Application of CHYR16 protein and coding gene thereof in regulating and controlling saline-alkaline tolerance of plants

Abstract

The invention discloses an application of CHYR16 protein and a coding gene thereof in regulating and controlling saline-alkaline tolerance of plants. The CHYR16 protein is any one of the following B1)-B4): B1) a protein with an amino acid sequence as shown in a sequence 2; b2) a fusion protein which is obtained by connecting a label to the N end and / or the C end of the amino acid sequence as shown in the sequence 2 and has the same function; b3) a protein which is obtained by substitution and / or deletion and / or addition of one or more amino acid residues on the amino acid sequence as shown in the sequence 2 and has the same function; b4) a protein which has 80% or more than 80% of identity with the amino acid sequence shown in the sequence 2 and has the same function. The invention discovers that the CHYR16 protein can regulate the saline-alkaline tolerance of soybean and arabidopsis thaliana for the first time, and lays a foundation for cultivating saline-alkaline tolerance plant varieties.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and specifically relates to application of CHYR16 protein and its encoding gene in regulating plant salt-alkali tolerance. Background Art

[0002] Soil salinization seriously harms the growth and development of crops, reduces crop yields, and causes extremely serious losses to agricultural production. According to incomplete statistics from the Food and Agriculture Organization of the United Nations, there are about 831 million hm2 of saline-alkali land in the world. 2 , of which my country accounts for about 10%. Northeast China is the main soybean planting area in my country. The planting area of ​​soybeans accounts for about 50-70% of the cultivated land area, and the annual planting area and output account for 1 / 3 of the country. The Songnen Plain in Northeast China, located in Heilongjiang Province, is one of the three largest saline-alkali lands in the world. The area of ​​saline-alkali land is as high as more than 3.7 million hectares, accounting for 10.68% of the total area of ​​saline-alkali land in my country, which seriously restricts the crop yield and agricultural development in Northeast my country. The Northeast region is mainly a mixed saline-alkali land of salinized soil and alkaline soil, namely soda saline-alkali soil, whose main components are strong alkaline salts such as NaHCO3 or Na2CO3, which are more harmful to plant growth, and the response mechanism of plants in response to soda saline-alkali stress is also more complex.

[0003] Soybean is an important crop for both food and oil, and is the main source of vegetable protein and vegetable oil. Heilongjiang Province is the main soybean producing area in my country, accounting for about 60% of the country's output and planting area. Glycine max ) is a moderately salt-tolerant crop. Soil salinization seriously affects soybean growth, agronomic traits and seed quality, resulting in reduced soybean production. Therefore, exploring soybean salt-alkali tolerance genes, cultivating salt-alkali tolerant soybean varieties through molecular design breeding technology, and increasing soybean yields in saline-alkali land have become one of the means to improve and rationally develop and utilize saline-alkali land. Summary of the invention

[0004] The technical problem to be solved by the present invention is how to regulate the salt-alkali tolerance of plants. The technical problem to be solved is not limited to the described technical subject matter, and those skilled in the art can clearly understand other technical subjects not mentioned in this article through the following description.

[0005] In order to solve the above technical problems, the present invention first provides the use of CHYR16 protein or a substance for regulating the content and / or activity of the CHYR16 protein in any of the following A1)-A6): A1) Regulate plant stress tolerance; A2) Preparation of products for regulating plant stress tolerance; A3) Cultivating plants with altered stress tolerance; A4) preparing products for breeding plants with altered stress tolerance; A5) Plant breeding; A6) preparing plant breeding products; The CHYR16 protein is any one of the following B1)-B4): B1) The amino acid sequence is the protein shown in SEQ ID NO:2; B2) A fusion protein having the same function obtained by connecting a tag to the N-terminus and / or C-terminus of the amino acid sequence shown in SEQ ID NO: 2; B3) A protein having the same function obtained by replacing and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID NO: 2; B4) A protein that has 80% or more identity with the amino acid sequence shown in SEQ ID NO: 2 and has the same function.

[0006] In the protein described in B2) above, the tag refers to a polypeptide or protein that is fused and expressed with the target protein using DNA in vitro recombination technology to facilitate the expression, detection, tracing and / or purification of the target protein. The tag includes but is not limited to: GST (glutathione sulfhydryl transferase) tag protein, His6 tag protein (His-tag), MBP (maltose binding protein) tag protein, Flag tag protein, SUMO tag protein, HA tag protein, Myc tag protein, eGFP (enhanced green fluorescent protein), eCFP (enhanced cyan fluorescent protein), eYFP (enhanced yellow-green fluorescent protein), mCherry (monomeric red fluorescent protein) or AviTag tag protein.

[0007] In the protein described in B3) above, the substitution and / or deletion and / or addition of one or several amino acid residues is no more than 10 or 9 or 8 or 7 or 6 or 5 or 4 or 3 or 2 or 1 amino acid residue substitution and / or deletion and / or addition.

[0008] In the protein described in B4) above, the identity refers to the identity of the amino acid sequence. The identity of the amino acid sequence can be determined using a homology search site on the Internet, such as the BLAST page on the NCBI homepage website. The identity includes an amino acid sequence having 80% or more, or 85% or more, or 90% or more, or 91% or more, or 92% or more, or 93% or more, or 94% or more, or 95% or more, or 96% or more, or 97% or more, or 98% or more, or 99% or more identity with the amino acid sequence shown in Sequence 2 of the present invention.

[0009] The protein described in B1) or B2) or B3) or B4) above can be artificially synthesized, or its encoding gene can be synthesized first and then obtained by biological expression.

[0010] In the above application, the substance that regulates the content and / or activity of the CHYR16 protein includes a substance that increases the content and / or activity of the CHYR16 protein or a substance that decreases the content and / or activity of the CHYR16 protein.

[0011] Furthermore, the substance that increases the activity of the CHYR16 protein may be a protein, polypeptide or small molecule compound that enhances or promotes the function of the CHYR16 protein.

[0012] The substance that increases the content of CHYR16 protein may be a substance that promotes the synthesis of CHYR16 protein or inhibits the degradation of CHYR16 protein or overexpresses CHYR16 protein.

[0013] The substance that reduces the activity of CHYR16 protein can be a protein, polypeptide or small molecule compound that inhibits the function of CHYR16 protein.

[0014] The substance that reduces the content of CHYR16 protein can be a substance that inhibits the synthesis of CHYR16 protein, promotes the degradation of CHYR16 protein, inhibits the expression of a gene encoding CHYR16 protein, or knocks out a gene encoding CHYR16 protein.

[0015] Furthermore, the substance that inhibits the expression of the CHYR16 protein encoding gene can be any nucleic acid molecule that can inhibit or interfere with the expression of the above-mentioned CHYR16 protein encoding gene, such as gRNA (such as sgRNA), mRNA, siRNA, dsRNA, shRNA, miRNA, antisense RNA, etc.

[0016] The substance for knocking out the CHYR16 protein encoding gene can be any method that can achieve the host cell not producing CHYR16 A substance that produces a functional protein product of a gene, such as by removing all or part of the coding gene sequence, introducing mutations so that no functional protein is produced, removing or changing regulatory components (such as promoter editing) so that the coding gene sequence is not transcribed, or preventing translation by binding to mRNA. Usually, knockout is performed at the genomic DNA level, so that the offspring of the cell also carry the knockout permanently.

[0017] Furthermore, the substance for knocking out the CHYR16 protein encoding gene can be CHYR16 A gene editing system (such as zinc finger protein ZFN gene editing system, TALENs gene editing system, CRISPR / Cas9 gene editing system) or a T-DNA insertion system in which the gene is mutated (the mutation may be in the form of deletion mutation and / or insertion mutation and / or base substitution) and thus loses its activity.

[0018] In order to solve the above technical problems, the present invention also provides new uses of biomaterials related to CHYR16 protein.

[0019] The present invention provides the use of a biomaterial related to CHYR16 protein in any of the following A1)-A6): A1) Regulate plant stress tolerance; A2) Preparation of products for regulating plant stress tolerance; A3) Cultivating plants with altered stress tolerance; A4) preparing products for breeding plants with altered stress tolerance; A5) Plant breeding; A6) preparing plant breeding products; The biological material is any one of the following E1) to E5): E1) a nucleic acid molecule encoding the above-mentioned CHYR16 protein; E2) a nucleic acid molecule for inhibiting the expression of a CHYR16 protein encoding gene or knocking out a CHYR16 protein encoding gene; E3) an expression cassette containing the nucleic acid molecule described in E1) or E2); E4) a recombinant vector containing the nucleic acid molecule described in E1) or E2), or a recombinant vector containing the expression cassette described in E3); E5) A recombinant microorganism containing the nucleic acid molecule described in E1) or E2), or a recombinant microorganism containing the expression cassette described in E3), or a recombinant microorganism containing the recombinant vector described in E4).

[0020] In the above application, the nucleic acid molecule E1) is any one of the following: F1) DNA molecule shown in Sequence 1 or Sequence 3; F2) A DNA molecule having 75% or more identity with the nucleotide sequence defined in F1) and encoding the above-mentioned CHYR16 protein.

[0021] A person skilled in the art can easily mutate the nucleotide sequence encoding the CHYR16 protein of the present invention by using known methods, such as directed evolution and point mutation. CHYR16Nucleotides with 75% or higher identity of the nucleotide sequence, as long as they encode CHYR16 protein and have the same function, are derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention. The identity refers to the sequence similarity with the natural nucleic acid sequence, including nucleotide sequences with 75% or higher, or 80% or higher, or 85% or higher, or 90% or higher, or 95% or higher identity with the nucleotide sequence of the protein composed of the amino acid sequence shown in the coding sequence 2 of the present invention. The identity can be evaluated by the naked eye or computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0022] The nucleic acid molecule described in E2) above may be gRNA (such as sgRNA), mRNA, siRNA, dsRNA, shRNA, miRNA or antisense RNA.

[0023] Any of the above-mentioned nucleic acid molecules can be DNA, such as cDNA, genomic DNA or recombinant DNA.

[0024] Any of the above-mentioned nucleic acid molecules can be RNA, such as gRNA, mRNA, siRNA, shRNA, sgRNA, miRNA or antisense RNA.

[0025] Any of the above-mentioned expression cassettes may include a promoter, the nucleic acid molecule described in E1) or E2) above, and a terminator. Promoters that can be used in the present invention include, but are not limited to, constitutive promoters, tissue, organ and development-specific promoters, and inducible promoters. Furthermore, the expression cassette may also include an enhancer sequence.

[0026] Any of the above-mentioned vectors refers to a vector that can carry the nucleic acid molecule described in E1) or E2) into the host cell for amplification and expression. The vector can be a cloning vector or an expression vector, including but not limited to: plasmid, phage (such as lambda phage or M13 filamentous phage, etc.), cosmid (i.e., cosmid), Ti plasmid, viral vector (such as retrovirus (including lentivirus), adenovirus, adeno-associated virus, etc.).

[0027] Any of the above-mentioned recombinant vectors refers to a recombinant DNA molecule constructed by connecting the nucleic acid molecule described in E1) or E2) with the vector in vitro. The recombinant vector containing the nucleic acid molecule described in E1) or E2) can be constructed using an existing plant expression vector. The plant expression vector includes a binary Agrobacterium vector and a vector that can be used for plant microprojectile bombardment, such as pAHC25, pBin438, pCAMBIA1302, pCAMBIA2300, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa or pCAMBIA1391-Xb (CAMBIA Company), etc. The plant expression vector may also contain the 3' non-translated region of the foreign gene, i.e., a polyadenylation signal and any other DNA fragments involved in mRNA processing or gene expression. The polyadenylic acid signal can guide the addition of polyadenylic acid to the 3' end of the mRNA precursor, such as the non-translated region transcribed at the 3' end of the Agrobacterium crown gall induction (Ti) plasmid gene (such as the nopaline synthase gene Nos) and the plant gene (such as the soybean storage protein gene) all have similar functions. When using the gene of the present invention to construct a plant expression vector, enhancers can also be used, including translation enhancers or transcription enhancers. These enhancer regions can be ATG start codons or adjacent region start codons, etc., but must be the same as the reading frame of the coding sequence to ensure the correct translation of the entire sequence. The sources of the translation control signal and the start codon are wide-ranging and can be natural or synthetic. The translation start region can come from the transcription start region or the structural gene. In order to facilitate the identification and screening of transgenic plant cells or plants, the plant expression vector used can be processed, such as adding genes that can be expressed in plants and encode enzymes or luminescent compounds that can produce color changes (GUS genes, luciferase genes, etc.), antibiotic marker genes (such as genes that confer resistance to kanamycin and related antibiotics) nptII Gene that confers resistance to the herbicide phosphinothricin bar Gene that confers resistance to the antibiotic hygromycin hph genes, and those conferring resistance to methotrexate dhfr Gene, conferring resistance to glyphosate EPSPS Gene) or chemical resistance marker gene (such as herbicide resistance gene), mannose-6-phosphate isomerase gene that provides the ability to metabolize mannose. Considering the safety of transgenic plants, no selective marker gene can be added, and transformed plants can be directly screened by adversity.

[0028] Any of the above-mentioned microorganisms may be bacteria, fungi, actinomycetes, protozoa, algae or viruses. Among them, the bacteria may be from the genus Escherichia ( Escherichia sp. ), Erwinia ( Erwinia sp. ), Agrobacterium ( Agrobacterium sp.), Flavobacterium ( Flavobacterium sp. )、Alcaligenes spp. Alcaligenes sp. ), Pseudomonas ( Pseudomonas sp. ), Bacillus ( Bacillus sp. ) etc. but not limited thereto, for example, the bacteria may be Escherichia coli ( Escherichia coli )、Bacillus subtilis( Bacillus subtilis ) or Bacillus pumilus ( Bacillus pumilus The fungus may be a yeast, and the yeast may be from the genus Saccharomyces (e.g., Saccharomyces cerevisiae Saccharomyces cerevisiae ), Kluyveromyces (such as Kluyveromyces lactis Kluyveromyces lactis ), Pichia (such as Pichia pastoris Pichia pastoris ), Schizosaccharomyces spp. (e.g. Schizosaccharomyces pombe Schizosaccharomyces pombe ), Hansenula (such as Hansenula polymorpha Hansenula polymorpha ) etc. but not limited thereto. The fungus may also be from the genus Fusarium ( Fusarium sp. ), Rhizoctonia spp. Rhizoctonia sp. ), Verticillium ( Verticillium sp. )、Penicillium( Penicillium sp. )、Aspergillus( Aspergillus sp. )、Cephalosporium( Cephalosporium sp. ) etc. but not limited thereto. The actinomycetes may be from the genus Streptomyces ( Streptomyces sp. ), Nocardia ( Nocardia sp. ), Micromonospora ( Micromonospora sp. ), Neurospora ( Streptosporangium sp. )、Actinomyces spp.( Actinoplanes sp. )、Thermoactinomycetes( Thermoactinomyces sp. ) etc. but not limited thereto. The algae may be from the genus Fucus ( Fucus sp. ), the genus A. Achnanthes sp. ), Cocoon algae ( Amphiprora sp. ), Diplocoriaceae ( Amphora sp. ), Fibrocystis spp. Ankistrodesmus sp. ), Astrophytum ( Asteromonas sp. )、Golden Chromophytes( Boekelovia sp. ) etc. but not limited thereto. The virus may be rotavirus, herpes virus, influenza virus, adenovirus etc. but not limited thereto.

[0029] Any of the above-mentioned recombinant microorganisms refers to a recombinant microorganism with a changed function obtained by operating and modifying the genes of the target microorganism. For example, a recombinant microorganism obtained by introducing the above-mentioned recombinant vector into the target microorganism. The recombinant microorganism can be understood to refer not only to a specific recombinant microorganism, but also to the offspring of such a cell, and due to natural, accidental or intentional mutations and / or changes, the offspring may not be completely identical to the original parent cell, but is still included in the scope of the recombinant microorganism.

[0030] In the above application, the regulation of plant stress tolerance is to increase plant stress tolerance or reduce plant stress tolerance; specifically, when the CHYR16 protein content and / or activity in the plant is increased, the plant stress tolerance is reduced; when the CHYR16 protein content and / or activity in the plant is reduced or absent, the plant stress tolerance is increased.

[0031] Furthermore, the stress resistance is salt-alkali resistance, and specifically, the salt-alkali resistance is NaHCO3 stress resistance.

[0032] In certain embodiments, when the expression level of the CHYR16 gene in the plant is increased, the degree of leaf wilting increases, the degree of leaf NBT staining becomes darker, the degree of leaf DAB staining becomes darker, and the seed germination rate decreases under NaHCO3 stress.

[0033] In the above application, the purpose of the plant breeding is to cultivate salt-alkali tolerant plant varieties.

[0034] In order to solve the above technical problems, the present invention also provides a method for cultivating transgenic plants with reduced stress tolerance.

[0035] The method for cultivating transgenic plants with reduced stress tolerance provided by the present invention comprises the following steps: increasing the content and / or activity of CHYR16 protein in target plants to obtain transgenic plants; the stress tolerance of the transgenic plants is lower than that of the target plants.

[0036] In the above method, the method for increasing the content and / or activity of CHYR16 protein in the target plant is to overexpress CHYR16 protein in the target plant.

[0037] Furthermore, the overexpression method is to introduce the gene encoding the CHYR16 protein into the target plant.

[0038] Furthermore, the nucleotide sequence of the gene encoding the CHYR16 protein is shown in Sequence 1.

[0039] In the above method, the stress resistance is salt-alkali resistance, and the salt-alkali resistance includes salt resistance and / or alkali resistance. Specifically, the salt-alkali resistance is NaHCO3 stress resistance.

[0040] The stress tolerance of the transgenic plant is lower than that of the target plant, which is embodied in any one of the following X1)-X4): X1) under NaHCO3 stress, the degree of leaf wilting of the transgenic plant is higher than that of the target plant; X2) Under NaHCO3 stress, the NBT staining degree of the leaves of the transgenic plant is deeper than that of the target plant; X3) Under NaHCO3 stress, the DAB staining degree of the leaves of the transgenic plant is deeper than that of the target plant; X4) Under NaHCO3 stress, the seed germination rate of the transgenic plant is lower than that of the target plant.

[0041] In certain embodiments, the NaHCO 3 stress is 8 mM stress, 10 mM stress, or 60 mM NaHCO 3 stress.

[0042] In order to solve the above technical problems, the present invention finally provides a method for cultivating transgenic plants with improved stress tolerance.

[0043] The method for cultivating transgenic plants with improved stress tolerance provided by the present invention comprises the following steps: reducing the content and / or activity of CHYR16 protein in target plants to obtain transgenic plants; the stress tolerance of the transgenic plants is higher than that of the target plants.

[0044] In the above method, the method for reducing the content and / or activity of CHYR16 protein in the target plant comprises introducing the above substance for reducing the content and / or activity of CHYR16 protein into the target plant.

[0045] In the above method, the stress resistance is salt-alkali resistance, including salt resistance and / or alkali resistance. Specifically, the salt-alkali resistance is NaHCO3 stress resistance.

[0046] In any of the above applications or methods, the transgenic plant not only comprises CHYR16 The first generation of transgenic plants obtained by gene transformation of the recipient plant also includes its progeny. For transgenic plants, the gene can be propagated in the species, or the gene can be transferred into other varieties of the same species using conventional breeding techniques, especially including commercial varieties. The transgenic plants include seeds, callus, complete plants and cells.

[0047] In any of the above uses or methods, the plant may be a dicotyledonous plant or a monocotyledonous plant.

[0048] Furthermore, the plant is a dicotyledonous plant.

[0049] Furthermore, the dicotyledonous plant is soybean (such as wild-type soybean Jack) or Arabidopsis thaliana (Columbia ecotype col-0).

[0050] The present invention is achieved by overexpressing in soybean or Arabidopsis CHYR16 , construct CHYR16 Overexpression of soybean and CHYR16 Overexpression of Arabidopsis thaliana CHYR16 Overexpression of soybean and CHYR16Analysis of the salt-alkaline tolerance of overexpressed Arabidopsis revealed that compared with the recipient plants, CHYR16 Overexpression of soybean and CHYR16 Overexpression of Arabidopsis thaliana reduces its tolerance to carbonate stress. The present invention first discovered that CHYR16 protein can regulate plant salt-alkali tolerance, laying a foundation for breeding salt-alkali tolerant plant varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0051] Figure 1 for CHYR16 Analysis of expression patterns under salt-alkali stress. CHYR16 The gene expression level was taken as 1, and all data were expressed as mean ± standard error (n = 3). Oneway ANOVA test was used to calculate the p value, and significant differences were indicated by different lowercase letters (p < 0.05).

[0052] Figure 2 Construction and expression verification of CHYR16-3Flag fusion expression vector. A: PCR identification of CHYR16-3Flag colonies; M: DNA Marker; -: ddH2O negative control; +: plasmid positive control; 1-5: single colonies. B: Western Blot detection of CHYR16-3Flag protein expression; M: protein marker; +: MKK3-3Flag protein positive control; WT: uninjected tobacco protein negative control; 1-3: CHYR16-3FLAG injected 48, 60, 70 hours protein samples.

[0053] Figure 3 for CHYR16 PCR detection of composite plants overexpressing soybean hairy roots.

[0054] Figure 4 for CHYR16 Analysis of NaHCO3 stress tolerance in composite plants overexpressing soybean hairy roots. A: CHYR16 Growth status of overexpressed soybean hairy roots under NaHCO3 stress. B: CHYR16 NBT staining of leaves of composite plants overexpressing soybean hairy roots. C: CHYR16 DAB staining of leaves of composite plants overexpressing soybean hairy roots.

[0055] Figure 5 for CHYR16 PCR detection of overexpressing Arabidopsis lines.

[0056] Figure 6 for CHYR16 RT-PCR detection of overexpressing Arabidopsis lines.

[0057] Figure 7 for CHYR16Seed germination test of overexpressing Arabidopsis strains under NaHCO3 stress. A: Growth status of Arabidopsis seedlings on medium with different NaHCO3 concentrations. B: Seed germination rate on 0 mM NaHCO3 medium. C: Seed germination rate on 8 mM NaHCO3 medium. D: Seed germination rate on 10 mM NaHCO3 medium. DETAILED DESCRIPTION

[0058] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0059] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0060] The pCAMBIA1300-3Flag vector in the following examples is described in the document “Construction and identification of Arabidopsis thaliana AtIDD4 and 3×Flag fusion protein expressing plants”.

[0061] The Agrobacterium tumefaciens GV3101+P19 in the following examples is described in the literature "Development of an Agrobacterium-mediated CRISPR / Cas9 gene editing system in jute ( Corchorus capsularis )"middle.

[0062] The Agrobacterium rhizogenes K599 used in the following examples is described in the document “Soybean Hairy Root Transformation: A Rapid and Highly Efficient Method”.

[0063] The soybean variety "Dongnong 50" in the following examples is recorded in the document "Effects of DREB-transgenic soybean Dongnong 50 on the number and biochemical intensity of soil nitrogen-converting bacteria".

[0064] Embodiment 1, CHYR16 Analysis of expression patterns under saline-alkali stress Soybean (Dongnong 50) seedlings at the three-leaf stage were treated with NaHCO3. Without the influence of rhythm, leaves at the same position were taken at 0 h, 1 h, 3 h and 6 h of treatment, and total RNA was extracted by Trizol method. Then, cDNA was obtained by reverse transcription using the reverse transcription kit HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) (Vazyme, R312). The obtained cDNA was diluted 10 times, and the diluted cDNA was used as a template, and primers CHYR16-qRT-F and CHYR16-qRT-R were used for fluorescence quantitative PCR. At the same time, soybean ubiquitin gene (ubiquitin B, GmUB3) was used as an internal reference gene. The primer sequences used for detection are as follows: CHYR16-qRT-F: 5'-GTACCATTGCAGTGGCTGTG-3'; CHYR16-qRT-R:5'-CAAGCAGAGAGGGCACGAAT-3'; GmUB3-RT-F: 5'-GTGTAATGTTGGATGTGTTCCC-3'; GmUB3-RT-R: 5'-ACACAATTGAGTTCAACACAAACCG-3'.

[0065] The qRT-PCR test results are as follows Figure 1 The results showed that after 1 h of cold stress at 4°C, the expression level of CHYR16 decreased significantly to 1 / 5 of that at 0 h, and then maintained a low expression level. CHYR16 The expression of was inhibited by saline-alkali stress and may be involved in the response to saline-alkali stress.

[0066] Embodiment 2, CHYR16 Construction of composite plants overexpressing soybean hairy roots and analysis of their salt-alkaline tolerance I. CHYR16 Construction of composite plants overexpressing soybean hairy roots 1 、CHYR16 Construction of soybean overexpression vector (1) Using the cDNA in Example 1 as a template, using CHYR16-3FLAG-F and CHYR16-3FLAG-R primers, and using the high-fidelity DNA polymerase KOD One TM PCR Master Mix-Blue (TOYOBO) was used for PCR amplification to obtain the PCR product ( CHYR16 Gene CDS sequence). The primer sequences are as follows: CHYR16-3FLAG-F: 5'-GAGCTCGGTACCCGGGGATCCATGGGAGAAGTGGCAGTAAT-3'; CHYR16-3FLAG-R: 5'-CTTGTAGTCTCCGCCACTAGtTGTTTGTCGTGTATTGTAGGATTTGCA-3'.

[0067] (2) Use restriction endonucleases BamHI and SpeI The pCAMBIA1300-3Flag vector was double-digested to obtain a digested vector; then the digested vector was connected to the PCR product obtained in step 1 using DNA recombinase Exnase II to obtain a connection product.

[0068] (3) The ligation product was transformed into Escherichia coli (DH5α), and the positive colonies were identified by PCR. The PCR identification results were as follows: Figure 2 As shown in A, the results showed that recombinant bacteria No. 1-5 all had bands of the same size as the positive control between 750-1000 bp. After activation, the plasmids were extracted and sent for sequencing, and the vector with the correct sequencing was named the recombinant expression vector pCAMBIA1300-CHYR16-3FLAG.

[0069] The sequencing results showed that the recombinant expression vector pCAMBIA1300-CHYR16-3FLAG was a BamHI and SpeI The DNA fragment between the restriction sites is replaced with the one shown in sequence 1 CHYR16 The vector was obtained by removing the CDS sequence and keeping the other sequences of the pCAMBIA1300-3Flag vector unchanged.

[0070] 2. Expression of pCAMBIA1300-CHYR16-3FLAG by injection into tobacco leaves (1) The recombinant expression vector pCAMBIA1300-CHYR16-3FLAG obtained in step 1 was transformed into Agrobacterium tumefaciens GV3101+P19 by freeze-thaw method, and the positive single clone Agrobacterium colony was reactivated (overnight culture at 28°C and 180 rpm) to obtain the activated bacterial solution.

[0071] (2) The activated bacterial suspension was transferred to 20 mL LB resistance liquid medium at a dilution of 1:1000 and 20 μM AS (acetosyringone) was added to the medium. When the Agrobacterium tumefaciens live bacterial suspension was activated to OD 600=0.6-0.8, centrifuge the bacterial solution at 4000 rpm for 10 min and remove the supernatant; then resuspend the bacteria in Infiltration buffer (10 mM MES + 150 μM AS + 10 mM MgCl2) and measure the OD of the resuspended solution. 600 Value, adjust OD 600 =1.

[0072] (3) Place the resuspended bacterial solution at room temperature and away from light for 2 h. When injecting, use a needle to poke a small hole on the back of the tobacco leaf. Aim the syringe without the needle at the small hole. Use your other hand to gently block the syringe and the small hole through the leaf. Push the piston and inject the bacterial solution into the leaf. After injection, keep the tobacco moist and return it to the culture room.

[0073] (4) Samples were collected 2 days after injection, and total protein was extracted using Tris-HCl lysis buffer. Western Blot was then performed using Anti-Flag antibody to detect the expression of pCAMBIA1300-CHYR16-3FLAG protein.

[0074] The results are as follows Figure 2 As shown in B, the results show that Rubisco signals can be detected in all lanes. CHYR16-3Flag protein signals were detected around 40 kDa using Anti-Flag antibody, which is similar to the predicted size of CHYR16-3Flag protein 34.6 kDa, and no protein signal was detected in the negative control (tobacco leaves without bacterial injection), indicating that the protein signal is the CHYR16-3Flag protein signal and CHYR16-3Flag is successfully expressed in tobacco leaves.

[0075] two, CHYR16 Obtaining and identifying composite plants overexpressing soybean hairy roots 1. CHYR16 Obtaining composite plants overexpressing soybean hairy roots The recombinant expression vector pCAMBIA1300-CHYR16-3FLAG was transformed into the cotyledons of soybean seedlings of soybean variety "Dongnong 50" by Agrobacterium-mediated method. CHYR16 Overexpression of soybean hairy root composite plants. The specific steps are as follows: (1) The recombinant expression vector pCAMBIA1300-CHYR16-3FLAG obtained in step 1 was transformed into Agrobacterium rhizogenes K599 using the freeze-thaw method, and the positive single clone Agrobacterium colony was reactivated (overnight culture at 28°C and 180 rpm) to obtain the activated bacterial liquid.

[0076] (2) The activated bacterial suspension was transferred to 20 mL LB resistance liquid medium at a dilution of 1:1000 and 20 μM AS (acetosyringone) was added to the medium. When the Agrobacterium tumefaciens live bacterial suspension was activated to OD 600 =0.6-0.8, centrifuge the bacterial solution at 4000 rpm for 10 min and remove the supernatant; then resuspend the bacteria in Infiltration buffer (10 mM MES + 150 μM AS + 10 mM MgCl2) and measure the OD of the resuspended solution. 600 Value, adjust OD 600 =1.

[0077] (3) Place the resuspended bacterial solution at room temperature and away from light for 2 h; when injecting, pierce the main stem of the soybean seedling "Dongnong 50" 1 cm from the cotyledon with a 1 mL needle and inject the resuspended bacterial solution into the wound. Repeat twice. After injection, evenly distribute it in a pot with vermiculite as the matrix, cover it with film and culture it overnight in the dark. The next day, culture it under light and water it once every 3 days with 1 / 4 Hoagland nutrient solution (calcium nitrate 945 mg / L, potassium nitrate 607 mg / L, ammonium phosphate 115 mg / L, magnesium sulfate 493 mg / L, iron salt solution 2.5 mL / L, trace element solution 5 mL / L, pH=6.0) to keep it moist. After 3 weeks of culture, CHYR16 -3Flag overexpressing soybean hairy root composite plants.

[0078] According to the above method, the recombinant expression vector pCAMBIA1300-CHYR16-3FLAG was replaced with the pCAMBIA1300-3FLAG empty vector to obtain the EV-3Flag empty vector soybean hairy root composite plants.

[0079] 2. CHYR16 Identification of composite plants overexpressing soybean hairy roots Ten strains were randomly selected from each pot to extract hairy root DNA, and PCR identification was performed using CHYR16-F and empty vector universal primers (CHYR16-F: AGGTACCCATGGGAGAAGTGGCA; empty vector universal primer: GGCGCCTGAGATCTAGA). At the same time, the recombinant plasmid pCAMBIA1300-CHYR16-3FLAG was used as a positive control and ddH2O as a negative control.

[0080] The results are as follows Figure 3 The results showed that pCAMBIA1300-CHYR16-3FLAG was used as the positive control to amplify a band of about 1500 bp. CHYR16The target band with the same size as the positive control was detected in the soybean hairy roots overexpressing EV-3Flag; the target band was not amplified in the ddH2O negative control and the soybean hairy roots with EV-3Flag empty vector, indicating that the infection efficiency of soybean hairy roots was high and there was no contamination with the empty vector, so phenotypic experiments could be carried out.

[0081] three, CHYR16 Analysis of salt-alkaline tolerance in composite plants overexpressing soybean hairy roots Test materials: CHYR16 -3Flag overexpressing soybean hairy root composite plants (abbreviated as CHYR16 -3Flag) and EV-3Flag empty vector soybean hairy root composite plants (EV-3Flag).

[0082] Experimental method: The soybean hairy root composite plants were treated with 60 mM NaHCO3. The specific treatment method was as follows: the composite plants were placed in 1 / 4 Hoagland nutrient solution (calcium nitrate 945 mg / L, potassium nitrate 607 mg / L, ammonium phosphate 115 mg / L, magnesium sulfate 493 mg / L, iron salt solution 2.5 mL / L, trace element solution 5 mL / L, pH=6.0) containing 60 mM NaHCO3, and cultured under the conditions of a photoperiod of 14 h light / 10 h dark, a temperature of 28℃ / 25℃, and a humidity of 60%. The treatment solution was replaced every 3 days, and the phenotype was observed 7 and 9 days after the treatment, respectively.

[0083] The results are as follows Figure 4 As shown in A, the results showed that before NaHCO3 treatment, the growth of EV-3Flag and CHYR16-3Flag soybean hairy root composite plants was basically the same; after 7 and 9 days of 60 mM NaHCO3 treatment, the leaves of CHYR16-3Flag soybean seedlings wilted severely and even died, while EV-3Flag soybean seedlings showed a relatively healthy growth state. CHYR16 Overexpression reduced the salt-alkaline tolerance of soybean hairy root composite plants.

[0084] To further analyze the damage of soybean leaves under NaHCO3 stress, NBT staining and DAB staining were performed on detached leaves of EV-3Flag and CHYR16-3Flag soybean seedlings treated with 0 mM and 60 mM NaHCO3 for 4 days.

[0085] The specific steps of NBT staining are as follows: take soybean seedling leaves treated with 60 mM NaHCO3 for 4 days and place them in NBT staining solution (100 mg NBT powder dissolved in 100 mL phosphate buffer (pH=7.8), add 5 μL Triton-X100, and store at 4°C away from light). After vacuuming for 1 min, stain in the dark for 6 h. Decolorize in a boiling water bath with decolorizing solution (60% anhydrous ethanol, 20% glycerol, 20% acetic acid) until the decolorizing solution no longer changes color, and take pictures with a camera to record.

[0086] The specific steps of DAB staining are as follows: take soybean seedling leaves treated with 60 mM NaHCO3 for 4 days and place them in DAB staining solution (1 mg DAB powder dissolved in 1 mL distilled water, prepared and used immediately, stored in the dark), evacuate for 1 min and then stain overnight in the dark, decolorize in a boiling water bath with decolorizing solution (60% anhydrous ethanol, 20% glycerol, 20% acetic acid) until the decolorizing solution no longer changes color, and take pictures with a camera to record.

[0087] The results are as follows Figure 4 As shown in B and 4C, the results showed that the leaves of soybean seedlings treated with 0 mM NaHCO3 were lighter in staining, and there was no significant difference between EV-3Flag and CHYR16-3Flag; after treatment with 60 mM NaHCO3, the staining of EV-3Flag and CHYR16-3Flag leaves was significantly deepened, and the staining degree of CHYR16-3Flag leaves was darker than that of EV-3Flag leaves.

[0088] The above results show that under NaHCO3 treatment, CHYR16 The leaves of soybean hairy root overexpressing plants were more severely damaged. CHYR16 Negative regulation of tolerance of soybean hairy root composite plants to NaHCO3 stress.

[0089] Embodiment 3, CHYR16 Construction of overexpressed Arabidopsis thaliana and analysis of its salt-alkaline tolerance one, CHYR16 Construction of Arabidopsis thaliana overexpression 1. The recombinant expression vector pCAMBIA1300- CHYR16 -3FLAG was transformed into Agrobacterium tumefaciens LBA4404, and the colony PCR was positive, indicating that the recombinant expression vector pCAMBIA1300- CHYR16 -3FLAG was successfully transferred into Agrobacterium, and the positive recombinant bacteria were recorded as pCAMBIA1300- CHYR16 -3FLAG / LBA4404.

[0090] 2. The recombinant bacteria pCAMBIA1300-CHYR16 -3FLAG / LBA4404 infects wild-type Arabidopsis thaliana (Columbia ecotype), CHYR16 The gene was overexpressed in Arabidopsis to obtain T0 transgenic Arabidopsis. The harvested T0 transgenic Arabidopsis seeds were sterilized with NaClO and then planted on 1 / 2MS solid screening medium containing 25 mg / L Hyg. The overexpressed transgenic Arabidopsis with Hyg resistance screened out was transferred to soil for culture and marked as different strains. When harvesting seeds, each plant was harvested separately.

[0091] 3. The genomic DNA of wild-type Arabidopsis thaliana (WT) and T1 transgenic Arabidopsis thaliana with Hyg resistance were extracted using the EasyPure genomic DNA extraction kit from Quanshijin Company. CHYR16 The specific primers used for full-length gene cloning were used for PCR detection. At the same time, ddH2O was used as a negative control and the positive plasmid pCAMBIA1300- CHYR16 -3FLAG was used as a positive control.

[0092] The results are as follows Figure 5 The results showed that: when no band was amplified in the negative control using ddH2O instead of template and wild-type Arabidopsis as template, and a band of about 900 bp was amplified in the positive control, a band of the same size as the positive control was amplified in the transgenic Arabidopsis, indicating that CHYR16 The gene has been integrated into the Arabidopsis genome.

[0093] 4. Sow the T1 seeds of each strain on 1 / 2 MS screening medium containing 25 mg / L Hyg, and transfer the transgenic Arabidopsis thaliana with Hyg resistance to soil for cultivation. Repeat the screening for 2-3 generations until a homozygous strain is screened out for each strain. Extract the total RNA of wild-type Arabidopsis thaliana (WT) and homozygous transgenic Arabidopsis thaliana strains, and use the reverse transcription products diluted 5 times as templates and specific primers for RT-PCR detection. Actin2 The gene was used as an internal reference.

[0094] The results are as follows Figure 6 As shown, the results show that: Actin2 When the brightness of the amplified bands is basically the same, CHYR16 PCR amplification was performed using gene-specific primers. Electrophoresis analysis of PCR products showed that no band products were amplified when wild-type Arabidopsis cDNA was used as a template. CHYR16 All transgenic Arabidopsis lines can amplify bands, indicating that CHYR16 It can be transcribed normally in transgenic Arabidopsis and can be used for subsequent experiments. CHYR16The homozygous transgenic Arabidopsis lines CHYR16-OX#3 and CHYR16-OX#5 were used for the following salt-alkaline tolerance analysis.

[0095] two, CHYR16 Analysis of salt-alkaline tolerance in overexpressed Arabidopsis Test materials: Wild-type Arabidopsis thaliana (WT), CHYR16 Overexpression Arabidopsis lines CHYR16-OX#3 and CHYR16-OX#5.

[0096] Experimental method: Select wild-type Arabidopsis thaliana with full and uniform vitality, CHYR16 Seeds of the overexpressing Arabidopsis lines CHYR16-OX#3 and CHYR16-OX#5 were sterilized with 5% NaClO for 5 min under sterile conditions, washed repeatedly with sterile water to remove NaClO, placed in a 4°C refrigerator for 2 days, and then sown in normal 1 / 2MS medium and 1 / 2MS medium containing 8 mM or 10 mM NaHCO3, respectively. After culturing at 22°C for 10 days, the growth of seedlings was observed and the seed germination rate was counted. The experiment was repeated three times, and 30 plants were used for each treatment and each line.

[0097] The results are as follows Figure 7 The results showed that in 1 / 2 MS medium containing 0 mM NaHCO3, wild-type Arabidopsis and CHYR16 The overexpressing Arabidopsis lines all germinated and grew normally, with no significant difference in germination rate and seedling growth. On 1 / 2 MS medium containing 8 mM and 10 mM NaHCO3, wild-type Arabidopsis and CHYR16 The germination of seeds of overexpressing Arabidopsis thaliana was significantly inhibited, but the germination rate of seeds of wild-type Arabidopsis thaliana was significantly higher than CHYR16 Overexpressing Arabidopsis lines, CHYR16 The growth of overexpressed Arabidopsis seedlings was significantly worse than that of wild-type Arabidopsis. The germination rate of wild-type Arabidopsis seeds was almost 100%, while CHYR16 The seed germination rates of overexpressing Arabidopsis strains were less than 80%.

[0098] The above results show that overexpression of CHYR16 The gene reduces NaHCO3 stress tolerance in Arabidopsis thaliana.

[0099] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. Use of CHYR16 protein or a substance for regulating the content and / or activity of CHYR16 protein in any of the following A1)-A6): A1) Regulate plant stress tolerance; A2) Preparation of products for regulating plant stress tolerance; A3) Cultivating plants with altered stress tolerance; A4) preparing products for breeding plants with altered stress tolerance; A5) Plant breeding; A6) preparing plant breeding products; The CHYR16 protein is any one of the following B1)-B4): B1) The amino acid sequence is the protein shown in SEQ ID NO:2; B2) A fusion protein having the same function obtained by connecting a tag to the N-terminus and / or C-terminus of the amino acid sequence shown in SEQ ID NO: 2; B3) A protein having the same function obtained by replacing and / or deleting and / or adding one or more amino acid residues in the amino acid sequence shown in SEQ ID NO: 2; B4) A protein that has 80% or more identity with the amino acid sequence shown in SEQ ID NO: 2 and has the same function.

2. Use of the biological material related to the CHYR16 protein in claim 1 in any of the following A1)-A6): A1) Regulate plant stress tolerance; A2) Preparation of products for regulating plant stress tolerance; A3) Cultivating plants with altered stress tolerance; A4) preparing products for breeding plants with altered stress tolerance; A5) Plant breeding; A6) preparing plant breeding products; The biological material is any one of the following E1) to E5): E1) a nucleic acid molecule encoding the CHYR16 protein of claim 1; E2) a nucleic acid molecule that inhibits the expression of the gene encoding the CHYR16 protein of claim 1 or knocks out the gene encoding the CHYR16 protein of claim 1; E3) an expression cassette containing the nucleic acid molecule described in E1) or E2); E4) a recombinant vector containing the nucleic acid molecule described in E1) or E2), or a recombinant vector containing the expression cassette described in E3); E5) a recombinant microorganism containing the nucleic acid molecule described in E1) or E2), or a recombinant microorganism containing the expression cassette described in E3), or a recombinant microorganism containing the recombinant vector described in E4); The CHYR16 protein is any one of the following B1)-B4): B1) The amino acid sequence is the protein shown in SEQ ID NO:2; B2) A fusion protein having the same function obtained by connecting a tag to the N-terminus and / or C-terminus of the amino acid sequence shown in SEQ ID NO: 2; B3) A protein having the same function obtained by replacing and / or deleting and / or adding one or more amino acid residues in the amino acid sequence shown in SEQ ID NO: 2; B4) A protein that has 80% or more identity with the amino acid sequence shown in SEQ ID NO: 2 and has the same function.

3. The use according to claim 2, characterized in that: E1) The nucleic acid molecule is any of the following: F1) DNA molecule shown in Sequence 1 or Sequence 3; F2) A DNA molecule having 75% or more identity with the nucleotide sequence defined in F1) and encoding the CHYR16 protein.

4. The use according to any one of claims 1 to 3, characterized in that: The stress resistance is salt and alkali resistance.

5. A method for cultivating a transgenic plant with reduced stress tolerance, comprising the following steps: increasing the content and / or activity of CHYR16 protein in a target plant to obtain a transgenic plant; the stress tolerance of the transgenic plant is lower than that of the target plant; The CHYR16 protein is any one of the following B1)-B4): B1) The amino acid sequence is the protein shown in SEQ ID NO:2; B2) A fusion protein having the same function obtained by connecting a tag to the N-terminus and / or C-terminus of the amino acid sequence shown in SEQ ID NO: 2; B3) A protein having the same function obtained by replacing and / or deleting and / or adding one or more amino acid residues in the amino acid sequence shown in SEQ ID NO: 2; B4) A protein that has 80% or more identity with the amino acid sequence shown in SEQ ID NO: 2 and has the same function.

6. The method according to claim 5, characterized in that: The stress resistance is salt and alkali resistance.

7. The method according to claim 5 or 6, characterized in that: The method for increasing the content and / or activity of CHYR16 protein in the target plant is to overexpress CHYR16 protein in the target plant.

8. The method according to claim 7, characterized in that: The overexpression method is to introduce the coding gene of CHYR16 protein into the target plant.

9. A method for cultivating a transgenic plant with improved stress tolerance, comprising the following steps: reducing the content and / or activity of CHYR16 protein in a target plant to obtain a transgenic plant; the transgenic plant has higher stress tolerance than the target plant; The CHYR16 protein is any one of the following B1)-B4): B1) The amino acid sequence is the protein shown in SEQ ID NO:2; B2) A fusion protein having the same function obtained by connecting a tag to the N-terminus and / or C-terminus of the amino acid sequence shown in SEQ ID NO: 2; B3) A protein having the same function obtained by replacing and / or deleting and / or adding one or more amino acid residues in the amino acid sequence shown in SEQ ID NO: 2; B4) A protein that has 80% or more identity with the amino acid sequence shown in SEQ ID NO: 2 and has the same function.

10. The use according to any one of claims 1 to 4 or the method according to any one of claims 5 to 9, characterized in that: The plant is a dicotyledonous plant or a monocotyledonous plant.

Images