Lane B is the ReBacmid-RHDV2VP60-R1L1 plasmid PCR amplification band.

[0033] Figure 3 The results of SDS-PAGE electrophoresis and Coomassie blue staining (A) and Western-blot (B) of two rabbit hemorrhagic disease virus VP60 chimeric proteins. Lane 1 is the protein marker; Lane 2 is the VP60 chimeric protein expressed by RHDV1VP60-R2L5; Lane 3 is the VP60 chimeric protein expressed by RHDV2VP60-R1L1.

[0034] Figure 4 The results of indirect immunofluorescence assay (IFA) of two recombinant baculoviruses are shown in Figure 2. Figure 4 A is an IFA image of Sf9 insect cells infected with the recombinant baculovirus constructed with RHDV1VP60-R2L5; Figure 4 B is an IFA image of Sf9 insect cells infected with the recombinant baculovirus constructed with RHDV2VP60-R1L1; Figure 4 C is an IFA image of Sf9 insect cells infected with wild-type baculovirus; Figure 4 D is the IFA image of normal Sf9 insect cells without virus inoculation.

[0035] Figure 5 The negative-staining electron microscopy results of virus-like particles assembled in vitro by two rabbit hemorrhagic disease virus VP60 chimeric proteins are shown. Figure 5 A is an electron microscopy image of VLPs expressed by the RHDV1VP60-R2L5 construct; Figure 5 B is an electron microscopy image of VLPs expressed by the RHDV2VP60-R1L1 construct.

[0036] Figure 6These are the results of the red blood cell agglutination test of two rabbit hemorrhagic disease virus VP60 recombinant antigens, where A is the hemagglutination result of the VP60 recombinant antigen expressed by the RHDV1VP60-R2L5 construct; B is the hemagglutination result of the VP60 recombinant antigen expressed by the RHDV2VP60-R1L1 construct. DETAILED DESCRIPTION

[0037] The preferred embodiments of the present invention are further described below in conjunction with specific examples. It is necessary for those skilled in the art to understand that the present invention may be modified and altered within the spirit and scope defined by the claims, but all fall within the protection scope of the present invention.

[0038] Unless otherwise specified, the experimental materials and reagents used in the following examples can be obtained from commercial sources.

[0039] The DH10Bac competent cells used in the following examples were purchased from Beijing Qingke Biotechnology Co., Ltd.; the insect cell culture medium was purchased from Suzhou Womei Biotechnology Co., Ltd.; and the FuGENER6 transfection reagent was purchased from Promega;

[0040] PrimeSTAR HS (Premix) was purchased from Takakra; protein electrophoresis gel was purchased from GenScript Biotech Co., Ltd.; PVDF membrane and chemiluminescent HRP substrate colorimetric reagent were purchased from Millipore; HRP-anti-rabbit IgG was purchased from EarthOx; FITC-goat anti-mouse IgG was purchased from Sigma; rabbit hemorrhagic disease virus VP60 protein-specific monoclonal antibody was prepared by our company (China Animal Husbandry Industry Co., Ltd.).

[0041] Example 1: Construction and synthesis of chimeric protein expressing rabbit hemorrhagic disease virus VP60

[0042] 1. Construction and synthesis of recombinant pFastBac plasmid

[0043] The sequences and key antigenic epitopes of the clinical RHDV1 and RHDV2 epidemic strains were analyzed, and the 404th to 413th amino acids in the Loop5 region of the RHDV1VP60 antigen were replaced with the corresponding RHDV2 sequences to obtain the RHDV1VP60-R2L5 chimeric antigen sequence (sequence 1). The amino acids at positions 301 to 319 in the Loop1 region of the RHDV2VP60 antigen were replaced with the corresponding sequences of RHDV1 to obtain the RHDV2VP60-R1L1 chimeric antigen sequence (sequence 2), which was optimized in combination with the insect cell codon tropism. The optimized sequences (sequences 3 and 4) were sent to Nanjing GenScript Biotech Co., Ltd. for gene synthesis, cloned into the pFastBac vector modified in this laboratory, and sequenced and identified using universal primers M13F and M13R. The correctly identified recombinant plasmid expressing the RHDV1VP60-R2L5 chimeric antigen was named pFastBac-RHDV1VP60-R2L5, and the correctly identified recombinant plasmid expressing the RHDV2VP60-R1L1 chimeric antigen was named pFastBac-RHDV2VP60-R1L1. The schematic diagram of the recombinant pFastBac plasmid structure is shown in the figure. Figure 1 As shown in A and 1B.

[0044] 2. Blue-white spot screening and identification

[0045] Take 1μg of pFastBac-RHDV1VP60-R2L5 or pFastBac-RHDV2VP60-R1L1 plasmid and add it to 100μL of DH10Bac competent cells, mix well, ice bath for 30min, heat shock in 42℃ water bath for 90s, ice bath for 2min, add 900μL of LB liquid medium without antibiotics, and culture at 37℃ for 1h. Take 100μL and spread it on blue-white triple antibody screening solid medium (LB plate, containing: 50μg / ml kanamycin, 7μg / ml gentamicin, 10μg / ml tetracycline, 100μg / ml Bluo-gal, and 40μg / ml IPTG), and culture it upside down at 37℃ for 48h. White colonies were picked to screen positive clones, each single clone was added to 10 μL of deionized water and pipetted evenly, 1 μL of template was taken for PCR identification using M13-F / R universal primers, and the remaining 9 μL was added to 100 μL of LB liquid culture medium containing three antibiotics (50 μg / ml kanamycin, 7 μg / ml gentamicin, and 10 μg / ml tetracycline), cultured at 37°C, 225 rpm, and after identification, transferred to 5 mL of triple antibody culture medium for expansion and shaking.

[0046] 3. Shuttle vector extraction and identification

[0047] Plasmids were extracted using plasmid extraction kits to obtain shuttle vectors ReBacmid-RHDV1VP60-R2L5 and ReBacmid-RHDV2VP60-R1L1 plasmids. The VP60 gene was amplified using specific primers VP60-F / R for verification, and the target size band was cut out for sequencing identification.

[0048] VP60F: TCGGGCCGCAAAGGTGTTTTAAAACATATC

[0049] VP60R: AGCGGATAACAATTTCACACAGG

[0050] The reaction system and conditions are as follows:

[0051] Table 1 VP60 fragment amplification system

[0052] Element Dosage Template 2.0μl Primer VP60-F 1.5μl Primer VP60-R 1.5μl 2×Premix 25μl ddH2O 20μl total 50μl

[0053] The PCR amplification procedure is as follows:

[0054] First, pre-denaturation at 95℃ for 3min; then denaturation at 95℃ for 30s, annealing at 55℃ for 30s, extension at 72℃ for 3min30s, for 35 cycles; finally extension at 72℃ for 10min; 4℃ forever. The gel electrophoresis imaging results of ReBacmid-RHDV1VP60-R2L5 and ReBacmid-RHDV2VP60-R1L1 plasmid PCR fragments are shown in the figure. Figure 2 As shown in lanes A and B, a band of the target size of about 4000 bp was observed, and sequencing verified the sequence to be correct, proving that the shuttle vector was successfully constructed.

[0055] Example 2: Rescue of recombinant baculovirus expressing rabbit hemorrhagic disease virus VP60 chimeric protein

[0056] The density of Sf9 cells in each well was controlled at 2.0×10 6 / ml, the culture medium is 2mL / well, let it stand until most of the cells adhere to the wall, change the medium, add 1ml of culture medium to each well, and prepare for transfection. Take 5.0μg of the recombinant plasmid ReBacmid-RHDV1VP60-R2L5 and ReBacmid-RHDV2VP60-R1L1 respectively and add them to 100μl of insect cell culture medium and mix gently. Add 8μl of transfection reagent to 100μl of insect cell culture medium, mix gently, and let it stand for 5min. Mix 100μl of the mixture of recombinant plasmid and insect cell culture medium and 100μl of the transfection reagent mixture evenly and let it stand for 30min. Add 200μl of the mixture evenly to the 6-well plate, and shake the 6-well plate gently to ensure that the mixture is evenly distributed around the cells. After transfection, the cells were placed in a 27°C incubator and cultured for 72 hours. Sf9 cells showed obvious pathological changes such as swelling, rounding, vacuolization, and decreased adhesion ability, indicating that the recombinant baculovirus had been successfully rescued and expressed. The cell supernatant was collected, which was the P1 generation recombinant baculovirus transfected with pFastBac-RHDV1VP60-R2L5 or pFastBac-RHDV2VP60-R1L1. After the P1 generation virus was amplified by passage on Sf9 insect cells, the rabbit hemorrhagic disease virus VP60 recombinant antigen RHDV1VP60-R2L5 or RHDV2VP60-R1L1P3 generation recombinant baculovirus was harvested. The seed virus titer was detected by indirect immunofluorescence test. The results showed that the two rescued recombinant baculoviruses could specifically bind to the rabbit hemorrhagic disease virus VP60 protein-specific monoclonal antibody, and the seed virus titer of the rabbit hemorrhagic disease virus VP60 recombinant antigen RHDV1VP60-R2L5P3 generation was 3.2×10 6.0 TCID50 / ml, the virus titer of the recombinant rabbit hemorrhagic disease virus VP60 antigen RHDV2VP60-R1L1P3 generation seed virus was 5.6×10 6.0 TCID50 / ml.

[0057] Example 3: Expression and identification of rabbit hemorrhagic disease virus VP60 chimeric protein

[0058] The density of Sf9 cells to be cultured in suspension is 2.0×10 6.0 / mL (cell viability is not less than 95%), take the rabbit hemorrhagic disease virus VP60 recombinant antigen RHDV1VP60-R2L5 or RHDV2VP60-R1L1P3 recombinant baculovirus to infect Sf9 cells in the logarithmic growth phase, culture at 27°C with a rotation speed of 120r / min for 96h-120h, collect the cell supernatant when the cells inoculated with the virus develop obvious lesions, store at 2-8°C in the dark, verify the expression of rabbit hemorrhagic disease virus VP60 chimeric protein by SDS-PAGE, Western-blot, and indirect immunofluorescence experiments, and observe the assembly of the expressed VP60 chimeric protein by hemagglutination test and transmission electron microscopy. The specific operation steps are as follows.

[0059] 1. SDS-PAGE and Western-blot identification:

[0060] Take the insect cell expressed antigens and perform SDS-PAGE gel electrophoresis, transfer the protein bands on the SDS-PAGE gel to the PVDF membrane, block it in 5% skim milk for 1 hour, wash it 3 times with PBST, add VP60 protein specific monoclonal antibody, place it at 4℃ and shake it slowly overnight, discard the primary antibody the next day, wash it 3 times with PBST, add the goat anti-mouse secondary antibody labeled with horseradish peroxidase, shake it slowly at room temperature for 1 hour, discard the secondary antibody, wash it 3 times with PBST, and perform chemiluminescence detection. The SDS-PAGE and WB verification results are as follows Figure 3 As shown, a band of about 72KD consistent with the size of the target protein can be seen, and WB verification shows that it can be recognized by the rabbit hemorrhagic disease virus VP60 protein-specific monoclonal antibody, as shown by the arrow, indicating that the target protein is correctly expressed in Sf9 cells.

[0061] 2. Indirect immunofluorescence experiment:

[0062] The density of Sf9 cells in suspension culture was adjusted to about 5 × 10 5 / ml, inoculated in a 96-well plate, 100μl / well. Then the sample to be tested was added to the 96-well plate at an amount of 100μl / well, and 8 wells were inoculated for each dilution. At the same time, a normal cell control was set up, and the 96-well plate was cultured in a 27℃ constant temperature incubator for 72h. The culture medium was discarded, and PBS was gently washed twice. 4% paraformaldehyde was added to fix for 30min, the fixative was discarded, and PBS was gently washed twice. VP60 monoclonal antibody was added, incubated at 37℃ for 60min, the monoclonal antibody was discarded, and it was gently washed twice with PBS. Working concentration of fluorescent secondary antibody was added, incubated at 37℃ in the dark for 60min, the secondary antibody was discarded, and it was gently washed twice with PBS, and fluorescence observation was performed under a fluorescence microscope. The IFA results showed that the fluorescence detection results of Sf9 insect cells inoculated with two recombinant baculoviruses were positive, while Sf9 insect cells infected with wild-type baculovirus and normal Sf9 insect cells without virus inoculation showed no fluorescence, indicating that both chimeric VP60 proteins were successfully expressed. The results are as follows Figure 4 shown.

[0063] 3. Sucrose density gradient centrifugation and transmission electron microscopy observation:

[0064] Take the insect cell expression supernatant, centrifuge at 8000rpm for 15min, take the supernatant and centrifuge at 100000g for 3h to concentrate the virus-like particles (VLP). Take 1mL of the concentrated product and add it to a 15% to 70% continuous density gradient sucrose solution. Centrifuge at 100000g for 12h at 4℃ to separate the VLP, identify the location of the VLP by WB, and observe the particle size and morphology using transmission electron microscopy. The results show that both VP60 chimeric proteins can be assembled into VLPs, and the particle size is about 35 to 40nm, which has a similar morphology and size to RHDV virus particles. The electron microscopy images of the particles assembled by the two VP60 chimeric proteins are shown in Figure 2. Figure 5 A, as shown in 5B.

[0065] 4. Hemagglutination test:

[0066] Transfer the red blood cell pellet to a centrifuge tube for washing. Add at least twice the volume of sterile saline or PBS to wash three times, and take the red blood cell mud to prepare a 1% human red blood cell suspension. Pipette 25μL of PBS in the sample loading groove and add it to a 96-well V-shaped microplate, a total of 18 wells (the last well is the negative control well). Pipette 25μL of the virus solution to be tested and add it to each well in the first column. Take 25μL of the mixed virus solution from the first well and add it to the corresponding wells in the second column and mix several times. Make a 2-fold serial dilution from the 1st well to the 17th well of the microplate, and discard 25μL of liquid from the last well. Pipette 25μL of red blood cell suspension in the sample loading groove and tap the microplate to fully mix the red blood cells and virus. Incubate at 2-8℃ for 30-60min, observe the red blood cell agglutination phenomenon and record the results. The hemagglutination results are as follows: Figure 6As shown in A and 6B, it can be seen that the chimeric VP60 protein expressed by the RHDV1VP60-R2L5 construct has the effect of agglutinating human red blood cells, and the hemagglutination titer is 16log2; the chimeric VP60 protein expressed by the RHDV2VP60-R1L1 construct has the effect of agglutinating human red blood cells, and the hemagglutination titer is 12log2.

[0067] Example 4: Expression of chimeric rabbit hemorrhagic disease virus VP60 protein using serum-free suspension culture in a bioreactor

[0068] Adjust the bioreactor culture parameters to 27°C, 50±5% dissolved oxygen, PH=6.0-6.3, and 80-90 rpm. Inoculate Sf9 seed cells into a 10L bioreactor for amplification and culture. Take samples and count them every 24 hours to observe cell density, viability, diameter, agglomeration rate, etc., and draw a growth curve. When the cell density reaches 8.0×10 6 The cells were transferred to a 100L reactor for amplification and culture until the cell density reached 8.0×10 6 The cells were transferred to a 500L reactor and inoculated with 5% of the recombinant antigen of rabbit hemorrhagic disease virus VP60, RHDV1VP60-R2L5 or RHDV2VP60-R1L1P3, respectively, during the logarithmic growth period. The antigens were harvested after 96 to 120 hours. The results showed that Sf9 cells can adapt to serum-free suspension culture in cell shake flasks and 10L to 500L bioreactors. The cell doubling time was 20 to 24 hours. At a cell density of 1.0 to 8.0×10 6 Exponential proliferation can be achieved when the number of cells / mL is 1.0. Collecting the culture supernatant 96 to 120 hours after inoculation of the recombinant baculovirus can achieve efficient antigen expression, and the hemagglutination titer of the recombinant antigen in the culture supernatant can reach 16log2. When applied to the configuration of rabbit hemorrhagic disease virus subunit vaccine, large-scale batch production can be achieved, and production costs can be effectively saved.

[0069] Example 5: Vaccine configuration

[0070] 1. Antigen inactivation

[0071] The supernatant of the insect cell expression infected with the recombinant baculovirus of the rabbit hemorrhagic disease virus VP60 recombinant antigen RHDV1VP60-R2L5 or RHDV2VP60-R1L1P3 prepared in Example 4 was added to the inactivation tank for inactivation, and BEI was added to a final concentration of 10mmol / L, and inactivated at 32°C with 300r / min stirring for 12 hours. After inactivation, sodium thiosulfate was added at a volume of 0.7%, and stirring was continued for 30 minutes to neutralize BEI. The inactivated antigen solution was stored at 2-8°C for no more than 1 month.

[0072] 2. Vaccine configuration

[0073] Take the semi-finished antigen that has passed the sterility test and inactivation test, and use 1% human red blood cell suspension to detect the hemagglutination value. Use physiological saline as a diluent to dilute the recombinant chimeric VP60 antigen RHDV1VP60-R2L5 or RHDV2VP60-R1L1 to a hemagglutination value of 6 to 13log2. Sterilize the aluminum hydroxide gel adjuvant at 116℃ for 30min. Place the antigen and adjuvant in a sterile container and mix them in a volume ratio of 7:1. Stir the adjuvant at 120 to 150rpm for 2 to 3min, then slowly add the antigen phase and stir for 40min to prepare the vaccine. The stirring speed should be such that there is no foaming to obtain the rabbit hemorrhagic virus VP60 recombinant antigen RHDV1VP60-R2L5 or RHDV2VP60-R1L1 vaccine. Dispense the vaccine into 20ml vaccine bottles, cover and label them; store at 4℃ for later use.

[0074] In addition, a vaccine with RHDV1VP60-R2L5 and RHDV2VP60-R1L1 as antigens was prepared according to the above method, wherein the ratio of the two to the adjuvant was 3.5:3.5:1.

[0075] Example 6 Immunogenicity Evaluation

[0076] 1. Safety experiment

[0077] Take 15 healthy rabbits aged 35 to 45 days as the test group, divided into three groups, 5 rabbits in each group. Among them, 5 rabbits were subcutaneously injected with 2.0 mL of the recombinant rabbit hemorrhagic disease subunit (RHDV1VP60-R2L5) vaccine prepared in Example 5, and the other 5 rabbits were subcutaneously injected with 2.0 mL of the rabbit hemorrhagic disease subunit (RHDV2VP60-R1L1) vaccine in each neck. At the same time, 5 rabbits under the same conditions were used as controls, without vaccination, and observed for 14 consecutive days, and the mental state, diet, feces, local and systemic reactions of the three groups were recorded. The results showed that all the experimental rabbits were healthy, with normal mental state and feces, good absorption at the injection site, and no lumps, indicating that the vaccine is safe.

[0078] 2. Efficacy Experiment

[0079] Thirty-five non-immunized healthy rabbits aged 35 to 45 days were selected as the experimental group and divided into 7 groups with 5 rabbits in each group. Group A was immunized with a single-component vaccine composed of RHDV1VP60-R2L5 chimeric antigen, Group B was immunized with a single-component vaccine composed of RHDV2VP60-R1L1 chimeric antigen, Group C was immunized with a two-component mixture vaccine composed of RHDV1VP60-R2L5 chimeric antigen and RHDV2VP60-R1L1 chimeric antigen, Group D was immunized with a single-component vaccine composed of wild-type RHDV1VP60 antigen without any amino acid mutation, Group E was immunized with a single-component vaccine composed of wild-type RHDV2VP60 antigen without any amino acid mutation, Group F was immunized with a wild-type bivalent vaccine, which was a physical mixture of two antigen components, wild-type RHDV1VP60 without any amino acid mutation and wild-type RHDV2VP60, i.e., a bivalent antigen vaccine composed of Wildtype RHDV1VP60+Wildtype RHDV2VP60; Group G was the control group, immunized with sterile saline. Specific animal grouping and vaccine immunization schedule are shown in Table 1.

[0080] Table 1 Animal grouping and vaccine immunization

[0081]

[0082]

[0083] (1) Hemagglutination inhibition (HI) antibody test

[0084] Serum was collected from each group of animals at 7 days, 14 days, 21 days after the first immunization and 10 days after the second immunization to detect serum HI antibody levels against RHDV1 / RHDV2. The hemagglutination inhibition test method is as follows:

[0085] Take 40uL of serum to be tested, inactivate it, add red blood cell mud and shake it evenly, act at 2-8℃ for 60min, centrifuge at 1500r / min for 10min, and aspirate the supernatant, which is the serum to be tested. Take a 96-well V-type micro-hemagglutination plate, add 25uL of PBS buffer to each well from the first well, add 50uL PBS to the last well, which is the red blood cell control well, and aspirate 25uL of serum to be tested respectively, add it to the corresponding first well, and set up positive serum control and negative serum control wells at the same time. Perform a 2-fold serial dilution from the first well, take 25uL from the 10th well and discard it. Except for the red blood cell control, add 25uL of 4HA unit antigen to each well, and flick the microplate to mix and react. After sufficient reaction, add 25uL of 1% red blood cell suspension to each well, flick the microplate to mix, and let it stand at 2-8℃ for 30-60min. The highest dilution multiple of the serum that completely inhibits the 4HAU antigen is taken as the HI titer. The specific results are shown in Table 2.

[0086] Table 2 RHDV-specific HI antibody titer after vaccination (log2, average value)

[0087]

[0088]

[0089] The above results show that the recombinant chimeric VP60 protein RHDV1VP60-R2L5 subunit vaccine and the recombinant chimeric VP60 protein RHDV2VP60-R1L1 subunit vaccine of the present invention can simultaneously stimulate high-level HI antibodies against RHDV1 and RHDV2 after immunizing animals, and the antibody titers of the two single-component vaccines against RHDV1 and RHDV2 antigens are equivalent to those of the bivalent subunit vaccine containing wild-type RHDV1VP60 antigen and wild-type RHDV2VP60 antigen. When the two recombinant chimeric RHDV1VP60-R2L5 and RHDV2VP60-R1L1 antigens are combined for vaccination, high-level HI-specific antibodies against RHDV1 and RHDV2 can still be stimulated after the amount of antigens is reduced, and the antibody titer level is better than that of the bivalent subunit vaccine containing wild-type RHDV1VP60 antigen and wild-type RHDV2VP60 antigen.

[0090] Example 7 Preparation Process Comparison

[0091] Although the recombinant chimeric antigen and the two wild-type protein mixture vaccines provided by the present invention have similar immune effects, the preparation processes are significantly different. As shown in Table 4, the preparation process of the recombinant chimeric antigen does not require physical mixing and other steps, and only one antigen needs to be prepared, which shortens the time by 50%, and there is no material, water and electricity consumption in the corresponding steps, and the production cost is significantly reduced, which has a good application prospect.

[0092] Table 4 Preparation process comparison

[0093]

Claims

1. A recombinant chimeric rabbit hemorrhagic disease virus VP60 antigen for preparing a rabbit hemorrhagic disease subunit vaccine, characterized in that: The amino acid sequence thereof is shown as sequence 1 or sequence 2 in the sequence table.

2. The gene encoding the recombinant chimeric rabbit hemorrhagic disease virus VP60 antigen according to claim 1, the nucleic acid sequence of which is shown in Sequence 3 or Sequence 4 in the sequence listing.

3. A recombinant expression vector containing the coding gene according to claim 2; preferably, the coding gene is transferred into pFastBac1, pFastBac dual or pDEST8, and the recombinant expression vector expressing the coding gene is screened.

4. A recombinant baculovirus expressing a chimeric rabbit hemorrhagic disease virus VP60 antigen, comprising: transforming the recombinant expression vector described in claim 3 into a DH10Bac host bacterium to obtain a Re-Bacmid shuttle plasmid, and transfecting the Re-Bacmid plasmid into a host cell to obtain a recombinant baculovirus expressing a chimeric rabbit hemorrhagic disease virus VP60 antigen; the host cell is a Sf9 cell, a High Five cell or a Sf21 cell.

5. The method for preparing the recombinant chimeric rabbit hemorrhagic disease virus VP60 antigen according to claim 1, characterized in that: The recombinant vector of claim 3 is transfected into a host cell, and the cell culture supernatant or host cell lysate is collected and then separated and purified to obtain the recombinant chimeric rabbit hemorrhagic disease virus VP60 antigen; the host cell is a Sf9 cell, a High Five cell or a Sf21 cell.

6. A recombinant chimeric rabbit hemorrhagic disease virus VP60 antigen composition, which is composed of a protein with an amino acid sequence as shown in Sequence 1 in the sequence list and a protein with an amino acid sequence as shown in Sequence 2 in the sequence list.

7. Use of the recombinant chimeric rabbit hemorrhagic disease virus VP60 antigen according to claim 1, the encoding gene according to claim 2, and the recombinant chimeric rabbit hemorrhagic disease virus VP60 antigen composition according to claim 6 in the preparation of a recombinant subunit vaccine for rabbit viral hemorrhagic disease.

8. A recombinant subunit vaccine for rabbit viral hemorrhagic disease, characterized in that: It comprises the recombinant chimeric rabbit hemorrhagic disease virus VP60 antigen as claimed in claim 1, and a pharmaceutically acceptable adjuvant; preferably, the adjuvant is one or more of aluminum hydroxide adjuvant, aluminum phosphate adjuvant, potassium aluminum sulfate adjuvant, amorphous aluminum hydroxyphosphate sulfate adjuvant, MF59, AS03, AS01, MONTANIDE ISA206VG, ​​MONTANIDE ISA 201VG, and MONTANIDE ISA 51VG.

9. Use of the rabbit viral hemorrhagic disease subunit vaccine according to claim 7 in the preparation of a medicament for preventing or treating rabbit viral hemorrhagic disease.

10. The method for preparing the rabbit hemorrhagic disease subunit vaccine according to claim 7, characterized in that: The preparation method comprises the following steps: (1) Dilute the recombinant chimeric VP60 antigen described in claim 1 or the recombinant chimeric rabbit hemorrhagic disease virus VP60 antigen composition described in claim 6 with water for injection to a blood coagulation titer of 2 13 to the power, thus obtaining the antigenic phase; (2) sterilizing the adjuvant; (3) At room temperature, add the adjuvant into a sterile container according to a volume ratio of the antigen phase to the adjuvant of 7:1 to 9:1, stir at 120 to 150 rpm for 2 to 3 minutes, then slowly add the subunit antigen phase, continue stirring for 30 to 40 minutes, let stand for 3 to 5 minutes, and package.

Images