Method for promoting polarization and phagocytosis of macrophages by using nicotine and application

Abstract

The invention belongs to the technical field of biological medicines, and particularly relates to a method for promoting polarization and phagocytosis of macrophages by using nicotine and application. It is found that 10 [mu] M nicotine promotes polarization of macrophages to M1 type macrophages and M2 type macrophages, the macrophages are induced to generate proinflammatory factors to regulate the functions of the macrophages, and phagocytosis of the macrophages is enhanced. The invention provides a new method for inducing polarization of macrophages, promoting the macrophages to generate pro-inflammatory cytokines and promoting phagocytosis of the macrophages, and provides a new idea for the new function and application of nicotine which is a tobacco active ingredient.

Description

Technical Field

[0001] The invention belongs to the field of biomedicine and relates to a method and application of promoting macrophage polarization and phagocytosis by utilizing nicotine. Background Art

[0002] Tobacco is a natural plant with complex components. The smoke produced after tobacco combustion contains more than 7,000 chemical components, and the functions of many substances have not yet been clarified. Nicotine is a tobacco component that has been studied relatively deeply in the cell signaling process. After smoking, the nicotine concentration in plasma increases rapidly and can reach 300nM. [1] Nicotine enters various tissues and organs throughout the body through blood circulation, can pass through the blood-brain barrier into the cerebrospinal fluid, and act on nicotinic acetylcholine receptors.

[0003] There have been a lot of studies on the effects of nicotine on the nervous system. Due to the extremely high blood concentration and the lack of endogenous enzymes to degrade it, the receptors are activated for a long time and eventually desensitized, leading to cognitive impairment, etc. [2] In recent years, nicotine has received increasing attention for its beneficial health effects. Researchers have found that nicotine has a certain effect on improving memory. [3] , regulating the release of neurotransmitters and neurotrophic factors, and anti-apoptotic neuroprotective effects, etc. [4] Nicotine has a certain preventive and therapeutic effect on Parkinson's disease (PD) and Alzheimer's disease (AD). Interestingly, healthy non-smokers and Alzheimer's patients showed better cognitive abilities after short-term nicotine intake. [5] .

[0004] However, little is known about the effects of nicotine on other functions of the human body, especially immune function. Among immune cells, macrophages are the first line of defense of the innate immune system. As the core part of maintaining tissue homeostasis, wound healing, muscle regeneration and limb regeneration, macrophages play a variety of phagocytic, endocytic and secretory roles. The functional evaluation of macrophages includes macrophage typing, cell membrane surface marker expression, cytokine secretion and metabolic pathways. Among them, M1 macrophages can be induced by resting M0 macrophages to polarize into M1 macrophages under the stimulation of LPS or LPS / IFNγ, and secrete pro-inflammatory factors (IL-1, IL-6, TNF, etc.); M2 macrophages can be induced by resting M0 macrophages to polarize into M2 macrophages under the stimulation of IL-4, and secrete anti-inflammatory factors (IL-10, TGFB1). M1 macrophages have strong bactericidal and phagocytic functions, eliminating foreign pathogens or tumor cells in the body. M2 macrophages play an important role in angiogenesis, anti-inflammation, tissue repair, etc., and antagonize M1 macrophages. Whether to affect the polarization process of macrophages and regulate the homeostasis of macrophage polarization is the key breakthrough in treatment.

[0005] [1]RUSSELL MA,WILSON C,PATEL UA,et al.1975.Plasma nicotine levelsafter smoking cigarettes with high,medium,and low nicotine yields.Br Med J[J],2:414-416.

[0006] [2]VALENTINE G,SOFUOGLU M 2018.Cognitive Effects of Nicotine:RecentProgress.Curr Neuropharmacol[J],16:403-414.

[0007] [3]REZVANI AH,LEVIN ED 2001.Cognitive effects of nicotine.BiolPsychiatry[J],49:258-267.

[0008] [4] SEROVAL, SABBAN EL 2002. Involvement of alpha 7nicotinicacetylcholine receptors in gene expression of dopamine biosynthetic enzymes in rat brain. J Pharmacol Exp Ther[J], 303:896-903.

[0009] [5]MIHAILESCU S,DRUCKER-COLIN R 2000. Nicotine, brain nicotinicreceptors, and neuropsychiatric disorders. Arch Med Res[J], 31:131-144. Summary of the invention

[0010] Based on the above shortcomings, the present invention provides a method and application of using nicotine to promote macrophage polarization and phagocytosis. The present invention found that 10 μM nicotine regulates macrophage function by promoting macrophage polarization to M1 macrophages and M2 macrophages, inducing macrophages to produce pro-inflammatory factors, and enhancing macrophage phagocytosis. The present invention provides a new method for inducing macrophage polarization, promoting macrophages to produce pro-inflammatory cytokines, and promoting macrophage phagocytosis, and provides new ideas for the new functions and applications of nicotine, a tobacco active ingredient.

[0011] The technical solution of the present invention includes:

[0012] In a first aspect, the present invention provides a method for promoting macrophage polarization using nicotine, wherein the nicotine concentration is 10 μM.

[0013] Specifically, the promotion of macrophage polarization is promoting the polarization of macrophages into M1 macrophages and M2 macrophages.

[0014] Preferably, the typing ratios of M1 macrophages and M2 macrophages are 81.7% and 73.9%.

[0015] Specifically, the nicotine promotes the expression of pro-inflammatory cytokines in macrophages.

[0016] Preferably, the macrophage pro-inflammatory cytokines include one or more of TNF-α and IL-6.

[0017] Preferably, the nicotine promotes macrophage phagocytosis.

[0018] In a second aspect, the present invention provides a method for promoting macrophage polarization using a drug containing nicotine, wherein the concentration of nicotine in the drug is 10 μM.

[0019] Specifically, the promotion of macrophage polarization is promoting the polarization of macrophages into M1 macrophages and M2 macrophages.

[0020] Preferably, the typing ratios of M1 macrophages and M2 macrophages are 81.7% and 73.9%.

[0021] Specifically, the drug promotes the expression of pro-inflammatory cytokines in macrophages.

[0022] Preferably, the macrophage pro-inflammatory cytokines include one or more of TNF-α and IL-6.

[0023] Preferably, the drug promotes macrophage phagocytosis.

[0024] Specifically, in the drug, nicotine is used as the only or main active ingredient in the preparation.

[0025] Specifically, the medicine also includes other active ingredients.

[0026] Preferably, the other active ingredients include one or more of N-type acetylcholine receptor, LPS, IL-4, and IL-10.

[0027] Specifically, the drug is an anti-tumor drug or an anti-autoimmune disease drug.

[0028] Specifically, the medicine also includes pharmaceutically acceptable excipients.

[0029] Preferably, the pharmaceutically acceptable excipients include one or more of a filler, a binder, a disintegrant, a lubricant, a stabilizer, a surfactant, an antioxidant, a pH adjuster or a preservative.

[0030] Preferably, the pharmaceutically acceptable excipient is at least one of lactose, mannose, mannitol, trehalose, starch, gum arabic, calcium phosphate, alginate, gelatin, calcium silicate, cross-linked polyvinylpyrrolidone, sodium carboxymethyl starch, cellulose, water, syrup, methylcellulose, methyl hydroxybenzoate, propyl hydroxybenzoate, magnesium stearate, mineral oil, vitamin C, vitamin E, citric acid, phosphoric acid, sodium benzoate, potassium sorbate, Tween-80, poloxamer, glutamic acid and glycine.

[0031] In a third aspect, the present invention provides use of nicotine in promoting macrophage polarization, wherein the nicotine concentration is 10 μM.

[0032] Specifically, the promotion of macrophage polarization is promoting the polarization of macrophages into M1 macrophages and M2 macrophages.

[0033] Preferably, the typing ratios of M1 macrophages and M2 macrophages are 81.7% and 73.9%.

[0034] Specifically, the nicotine promotes the expression of pro-inflammatory cytokines in macrophages.

[0035] Preferably, the macrophage pro-inflammatory cytokines include one or more of TNF-α and IL-6.

[0036] Preferably, the nicotine promotes macrophage phagocytosis.

[0037] The beneficial effects of the present invention are:

[0038] The present invention found that 10 μM nicotine regulates macrophage function by promoting macrophage polarization to M1 macrophages and M2 macrophages, inducing macrophages to produce pro-inflammatory factors, and enhancing macrophage phagocytosis. The present invention provides a new method for inducing macrophage polarization, promoting macrophages to produce pro-inflammatory cytokines, and promoting macrophage phagocytosis, and provides new ideas for the new function and application of nicotine, a tobacco active ingredient. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 Nicotine induces macrophage polarization to M1 and M2 macrophages; A in the figure uses CD11c as a surface marker for M1 macrophages; B uses CD206 as a surface marker for M2 macrophages; C uses the positive control LPS (1 μg / mL) that induces M1 polarization to treat macrophages; D uses the positive control IL-4 / IL-10 (both 20 ng / mL) that induces M2 polarization to treat macrophages.

[0040] Figure 2 Nicotine induces macrophages to produce pro-inflammatory cytokines; A in the figure is the TNF-α mRNA level; B is the IL-6 mRNA level.

[0041] Figure 3 Nicotine treatment enhances cell phagocytosis; Figure A shows red fluorescent labeled latex beads and macrophages under transmitted light; and Figure B shows the statistical proportion of cells that phagocytize different latex beads. DETAILED DESCRIPTION

[0042] In order to make the purpose, technical scheme and advantages of the embodiments of the present invention clearer, the technical scheme in the embodiments of the present invention will be clearly and completely described below. If the specific conditions are not specified in the embodiments, they are carried out according to the normal conditions or the conditions recommended by the manufacturer. If the manufacturer is not specified in the reagents or instruments used, they are all conventional products that can be purchased commercially. The features and performance of the present invention are further described in detail below in conjunction with the embodiments.

[0043] Example 1 Nicotine induces macrophage polarization

[0044] In this example, primary mouse bone macrophages isolated from C57BL / 6 were treated with nicotine (10 μM) for 24 hours and then detected by flow cytometry. The specific operation is as follows:

[0045] Isolation and culture of primary bone macrophages from mice: 1) The mice were killed by dislocation and soaked in alcohol for 5 minutes for disinfection. 2) A small incision was made on the back skin and the skin was torn off. The femur and tibia of the mouse were found, the entire hind limb was cut off, and the muscles were removed. 3) The treated femur and tibia were placed in 75% alcohol for disinfection, and a 3.5 cm culture dish was added with PBS solution, and the treated femur and tibia were washed twice in PBS. 4) The femur and tibia were separated, the two ends of the bones were cut off, 1 mL of culture medium was aspirated with a syringe, and the bone marrow was repeatedly washed and blown from one end of the bone for 3 times until the bone changed from the original red color containing bone marrow to colorless. 5) The culture medium and the bone marrow therein were aspirated and blown repeatedly until the bone marrow was blown and dispersed. 6) The culture medium containing bone marrow cells was filtered into a centrifuge tube through a 70 μm filter membrane. 7) The solution was centrifuged (1500 rpm, 15 min). The supernatant of the solution was discarded, and then 3 mL of red blood cell lysis solution was added to each tube and mixed. After standing for 5 minutes, centrifuge at 1500 rpm for 5 minutes. Repeat the above steps to obtain relatively pure bone macrophages. 8) Add 5 mL of DMEM medium containing 50 ng / mL M-CSF, 10% FBS and double antibody to the centrifuged cells and mix well. Take 20 μL of the solution containing bone macrophages and count under a microscope. 9) Adjust the cell density to 8×10 5 / mL, and the cells were cultured in a 10 cm culture dish. After 2 days, 50% of the medium of the bone macrophages was replaced, and after 4 days, 100% of the medium in the culture dish was replaced. After 7 days, the unpolarized macrophages (M0) can be used for experiments.

[0046] Nicotine treatment and polarization induction of macrophages: Macrophages were scraped and isolated 7 days later using a cell scraper and counted at 8×10 5 / mL plate, 1mL / 3.5cm dish. Nicotine (GLPBIO, GC14043-500) stock solution was diluted to 10μM with macrophage culture medium, hexamethylammonium bromide (Sigma, H0879-5G) was diluted to 10μM, LPS (Sigma, L2630-10MG) was diluted to 1μg / mL, IL-4 and IL-10 (MCE, HY-P7080, HY-P70517) were diluted to 20ng / mL, and added to the cells respectively, and cultured for 24h.

[0047] Flow cytometric analysis of macrophage surface marker proteins: Collect macrophages with a cell scraper, centrifuge the macrophages, discard the supernatant, wash the cells with PBS, and resuspend them in 1 mL of PBS. Count the cells and adjust the concentration to 1×10 6 cells / mL. Add 1 μL of dissolved CD11c-PE (M1 macrophage surface marker, Proteintech, PE-65130) or CD206-APC (M2 macrophage surface marker, Proteintech, APC-18704) dye to the cell suspension and mix well. Incubate on ice in the dark for 30 minutes. After staining, wash three times with 1 mL PBS and resuspend the cells in 900 μL PBS. Analyze on a flow cytometer. The horizontal axis is the name of the filter used for different fluorescence.

[0048] The results are as follows Figure 1As shown, A in the figure uses CD11c as a surface marker for M1 macrophages, and flow cytometry is used to detect the control (control, blue), 10μM nicotine treatment group (Nicotine, black) and 10μM nicotine superimposed on hexamethylammonium bromide treatment group (Nicotine+Hex, light blue). It can be seen that 48.8%, 81.7%, and 54.5% of the cells are polarized from the resting state M0 to M1 macrophages, respectively; B uses CD206 as a surface marker for M2 macrophages, and flow cytometry is used to detect the control (control, blue), 10μM nicotine treatment Group (Nicotine, black) and 10μM nicotine superimposed hexamethonium bromide treatment group (Nicotine+Hex, light blue), it can be seen that 41.9%, 73.9%, and 48.3% of the cells polarized from the resting state M0 to M2 macrophages, respectively; C is the treatment of macrophages with the positive control LPS (1μg / mL) that induces M1 polarization, and the M1 polarization ratio is 76.6%; D is the treatment of macrophages with the positive control IL-4 / IL-10 (both 20ng / mL) that induces M2 polarization, and the M2 polarization ratio is 72.7%. It shows that macrophages in the nicotine treatment group produce M1 and M2 directional polarization, express the corresponding cell surface markers CD11c and CD206, and the polarization can be inhibited by the N-type acetylcholine receptor inhibitor hexamethonium bromide (Hex) ( Figure 1 A and B in Figure 1). The effect of nicotine in promoting macrophages to express M1 and M2 surface specific receptors is similar to that of LPS (1 μg / mL) and IL-4 / IL-10 (both 20 ng / mL) ( Figure 1 C and D in ).

[0049] Example 2 Nicotine promotes macrophages to produce pro-inflammatory cytokines

[0050] Fluorescence quantitative PCR technology was used to detect macrophages treated with 10 μM nicotine for 24 hours. The specific steps are as follows:

[0051] Macrophage RNA extraction and reverse transcription: RNA was extracted using the trizol (Novozyme, R411-01) method, and the sample was rapidly lysed. After chloroform extraction, the supernatant (containing RNA) was taken, precipitated with isopropanol, and washed with ethanol to obtain total cell RNA. 1 μg was reverse transcribed into a cDNA library, and the reverse transcription kit was Yisheng 11139ES60. Subsequently, fluorescence quantitative PCR (qPCR) detection was performed, and the primers used were as shown in the following table, where GAPDH was the internal reference gene, and the primer information used is shown in Table 1.

[0052] Table 1 qPCR primer information

[0053] Primer name Primer sequence (5'→3') Serial Number TNF-α_F GCCTCTTCTCATTCCTGCTT SEQ ID NO.1 TNF-α_R TGGGAACTTCTCATCCCTTTG SEQ ID NO.2 IL-6_F TACCACTTCACAAGTCGGAGGC SEQ ID NO.3 IL-6_R CTGCAAGTGCATCATCGTTGTTC SEQ ID NO.4 GAPDH_F ACCACAGTCCATGCCATCAC SEQ ID NO.5 GAPDH_R TCCACCACCCTGTTGCTGTA SEQ ID NO.6

[0054] Note: "F" in the table represents forward primer; "R" represents reverse primer.

[0055] The results of the test are as follows Figure 2 As shown, nicotine-induced proinflammatory cytokines TNF-α and IL-6 were highly expressed, and the N-type acetylcholine receptor inhibitor hexamethonium bromide could completely inhibit their effects.

[0056] Example 3 Nicotine treatment enhances cellular phagocytosis

[0057] The core phagocytic function of macrophages treated with nicotine was detected using latex beads coated overnight with 100 μg / mL mouse IgG. The experimental steps are as follows:

[0058] Pretreatment of latex beads: 60 μL of latex beads (Polysciences, 17797-1, diameter 1.75 μm) were taken and divided into two groups: an experimental group and a control group. Endotoxin-free PBS solution containing mouse IgG was added to the experimental group, and 4 mL of PBS solution was added to 30 μL of latex beads in the control group. The mixture was mixed and incubated overnight at 4°C. The next day, the latex beads were removed, centrifuged, and washed with PBS containing 1% FBS. This was repeated 8 times. After each wash, the beads were centrifuged at 13,000 rpm for 3 minutes at 4°C.

[0059] Co-incubation of macrophages with latex beads: Take the cultured bone macrophages, wash them twice with benchtop solution, add 1 mL of benchtop solution to them, and place them on ice for 10 minutes. Add 1 mL of solution containing latex beads to the bone macrophages and incubate them on ice for 10 minutes. Transfer the culture dish containing bone macrophages and latex beads to a 37°C incubator and incubate for 20 minutes. After the incubation is completed, add 1 mL of benchtop solution to the culture dish, and then place it on a laser confocal microscope for confocal imaging. Laser confocal microscopy collects the fluorescence signal emitted by the latex beads, with an excitation wavelength of 543 nm and a collection wavelength greater than 550 nm.

[0060] The results of the test are shown in Figure 3 Nicotine can increase the ability of macrophages to phagocytize latex particles. The proportion of cells that phagocytized 0 or 1 latex beads in the nicotine-treated group was significantly reduced, while the proportion of cells that phagocytized more than 5 latex beads was significantly increased. This suggests that nicotine regulates macrophage function by affecting macrophage polarization and inducing the production of pro-inflammatory factors.

[0061] The above detailed description is a specific description of one of the feasible embodiments of the present invention, and the embodiment is not intended to limit the scope of the present invention. It should be pointed out that any equivalent implementation or change that does not deviate from the present invention should be included in the scope of the technical solution of the present invention. Therefore, the protection scope of the patent of the present invention shall be based on the attached requirements.

Claims

1. A method for promoting macrophage polarization using nicotine, characterized in that: The nicotine concentration is 10 μM; the promotion of macrophage polarization is to promote the polarization of macrophages into M1 macrophages and M2 macrophages.

2. The method according to claim 1, characterized in that The typing ratios of the M1 macrophages and the M2 macrophages were 81.7% and 73.9%.

3. The method according to claim 1, characterized in that The nicotine promotes the expression of pro-inflammatory cytokines in macrophages.

4. The method according to claim 1, characterized in that: The nicotine promotes macrophage phagocytosis.

5. A method for promoting macrophage polarization using a nicotine-containing drug, characterized in that: The concentration of nicotine in the drug is 10 μM; the promotion of macrophage polarization is to promote the polarization of macrophages into M1 macrophages and M2 macrophages.

6. The method according to claim 5, characterized in that In the medicine, nicotine is used as the only or main active ingredient in the preparation.

7. The method according to claim 5, characterized in that The medicine also includes other active ingredients, which include one or more of N-type acetylcholine receptor, LPS, IL-4, and IL-10.

8. The method according to claim 5, characterized in that The medicine is an anti-tumor medicine or an anti-autoimmune disease medicine.

9. The method according to claim 5, characterized in that The medicine also includes pharmaceutically acceptable excipients.

10. Use of nicotine in promoting macrophage polarization, characterized in that: The nicotine concentration is 10 μM; the promotion of macrophage polarization is to promote the polarization of macrophages into M1 macrophages and M2 macrophages.

Images