Phytophthora sojae psFBP21 protein, psFBP21 gene, biological material and application thereof

Abstract

The invention relates to the field of biology, in particular to phytophthora sojae psFBP21 protein, a psFBP21 gene, a biological material and application thereof. The amino acid sequence of the phytophthora sojae psFBP21 protein provided by the invention is as shown in SEQ ID NO. 2; the nucleotide sequence of the coding gene is as shown in SEQ ID NO. 1. Experiments prove that the phytophthora sojae psFBP21 protein provided by the invention plays an important role in the growth and development process of phytophthora sojae, specifically, after the protein is deleted, the growth of phytophthora sojae hyphae is slowed down, the number of oospore is reduced, the pathogenicity is reduced and the like. The conclusion provides a technical basis for exploring phytophthora sojae development and a pathogenic molecular mechanism, and provides a molecular target for research and development of novel bactericides in the future.

Description

Technical Field

[0001] The invention relates to the biological field, in particular to a psFBP21 protein of Phytophthora sojae, a psFBP21 gene and a biological material and applications thereof. Background Art

[0002] Soybean Phytophthora is a very important plant pathogenic oomycete, which mainly causes soybean Phytophthora root rot. The disease is a soil-borne disease and occurs in major soybean producing areas in more than 20 countries around the world. The disease was first discovered and reported in North America in the 1950s. Currently, it occurs in major soybean producing areas in more than 20 countries in Asia, Africa, Europe, North and South America, and Oceania. Soybean Phytophthora can infect soybeans throughout the entire growth period, causing devastating disasters to soybeans and causing economic losses of more than $1 billion each year. At present, it is classified as one of the top ten important pathogenic oomycetes.

[0003] Different from fungal diseases, soybean phytophthora belongs to the class Oomycetes. Due to its complex life cycle, soybean phytophthora can infect soybeans throughout their entire growth period. Soybean phytophthora root rot can cause a 20-50% reduction in soybean yield, or even a total loss of yield. It is particularly serious in repeated or continuous cropping plots, and has always been one of the important plant diseases that has attracted extensive attention and research from scholars at home and abroad.

[0004] The life cycle of soybean phytophthora is divided into different stages such as hyphae, zoospores, zoospores, and oospores, all of which have the ability to infect soybeans. In particular, zoospores are the main source of re-infection in the disease cycle. Therefore, the growth rate of soybean phytophthora hyphae, the formation of zoospores, and the formation of oospores are important factors affecting the occurrence and development of the disease. Reducing the growth rate of soybean phytophthora hyphae, blocking the formation of oospores, and reducing the ability of the pathogen to infect host plants is an effective method for preventing and controlling soybean phytophthora root rot.

[0005] During the growth and development or pathogenicity of soybean phytophthora, proteins with important functions are often important potential molecular targets for the development of fungicides. The loss of such proteins often affects the infection process and the growth of soybean phytophthora, thereby controlling the occurrence and circulation of soybean phytophthora diseases and reducing their harm. Summary of the invention

[0006] The purpose of the present invention is to provide a psFBP21 protein, a psFBP21 gene and a biomaterial of Phytophthora sojae, and their application, so as to solve the problems existing in the above-mentioned prior art. By inhibiting the expression of the psFBP21 gene in Phytophthora sojae or inhibiting the activity of the psFBP21 protein of Phytophthora sojae, the growth rate of Phytophthora sojae hyphae, the yield of Phytophthora sojae oospores, the ability of Phytophthora sojae to infect hosts and the pathogenicity of Phytophthora sojae to hosts can be reduced.

[0007] To achieve the above object, the present invention provides the following solutions:

[0008] The present invention provides the use of soybean Phytophthora psFBP21 protein in any of the following items:

[0009] (1) Application in regulating the growth rate of soybean Phytophthora mycelium;

[0010] (2) Application in regulating soybean Phytophthora oospore production;

[0011] (7) Application in regulating the ability of soybean Phytophthora to infect hosts;

[0012] (4) Application in regulating the pathogenicity of Phytophthora sojae to the host;

[0013] The amino acid sequence of the soybean Phytophthora psFBP21 protein is shown in SEQ ID NO.2.

[0014] Preferably, by inhibiting the activity of the P. sojae psFBP21 protein in P. sojae, the mycelial growth rate of P. sojae, the oospore yield of P. sojae, the ability of P. sojae to infect the host or the pathogenic effect of P. sojae on the host are reduced.

[0015] As an additional example, the soybean Phytophthora psFBP21 protein provided by the present invention is as follows:

[0016] A1) a protein with an amino acid sequence as shown in SEQ ID NO.2;

[0017] A2) a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein shown in SEQ ID NO.2;

[0018] A3) A protein derived from the protein shown in SEQ ID NO. 2 having the same function as that shown in SEQ ID NO. 2 obtained by replacing and / or deleting and / or adding one or more amino acid residues in the amino acid sequence shown in SEQ ID NO. 2.

[0019] As an additional case, in order to facilitate the purification of the soybean Phytophthora psFBP21 protein of the present invention, tags such as Poly-Arg (RRRRR, SEQ ID NO.16), Poly-His (HHHHHH, SEQ ID NO.17), FLAG (DYKDDDDK, SEQ ID NO.18), Strep-tag II (WSHPQFEK, SEQ ID NO.19), and C-myc (EQKLISEEDL, SEQ ID NO.20) can be connected to the amino terminus or carboxyl terminus of the amino acid shown in SEQ ID NO.2.

[0020] The soybean Phytophthora psFBP21 protein of the present invention can be artificially synthesized, or its encoding gene can be synthesized first and then obtained by biological expression.

[0021] The coding gene of the protein in A2)-A3) above can be obtained by deleting one or several codons of amino acid residues in the DNA sequence shown in SEQ ID NO.1; and / or performing missense mutation of one or several nucleotide pairs; and / or connecting the coding sequence of the above tag at its 5' end and / or 3' end.

[0022] As an additional example, the present invention provides the use of a nucleic acid molecule encoding the soybean Phytophthora psFBP21 protein in any of the following:

[0023] (1) Application in regulating the growth rate of soybean Phytophthora mycelium;

[0024] (2) Application in regulating soybean Phytophthora oospore production;

[0025] (7) Application in regulating the ability of soybean Phytophthora to infect hosts;

[0026] (4) Application in regulating the pathogenicity of Phytophthora sojae to the host;

[0027] Further preferably, the nucleic acid molecule comprises an RNA nucleic acid molecule or a DNA nucleic acid molecule.

[0028] Further preferably, the DNA nucleic acid molecule includes cDNA, genomic DNA or recombinant DNA.

[0029] The present invention provides the use of the soybean Phytophthora psFBP21 gene in any of the following items:

[0030] (1) Application in regulating the growth rate of soybean Phytophthora mycelium;

[0031] (2) Application in regulating soybean Phytophthora oospore production;

[0032] (7) Application in regulating the ability of soybean Phytophthora to infect hosts;

[0033] (4) Application in regulating the pathogenicity of Phytophthora sojae to the host;

[0034] The nucleotide sequence of the soybean Phytophthora psFBP21 gene is shown in SEQ ID NO.1.

[0035] Preferably, by deleting the P. sojae psFBP21 gene in P. sojae, the mycelial growth rate of P. sojae, the oospore yield of P. sojae, the ability of P. sojae to infect the host or the pathogenicity of P. sojae to the host are reduced.

[0036] The soybean Phytophthora psFBP21 gene of the present invention consists of 1397 nucleotides; the nucleotides 1-276, 403-945 and 1050-1397 from the 5 end of SEQ ID NO.1 are coding sequences, encoding the soybean Phytophthora psFBP21 protein shown in SEQ ID NO.2.

[0037] As an additional example, the present invention provides the use of RNA molecules obtained by transcription of the soybean Phytophthora psFBP21 gene in any of the following items:

[0038] (1) Application in regulating the growth rate of soybean Phytophthora mycelium;

[0039] (2) Application in regulating soybean Phytophthora oospore production;

[0040] (3) Application in regulating the ability of soybean Phytophthora to infect its host;

[0041] (4) Application in regulating the pathogenicity of Phytophthora sojae to the host;

[0042] The present invention provides the use of a biological material containing the soybean Phytophthora psFBP21 gene in any of the following items:

[0043] (1) Application in regulating the growth rate of soybean Phytophthora mycelium;

[0044] (2) Application in regulating soybean Phytophthora oospore production;

[0045] (3) Application in regulating the ability of soybean Phytophthora to infect its host;

[0046] (4) Application in regulating the pathogenicity of Phytophthora sojae to the host;

[0047] The nucleotide sequence of the soybean Phytophthora psFBP21 gene is shown in SEQ ID NO.1.

[0048] Preferably, the biological material comprises an expression cassette, a recombinant vector, a recombinant microorganism or a transgenic plant cell line.

[0049] As an optional solution, the present invention includes achieving the above application by inhibiting the transcription or inactivation of the soybean Phytophthora psFBP21 gene;

[0050] And / or, inhibiting the translation of RNA molecules transcribed from the soybean Phytophthora psFBP21 gene to achieve the above application;

[0051] And / or, inhibiting or inactivating the activity of soybean Phytophthora psFBP21 protein to achieve the above application;

[0052] The amino acid sequence of the soybean Phytophthora psFBP21 protein is shown in SEQ ID NO.2; the nucleotide sequence of the soybean Phytophthora psFBP21 gene is shown in SEQ ID NO.1.

[0053] As an optional solution, the recombinant vector may be a recombinant expression vector or a recombinant cloning vector;

[0054] In the biological material, the vector may be a plasmid, a cosmid, a phage or a virus vector; the microorganism may be a yeast or a bacterium; and the transgenic plant cell line does not include a propagation material.

[0055] As an optional solution, the biological material is any one of the following D1 to D10:

[0056] D1) an expression cassette containing the psFBP21 gene of Phytophthora sojae;

[0057] D2) a recombinant vector containing the P. sojae psFBP21 gene or a recombinant vector containing the expression cassette described in D1);

[0058] D3) a recombinant microorganism containing the psFBP21 gene of Phytophthora sojae, a recombinant microorganism containing the expression cassette described in D1), or a recombinant microorganism containing the recombinant vector described in D2);

[0059] D4) a transgenic plant cell line containing the P. sojae psFBP21 gene or a transgenic plant cell line containing the expression cassette described in D1);

[0060] D5) transgenic plant tissue containing the soybean Phytophthora psFBP21 gene or transgenic plant tissue containing the expression cassette described in D2);

[0061] D6) a transgenic plant organ containing the P. sojae psFBP21 gene or a transgenic plant organ containing the expression cassette described in D2);

[0062] D7) a nucleic acid molecule that inhibits the expression of the soybean Phytophthora psFBP21 gene;

[0063] D8) an expression cassette, a recombinant vector, a recombinant microorganism or a transgenic plant cell line containing the nucleic acid molecule described in D7);

[0064] D9) a nucleic acid molecule that inhibits the translation of RNA molecules transcribed from the psFBP21 gene of Phytophthora sojae;

[0065] D10) An expression cassette, a recombinant vector, a recombinant microorganism or a transgenic plant cell line producing the nucleic acid molecule described in D9).

[0066] The present invention provides the use of a soybean Phytophthora psFBP21 protein, a soybean Phytophthora psFBP21 gene or a biological material containing the soybean Phytophthora psFBP21 gene in screening and / or assisting screening of soybean Phytophthora antibacterial agents and / or fungicides. The amino acid sequence of the soybean Phytophthora psFBP21 protein is shown in SEQ ID NO.2; the nucleotide sequence of the soybean Phytophthora psFBP21 gene is shown in SEQ ID NO.1.

[0067] Preferably, the biological material comprises an expression cassette, a recombinant vector, a recombinant microorganism or a transgenic plant cell line.

[0068] As an additional example, the present invention provides the use of nucleic acid molecules encoding soybean psFBP21 protein or RNA molecules obtained by transcription of soybean psFBP21 gene of soybean Phytophthora in screening and / or assisting screening of soybean Phytophthora antifungal agents and / or fungicides.

[0069] The present invention provides a method for screening or assisting in screening a soybean Phytophthora antibacterial agent and / or bactericide, comprising the step of detecting the expression level of a soybean Phytophthora psFBP21 gene in soybean Phytophthora before and after application of the drug; the nucleotide sequence of the soybean Phytophthora psFBP21 gene is shown in SEQ ID NO.1.

[0070] Further preferably, when the pesticide preparation can inhibit the transcription of the soybean Phytophthora psFBP21 gene, inhibit the translation of the RNA nucleic acid molecule transcribed from the soybean Phytophthora psFBP21 gene, inhibit the activity of the soybean Phytophthora psFBP21 protein, or inactivate the soybean Phytophthora psFBP21 protein, the pesticide preparation can be used as an antibacterial agent and / or a fungicide for the soybean Phytophthora;

[0071] The amino acid sequence of the soybean Phytophthora psFBP21 protein is shown in SEQ ID NO.2; the nucleotide sequence of the soybean Phytophthora psFBP21 gene is shown in SEQ ID NO.1.

[0072] As an optional scheme, the method for screening or assisting in screening soybean Phytophthora antibacterial agents and / or fungicides described in the present invention comprises the following steps: applying the substance to be detected to the soybean Phytophthora, when the substance to be detected can inhibit the transcription of the soybean Phytophthora psFBP21 gene, or inhibit the translation of RNA nucleic acid molecules obtained by transcription of the soybean Phytophthora psFBP21 gene, or inhibit the soybean Phytophthora psFBP21 protein, or inactivate the soybean Phytophthora psFBP21 protein, then the substance to be detected is a candidate for the soybean Phytophthora antibacterial and / or fungicide.

[0073] As an optional scheme, in the above method, the inactivation of the P. sojae psFBP21 protein is achieved by inhibiting the expression of the gene encoding the P. sojae psFBP21 protein in the P. sojae (P. sojae psFBP21 gene), specifically, by gene knockout or gene silencing.

[0074] As an optional solution, the method for knocking out the above-mentioned gene is a gene knockout method based on CRISPR / Cas9.

[0075] As an optional scheme, the sgRNA and Cas9 co-expression plasmid is a vector that co-expresses the sgRNA fragment targeting the target gene to be knocked out and the encoding of Cas9, wherein the target gene to be knocked out is the soybean Phytophthora psFBP21 gene, and the sgRNA sequence targeting the soybean Phytophthora psFBP21 gene is GTCGTCGTGGGAGGTCCCTG, SEQ ID NO.15.

[0076] The present invention discloses the following technical effects:

[0077] The present invention provides a psFBP21 protein, a psFBP21 gene, a biomaterial and an application thereof of Phytophthora sojae. The results of the specific embodiments of the present invention show that the psFBP21 protein of Phytophthora sojae provided by the present invention plays a role in the growth and development process of Phytophthora sojae itself. The knockout mutants obtained by using CRISPR / Cas9 gene editing technology have obvious changes in growth and development compared with the wild-type parent strain, which are mainly manifested in that the hyphae growth rate of the single knockout mutant of the psFBP21 gene of Phytophthora sojae slows down, the oospores are reduced, and the ability to infect host plants is weakened; therefore, the psFBP21 protein of Phytophthora sojae can play an important role in each process of Phytophthora sojae's vegetative growth, sexual reproduction and infection of the host. The present invention provides technical support for the study of the pathogenic mechanism of Phytophthora sojae, and provides a potential molecular target for the research and development of new fungicides in the future. BRIEF DESCRIPTION OF THE DRAWINGS

[0078] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0079] Figure 1 It is a bar chart of hyphae growth rate of different strains;

[0080] Figure 2 It is a bar chart of oospore production of different strains;

[0081] Figure 3 Statistical bar graph of pathogenicity of different strains. DETAILED DESCRIPTION

[0082] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0083] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0084] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0085] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0086] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0087] The experimental methods in the following examples are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples are commercially available unless otherwise specified.

[0088] Soybean Phytophthora strain P6497 (WT) and the vectors used PYF 515, pBluescript II SK + Gift to the Oomycete and Fungal Molecular Laboratory of Nanjing Agricultural University.

[0089] The present invention provides a FBP21 (Formin Binding Protein) protein derived from soybean Phytophthora, and named it as soybean Phytophthora psFBP21 protein. The protein is closely related to the growth rate of soybean Phytophthora hyphae and the yield of oospores, which are all related to the infection cycle of plant diseases. Therefore, the growth of hyphae can be slowed down, the normal oospore production can be blocked, and the ability of soybean Phytophthora to infect the host can be affected, thereby controlling the occurrence and development of soybean Phytophthora root rot, which is specifically verified by the following examples:

[0090] Example 1 Obtaining the soybean Phytophthora FBP21 protein (psFBP21) and its encoding gene

[0091]

[0092] The above-mentioned soybean Phytophthora psFBP21 protein or soybean Phytophthora psFBP21 gene can also be artificially synthesized.

[0093] Table 1 Primers for amplifying the full-length gene encoding psFBP21 protein of Phytophthora sojae

[0094]

[0095] Example 2 Construction of soybean Phytophthora psFBP21 gene knockout vector

[0096] The Donor vector pBS-NPT II-psFBP21 used in this embodiment; the sgRNA and Cas 9 co-expression plasmid PYF515-psFBP21;

[0097] The specific construction method is as follows:

[0098] 1) Construction of pBS-NPT II-psFBP21:

[0099] 2+ plus) 10μL, dNTP Mixture (2.5mMeach) 1.6μL, PrimeSTAR HSDNA Polymerase (2.5U / μL) 0.2μL, psFBP21-F1 1μL, psFBP21-R1 1μL, template DNA 1μL, ddH2O 5.2μL; PCR reaction program: 98℃ pre-denaturation 10min; 98℃ denaturation 10s, 55℃ annealing 5s, 72℃ extension 1min, a total of 35 cycles; finally 72℃ extension 10min, one cycle ends. The three amplified fragments were fused and connected into the cloning vector pBluescript IISK in sequence using the Bio-Sky Seamless Cloning Kit. + (EcoR V digestion), the ligation product was transformed into Escherichia coli DH5α competent cells, and after overnight culture at 37°C, the universal primers M13F (sequence: 5'-TGTAAAACGACGGCCAGT-3', SEQ ID NO.7) / M13R (sequence: 5'-CAGGAAACAGCTATGACC-3', SEQ ID NO.8) were used for amplification and sequencing to verify the clone, and the correctly verified recombinant expression vector containing the sequentially connected 1000bp sequence of the psFBP21 gene upstream, the NPTII gene sequence and the 1000bp sequence downstream of the psFBP21 gene was named pBS-NPT II-psFBP21.

[0100] Table 2 Primer sequences used for vector construction

[0101]

[0102] 2) Construction of PYF 515-sgFBP21:

[0103] Using the sgRNA design website EuPaGDT (http: / / grna.ctegd.uga.edu / ) and the RNA structure online analysis tool (http: / / rna.urmc.roche s ter.edu / RNAstructureWeb / Servers / Predict1 / Predict1.html), the sgRNA sequence (sgFBP21, whose sequence is shown in SEQ ID NO.15, specifically: GTCGTCGTGGGAGGTCCCTG, targeting positions 102-121 of SEQ ID No.1 of the psFBP21 gene) that specifically targets the psFBP21 gene was selected, and the forward and reverse sgRNA sequences with Nhe I and Bsa I restriction sites and HH ribozyme were synthesized and connected to the vector PYF 515. The recombinant vector of sgRNA was named PYF 515-sgFBP21.

[0104] Example 3 Obtaining soybean Phytophthora psFBP21 gene knockout transformants

[0105] The psFBP21 gene knockout transformants were prepared by a CaCl2-PEG-mediated protoplast transformation method. The method of oomycete genetic transformation was disclosed in the document "Efficient disruption and replacement of an effector gene in the oomycete Phytophthora sojae using CRISPR / Cas9. Molecular plant pathology" (Fang, Y., and Tyl r, BM (2016). Efficient disruption and replacement of an effector gene in the oomycete Phytophthora sojae using CRISPR / Cas9. Molecular plant pathology, 17 (1), 127-139).

[0106] After the transformants were screened for G418 resistance, the mycelial DNA of the suspected transformants was extracted for PCR sequencing verification, and the soybean Phytophthora psFBP21 gene single knockout transformant, z-9 strain, was obtained.

[0107] Example 4 Analysis of biological characteristics of soybean Phytophthora psFBP21 gene knockout transformants (z-9 strain)

[0108] 1. Mycelial growth rate detection

[0109] The wild-type soybean Phytophthora strain P6497 (WT), the control transformant (CK, constructed in the same manner as in Example 3, but without knocking out the soybean Phytophthora psFBP21 gene) and the soybean Phytophthora psFBP21 gene single knockout transformant (z-9 strain) obtained in Example 3 were inoculated in the center of a sterile culture dish (9 cm in diameter) containing 15 mL of V8 solid culture medium, and cultured at 25° C. in the dark for 5 d. The colony diameter of each strain was measured by the cross method, and each strain was repeated 3 times. The results are shown in FIG. Figure 1 The results showed that the mycelial growth rate of all tested soybean Phytophthora psFBP21 gene single knockout transformants, z-9 strains, was significantly decreased compared with the wild-type soybean Phytophthora strain P6497 (WT) and the control transformant (CK).

[0110] The experimental results show that the soybean Phytophthora psFBP21 gene or soybean Phytophthora psFBP21 protein is involved in regulating the hyphal growth of soybean Phytophthora.

[0111] 2. Oospore Count

[0112] The wild-type soybean Phytophthora strain P6497 (WT), the control transformant (CK) and the soybean Phytophthora psFBP21 gene single knockout transformant (z-9 strain) obtained in Example 3 were inoculated in the center of a sterile culture dish (diameter 9 cm) with 15 mL of V8 solid culture medium, and cultured in the dark at 25° C. for 14 days. The number and morphology of oospores produced were observed under a microscope, and the deformity rate was calculated. The results were repeated 3 times. Figure 2 The results showed that the number of oospores of the soybean Phytophthora psFBP21 gene single knockout transformant (z-9 strain) obtained in Example 3 was lower than that of the wild-type strain P6497 (WT) and the control transformant (CK).

[0113] 3. Pathogenicity Detection

[0114] The soybean variety was Hefeng 50. Preparation of zoospore suspension (2×10 4 Zoospores / mL) or 5mm bacterial cakes were made on the solid medium of soybean Phytophthora V8 cultured for 5-7 days. 10μL zoospore suspension or a bacterial cake was inoculated at about 1cm from the hypocotyl of the yellowed soybean seedlings. The present invention uses bacterial cakes; each strain of bacteria was inoculated into 10 yellowed seedlings, and after culturing at 25℃ in the dark and moisturizing for 3 days, the length of the lesions (mm) of the hypocotyls of the yellowed seedlings infected by soybean Phytophthora was investigated. The results are as follows Figure 3 The results showed that compared with the wild-type soybean Phytophthora strain P6497 (WT), the pathogenicity of the psFBP21 gene single knockout transformant (z-9 strain) obtained in Example 3 was significantly reduced.

[0115] The experimental results show that the soybean Phytophthora psFBP21 gene or soybean Phytophthora psFBP21 protein has the ability to participate in regulating the infection of soybean Phytophthora to host plants.

[0116] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. Use of soybean Phytophthora psFBP21 protein in any of the following: (1) Application in regulating the growth rate of soybean Phytophthora mycelium; (2) Application in regulating soybean Phytophthora oospore production; (3) Application in regulating the ability of soybean Phytophthora to infect its host; (4) Application in regulating the pathogenicity of Phytophthora sojae to the host; The amino acid sequence of the soybean Phytophthora psFBP21 protein is shown in SEQ ID NO.

2.

2. The use according to claim 1, characterized in that: By inhibiting the activity of the soybean phytophthora psFBP21 protein in soybean phytophthora, the soybean phytophthora hyphae growth rate, soybean phytophthora oospore yield, soybean phytophthora host infection ability or soybean phytophthora pathogenicity to the host are reduced.

3. Use of the soybean Phytophthora psFBP21 gene in any of the following: (1) Application in regulating the growth rate of soybean Phytophthora mycelium; (2) Application in regulating soybean Phytophthora oospore production; (3) Application in regulating the ability of soybean Phytophthora to infect its host; (4) Application in regulating the pathogenicity of Phytophthora sojae to the host; The nucleotide sequence of the soybean Phytophthora psFBP21 gene is shown in SEQ ID NO.

1.

4. The use according to claim 3, characterized in that: By deleting the soybean phytophthora psFBP21 gene in soybean phytophthora, the soybean phytophthora hyphae growth rate, soybean phytophthora oospore yield, soybean phytophthora host infection ability or soybean phytophthora pathogenicity to the host are reduced.

5. Use of biological materials containing soybean Phytophthora psFBP21 gene in any of the following: (1) Application in regulating the growth rate of soybean Phytophthora mycelium; (2) Application in regulating soybean Phytophthora oospore production; (3) Application in regulating the ability of soybean Phytophthora to infect its host; (4) Application in regulating the pathogenicity of Phytophthora sojae to the host; The nucleotide sequence of the soybean Phytophthora psFBP21 gene is shown in SEQ ID NO.

1.

6. The use according to claim 3, characterized in that: The biological material includes an expression cassette, a recombinant vector, a recombinant microorganism or a transgenic plant cell line.

7. Use of a psFBP21 protein of Phytophthora sojae, a psFBP21 gene of Phytophthora sojae, or a biological material containing the psFBP21 gene of Phytophthora sojae in screening and / or assisting screening of a Phytophthora sojae antifungal agent and / or bactericide, characterized in that: The amino acid sequence of the soybean Phytophthora psFBP21 protein is shown in SEQ ID NO.2; the nucleotide sequence of the soybean Phytophthora psFBP21 gene is shown in SEQ ID NO.

1.

8. The use according to claim 7, characterized in that: The biological material includes an expression cassette, a recombinant vector, a recombinant microorganism or a transgenic plant cell line.

9. A method for screening or assisting screening of soybean phytophthora inhibitors and / or bactericides, characterized in that: The method comprises the steps of detecting the expression amount of the psFBP21 gene of Phytophthora sojae in Phytophthora sojae before and after the application of the drug; the nucleotide sequence of the psFBP21 gene of Phytophthora sojae is shown as SEQ ID NO.1.

Images