Phlorizin glycosylation genes and uses thereof

By regulating the expression of PGGT1.1 and PGGT1.2 genes in apple plants, the efficient catalytic synthesis and extraction of phlorizin 2'-O-xylose glucoside were achieved, solving the problem of the difficulty in separating phlorizin 2'-O-xylose glucoside from fruit and improving the separation efficiency and purity.

CN119639725BActive Publication Date: 2025-11-21NORTHWEST A & F UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411912555.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-24
Publication Date
2025-11-21
Estimated Expiration
2044-12-24

AI Technical Summary

Technical Problem

Existing technologies make it difficult to efficiently separate and extract phlorizin 2'-O-xylose glucoside, which is present in low amounts in apple fruits. Separation is challenging, and the high sugar content in the fruit further complicates the process.

Method used

By mining and regulating the expression or enzyme activity of PGGT1.1 and PGGT1.2 genes in Malus plants, glycosylation of phlorizin to generate phlorizin 2'-O-xylose glucoside was achieved, and the glycosylation and extraction were efficiently catalyzed in plant leaves using recombinant vectors and recombinant cells.

Benefits of technology

It significantly increased the content of phlorizin 2'-O-xyloside, simplified the separation and extraction process, and improved separation efficiency and purity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119639725B_ABST
    Figure CN119639725B_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of plant genetic engineering, and specifically discloses a phloridzin glycosylation protease, a gene and application thereof. The application obtains glycosyltransferase genes PGGT1.1 and PGGT1.2 for synthesizing phloridzin 2'-O-xylose glucoside through phloridzin glycosylation. By overexpressing PGGT1.1 and PGGT1.2 in plants, the content of phloridzin 2'-O-xylose glucoside in the leaves of the plants is obviously increased, thereby facilitating the biosynthesis and separation and extraction of phloridzin 2'-O-xylose glucoside.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of plant genetic engineering, and particularly relates to a phloridzin glycosylation gene and a method and application for efficiently catalyzing phloridzin glycosylation to synthesize phlorizin 2'-O-xylosylglucoside. BACKGROUND

[0002] Phloridzin is accumulated in the roots, stems, leaves, flowers and fruits of plants, especially apple plants. In apple leaves, the content of phloridzin accounts for more than 90% of the total phenol content. Due to the large and wide accumulation of phloridzin in apple leaves, it is relatively easy to separate and purify. Phlorizin 2'-O-xylosylglucoside is only accumulated in fruits, but due to the high sugar content in fruits, the difficulty of separating and extracting phlorizin 2'-O-xylosylglucoside is increased. Therefore, it is very necessary to identify a glycosyltransferase with high catalytic activity to synthesize phlorizin 2'-O-xylosylglucoside.

[0003] In view of this, the present application is proposed. SUMMARY

[0004] In view of the above technical problems, the present application finds through gene mining and research that PGGT1.1 and PGGT1.2 can glycosylate phloridzin to generate phlorizin 2'-O-xylosylglucoside. The present application also finds that for different tissues of plants, it is easier to separate and extract phlorizin 2'-O-xylosylglucoside from leaves than from fruits. Therefore, by regulating the expression or enzyme activity of PGGT1.1 and PGGT1.2 to glycosylate phloridzin to generate phlorizin 2'-O-xylosylglucoside, the present application has important application value for separating and extracting phlorizin 2'-O-xylosylglucoside.

[0005] The present application specifically provides the following technical solutions:

[0006] The present application first provides a protease, wherein the gene encoding the protease is located at chr10: 16473722-16475131 (gene number MD10G1211400) or chr15: 16963589-16966336 (gene number MD15G1101200) of the reference genome GDDH13v1.1.

[0007] Further, the protease is from the genus Malus; preferably, the protease is from Malus xiaojinensis, Malus xiaozhizhong or Malus xiaozhonghong.

[0008] In some specific modes, the protease has an amino acid sequence as shown in any one of SEQ ID NO. 6-10, or has an amino acid sequence with at least 95% homology to any one of SEQ ID NO. 6-10.

[0009] In some more specific ways, the protease of the present application further comprises: the protease as shown in SEQ ID NO. 6, and 96Glu of SEQ ID NO. 6 is replaced by 96Asp; preferably, 125Glu, 334Ala or 424Gln of SEQ ID NO. 6 is further replaced by 125Gln, 334Val or 424Arg, respectively.

[0010] In some more specific ways, the protease of the present application further comprises: the protease as shown in SEQ ID NO. 6, and 96Glu of SEQ ID NO. 6 is replaced by 96Asp; preferably, 125Glu, 334Ala or 424Gln of SEQ ID NO. 6 is further replaced by 125Gln, 334Val or 424Arg, respectively.

[0011] The present application also provides a phlorizin glycosylation gene, which encodes the protease as described above.

[0012] In some ways, the phlorizin glycosylation gene has at least 95% homology with SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4 and SEQ ID NO. 5; preferably, as shown in SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4 and SEQ ID NO. 5.

[0013] In some ways, the phlorizin glycosylation gene is derived from Malus.

[0014] Further, the phlorizin glycosylation gene can be applied to the biosynthesis and separation and extraction of phloretin 2'-O-xylosylglucoside.

[0015] The present application also provides a recombinant vector comprising the nucleic acid sequence of the phlorizin glycosylation gene as described above.

[0016] In some ways, the vector is an expression vector.

[0017] In some preferred ways, the expression vector comprises a prokaryotic expression vector or a eukaryotic expression vector.

[0018] In some specific preferred ways, the expression vector comprises, but is not limited to, a prokaryotic expression vector Pet28a or an overexpression vector pCambia 2300.

[0019] The present application also provides a recombinant cell or a recombinant microorganism comprising the recombinant vector as described above.

[0020] In some specific ways, the recombinant cell or the recombinant microorganism is Escherichia coli BL21 (DE3) or Agrobacterium GV3101.

[0021] The present application also provides any one of the following applications of the above-mentioned genes:

[0022] 1) application in synthesizing phloretin 2'-O-xylosylglucoside;

[0023] 2) application in isolating and extracting phloretin 2'-O-xylosylglucoside.

[0024] Further, the synthesis includes catalytic synthesis or biosynthesis, etc.

[0025] The present application also provides a method for isolating and extracting phloretin 2'-O-xylosylglucoside, which comprises the above-mentioned biosynthesis step, and further comprises a step of isolating and extracting phloretin 2'-O-xylosylglucoside from plant leaves.

[0026] In some modes, the above-mentioned plant includes but is not limited to Malus.

[0027] Compared with the prior art, the present application has at least the following advantages:

[0028] 1) The present application finds that phloroside glycosylation genes PGGT1.1 and PGGT1.2 can glycosylate phloroside into phloretin 2'-O-xylosylglucoside.

[0029] 2) The present application stably expresses phloroside glycosylation genes PGGT1.1 and PGGT1.2 in apples, and the content of phloretin 2'-O-xylosylglucoside in overexpression transgenic plants is significantly increased, which has important application value for isolating and extracting phloretin 2'-O-xylosylglucoside. BRIEF DESCRIPTION OF DRAWINGS

[0030] In order to more clearly illustrate the technical solutions in the specific embodiments or prior art of the present application, the following will briefly introduce the drawings needed to be used in the description of specific embodiments or prior art. Obviously, the drawings in the following description are some embodiments of the present application, and other drawings can also be obtained by those skilled in the art without creative labor.

[0031] Figure 1 Intersection of Set 1-10 different genes described in Example 1;

[0032] Figure 2 Gene expression heat map of PGGT1.1 and PGGT1.2 in different tissues of Malus halliana described in Example 1;

[0033] Figure 3 Gene expression heat map of PGGT1.1 and PGGT1.2 in 6 germplasm resources fruits and leaves described in Example 1;

[0034] Figure 4 The in vitro enzyme activity detection structures of the recombinant proteins PGGT1.1 and PGGT1.2 described in Example 1 are shown.

[0035] Figure 5 The amino acid sequence alignment results of PGGT1.1 and PGGT1.2 of Golden Crown (Md), Malus spectabilis (Mm), and Malus floribunda (Mw) described in Example 2;

[0036] Figure 6 The results of in vitro enzyme activity detection of the mutant MdPGGT1.1 and MdPGGT1.2 recombinant proteins described in Example 2;

[0037] Figure 7 The results are the detection results of RNA levels in the PGGT overexpressing transgenic lines described in Example 3;

[0038] Figure 8 The content of phlorizin and phlorizin 2'-O-xylose glucoside in the leaves of the PGGT overexpressing transgenic line described in Example 3;

[0039] Figure 9 The purity of phloretin 2'-O-xylose glucoside described in Example 4;

[0040] Figure 10 The results of the detection of root cortexin 2'-O-xylo-glucoside after transient expression of the PGGT gene of Malus spectabilis, Malus spectabilis and Malus crassifolia in tobacco leaves as described in Example 5;

[0041] Figure 11 The content of root cortexin 2'-O-xyloside after transient expression of the PGGT gene of Golden Delicious, Malus spectabilis and Malus baccata in tobacco leaves as described in Example 5. Detailed Implementation

[0042] While this application can be implemented in many different forms, what is disclosed herein are specific illustrative embodiments that validate the principles of this application. It should be emphasized that this application is not limited to the specific embodiments illustrated herein. Furthermore, any section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter. The following terms or definitions are provided merely to aid in understanding this application. These definitions should not be construed as having a scope less than that understood by those skilled in the art.

[0043] Unless otherwise defined below, all technical and scientific terms used in the specific embodiments of this application are intended to have the same meaning as commonly understood by those skilled in the art. While it is believed that the following terms will be well understood by those skilled in the art, the following definitions are set forth to better explain this application.

[0044] The terms "comprising", "containing", "having" "including", or "involving" are to be construed as inclusive or open-ended and do not exclude additional, unrecited elements or method steps. The term "consisting of is to be construed as a preferred embodiment of the term "comprising". If a group of items, definitions or embodiments are disclosed as comprising at least one of a list of elements having the term "comprising", it is understood that each individual item, definition or embodiment is also disclosed as a possible group of the list of elements.

[0045] The indefinite articles "a" or "an", as used herein in a specification or in claims are each considered to be equivalent to the term "at least one", unless the context clearly indicates otherwise.

[0046] Furthermore, the terms first, second, third, (a), (b), (c), and the like as used in the specification and claims, are used as names for similar elements, and do not necessarily have an ordinal or chronological significance. It is to be understood that the terms so used are interchangeable under appropriate circumstances and that the embodiments of the application described herein are capable of functioning in other sequences than the one(s) explicitly described or illustrated.

[0047] The term "and / or", as used in a phrase such as "A and / or B" is intended to cover the interpretation that A and B are either both present or only one of the features is present. Thus, as used in a phrase such as "A, B, and / or C" the term "and / or" is intended to cover the interpretation that A, B, and C are either all present or any combination of A, B, and C is present.

[0048] The terms "for example" and "e.g." are used herein to mean "for the purpose of illustration" and are not to be construed as limiting the application in any way.

[0049] The terms "about", "substantially" mean an interval that a person of skill in the art is understood to appreciate as a reasonable amount of deviation from a stated value. Typically, the term "about" denotes an interval of ±10%, preferably ±5% from a stated value.

[0050] As used herein, the singular forms "a", "an" and "the" include plural referents unless the context clearly dictates otherwise.

[0051] Detailed technical solutions of the present application:

[0052] The protease protected by the present application is a protease whose encoding gene is the gene located at chr10: 16473722-16475131 of the reference genome GDDH13 vl. l (gene number MD10G1211400) or chr15: 16963589-16966336 (gene number MD15G1101200).

[0053] In particular, the protease is from the genus Malus; in some specific embodiments, from Malus coronaria, Malus xiaozhizhong or Malus xiaozhong.

[0054] The present application proves by examples that the protease sequence can realize the change of catalytic activity by mutation, such as when Glu96 in MdPGGT1.1 (SEQ ID NO. 6) is replaced by Asp96 in MdPGGT1.2 (SEQ ID NO. 7), or Asp96 in MdPGGT1.2 (SEQ ID NO. 7) is replaced by Glu96 in MdPGGT1.1 (SEQ ID NO. 6), the activities of the two proteins will also be exchanged, that is, the mutated MdPGGT1.1 (SEQ ID NO. 6) obtains the activity of glycosylated phloridzin, while the mutated MdPGGT1.2 (SEQ ID NO. 7) loses the activity of glycosylated phloridzin. When Glu125, Ala334 and Gln424 in MdPGGT1.1 (SEQ ID NO. 6) are replaced by Gln125, Val334 and Arg424 in MdPGGT1.2 (SEQ ID NO. 7) respectively, or Gln125, Val334 and Arg424 in MdPGGT1.2 (SEQ ID NO. 7) are replaced by Glu125, Ala334 and Gln424 in MdPGGT1.1 (SEQ ID NO. 6) respectively, the activities of the two proteins will not change.

[0055] Therefore, the active protease of the present application is Asp at the 96th amino acid encoded by the above reference sequence, at this time, the protease has the corresponding catalytic activity, and the mutation at 125th, 334th or 424th position does not affect the activity.

[0056] In some specific embodiments of the present application, the sequence of the protease can be an amino acid sequence as shown in any one of SEQ ID NO. 6-10, or an amino acid sequence with at least 95% homology to any one of SEQ ID NO. 6-10.

[0057] In some more specific embodiments, the protease of the present application further comprises: the protease as shown in SEQ ID NO. 6, and 96Glu of SEQ ID NO. 6 is replaced by 96Asp; in some preferred embodiments, 125Glu, 334Ala or 424Gln of SEQ ID NO. 6 is further replaced by 125Gln, 334Val or 424Arg, respectively.

[0058] In some more specific embodiments, the protease of the present application further comprises: the protease as shown in SEQ ID NO. 6, and 96Glu of SEQ ID NO. 6 is replaced by 96Asp; in some preferred embodiments, 125Glu, 334Ala or 424Gln of SEQ ID NO. 6 is further replaced by 125Gln, 334Val or 424Arg, respectively.

[0059] It can be understood that the above specific protein sequences do not limit the present application, and it has been verified and confirmed in the embodiments of the present application that, through mutation tests from multiple sequences, the nucleic acid sequence at the position corresponding to the reference genome GDDH13 v1.1 chr10: 16473722-16475131 or chr15: 16963589-16966336 has phloridzin glycosylation activity of catalyzing phloridzin to synthesize phloridzin 2'-O-xylose glucoside when the corresponding protein is translated and the 96th position of the corresponding protein is Asp.

[0060] The gene of the present application, which encodes any of the above-mentioned proteases.

[0061] In some embodiments, the phloridzin glycosylation gene has at least 95% homology with SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4 and SEQ ID NO. 5; in some preferred embodiments, the phloridzin glycosylation gene is as shown in SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4 and SEQ ID NO. 5.

[0062] In some embodiments, the phloridzin glycosylation gene is derived from Malus; in some specific embodiments, it is derived from Malus coronaria, Malus xiaofu or Malus x domestica cv. Donghong, etc. Further, the phloridzin glycosylation gene can be applied to the biosynthesis and separation and extraction of phloridzin 2'-O-xylose glucoside.

[0063] The recombinant vector of the present application, which comprises the nucleic acid sequence of any of the above-mentioned phloridzin glycosylation genes.

[0064] In some embodiments, the vector is an expression vector. In some preferred embodiments, the expression vector comprises a prokaryotic expression vector or a eukaryotic expression vector; in some specific embodiments, the expression vector comprises, but is not limited to, prokaryotic expression vector Pet28a or overexpression vector pCambia 2300.

[0065] The recombinant cell or the recombinant microorganism of the present application comprises the recombinant vector as described above. In some specific embodiments, the recombinant cell or the recombinant microorganism is Escherichia coli BL21 (DE3) or Agrobacterium GV3101.

[0066] The application of the present application comprises the application of the above-mentioned protease or gene in the following aspects:

[0067] 1) in the synthesis of phloretin 2'-O-xylosylglucoside;

[0068] 2) in the isolation and extraction of phloretin 2'-O-xylosylglucoside.

[0069] Further, the synthesis comprises catalytic synthesis or biosynthesis, etc.

[0070] The method for biosynthesizing phloretin 2'-O-xylosylglucoside of the present application comprises the step of overexpressing the phloroside glycosylation gene; preferably, the overexpression is derived from eukaryotic expression or prokaryotic expression; more preferably, the expression is in a plant body, including but not limited to apple tree plants or Nicotiana, etc.

[0071] It can be understood that the protease after eukaryotic expression in apple and tobacco has been proved in the embodiments of the present application to be able to catalyze the synthesis of phloretin 2'-O-xylosylglucoside in a plant body. Therefore, the biosynthesis of phloretin 2'-O-xylosylglucoside is not limited to a plant host, as long as the substrates phloridzin and UDP-xylose exist (endogenous or exogenous injection, etc.), the corresponding catalytic synthesis can be realized, and the biosynthesis method of the present application is not limited to a plant body.

[0072] The method for isolating and extracting phloretin 2'-O-xylosylglucoside of the present application comprises the above-mentioned biosynthesis step, and further comprises the step of isolating and extracting phloretin 2'-O-xylosylglucoside from a plant leaf. Preferably, the above-mentioned plant refers to apple in particular.

[0073] The following are specific embodiments.

[0074] Embodiment 1, screening of phloridzin glycosylation gene and in vitro catalytic synthesis of phloretin 2'-O-xylosylglucoside

[0075] Based on the characteristics of the specific accumulation of phloretin 2'-O-xylosylglucoside in fruits, in order to mine the key glycosyltransferase gene of phlorizin glycosylation to synthesize phloretin 2'-O-xylosylglucoside, the applicant carried out transcriptome sequencing on the leaves and fruits of different germplasm resources of Malus (‘Golden Delicious’, Malus honanensis, Malus yunnanensis, Malus prattii, Malus halliana and Malus sieboldii) and different tissues (roots, bark, fruits, leaves and petals) of Malus ‘Winter Red’. The transcriptome results were divided into 10 groups, Set 1-6 were ‘Golden Delicious’, Malus honanensis, Malus yunnanensis, Malus prattii, Malus halliana and Malus sieboldii fruit vs leaf, Set 7-10 were Malus ‘Winter Red’ fruit vs petal, leaf, bark and root. The differential genes of each group were screened with padj<0.05, |log2FoldChange|>2, the intersection of the differential genes of Set 1-10 contained 110 genes ( Figure 1 ). Among them, two glycosyltransferase genes were named PGGT1.1 (MD10G1101200) and PGGT1.2 (MD15G1211400). The expression levels of these two genes in the fruits of ‘Golden Delicious’, Malus honanensis, Malus yunnanensis, Malus prattii, Malus halliana and Malus sieboldii were higher than those in the leaves ( Figure 2 ), and the expression levels in the fruits of Malus ‘Winter Red’ were high, while the expression levels in other tissues were very low or even not expressed ( Figure 3 ).

[0076] The fruits of Malus ‘Golden Delicious’, Malus prattii and Malus ‘Winter Red’ were collected, frozen quickly with liquid nitrogen, and the RNA was reverse transcribed into cDNA. The primers PGGT-F: ATGGAGCGCAAAGATGAGAAGA and PGGT-R: TTAAGTTGAAGCGGGCCAAGTTTC were designed to amplify the target gene PGGT, and the cDNA of ‘Golden Delicious’, Malus prattii and Malus ‘Winter Red’ fruits were used as templates for amplification and connected to the PMD-19T (Takara) vector for sequencing, obtaining five sequences.

[0077] The gene sequence of the obtained gold crown MdPGGT1.1 is shown in SEQ ID NO. 1, and the sequence corresponds to chr10: 16473722-16475131 (gene number MD10G1211400) of the gold crown reference genome GDDH13 v1.1. The encoded amino acid sequence has 95% amino acid similarity with MmPGGT1.1 of Malus xiaozhuetanensis and 96% amino acid similarity with MwPGGT1.1 of Malus xiaozhuetanensis.

[0078] The obtained gold crown MdPGGT1.2 is consistent with the gene sequence of MmPGGT1.2 of Malus xiaozhuetanensis, as shown in SEQ ID NO. 2, and the sequence corresponds to chr15: 16963589-16966336 (gene number MD15G1101200) of the gold crown reference genome GDDH13 v1.1. The encoded amino acid sequence has 96% amino acid similarity with MwPGGT1.2 of Malus xiaozhuetanensis.

[0079] Specifically, the gene sequences of MdPGGT1.1, MdPGGT1.2 / MmPGGT1.2, MmPGGT1.1, MwPGGT1.1, and MwPGGT1.2 are shown in SEQ ID NO. 1-5, respectively, and the encoded amino acid sequences of MdPGGT1.1, MdPGGT1.2 / MmPGGT1.2, MmPGGT1.1, MwPGGT1.1, and MwPGGT1.2 are shown in SEQ ID NO. 6-10, respectively.

[0080] Further, the CDS full-length sequence of the PGGT gene is connected to the Pet28a vector by the method of one-step cloning (Vazyme non-enzyme-dependent single-fragment rapid cloning kit), transformed into the Escherichia coli BL21 (DE3) strain, the positive colonies are activated and induced with 0.8 mM IPTG for 24 h (18℃, 120 rpm), the supernatant is removed by centrifugation of the bacterial solution, resuspended with buffer (50 mM NaH2PO4, 30 mM NaCl, 20 mM imidazole, pH 8.0 adjusted with NaOH), and then 2 mg L -1 of lysozyme is added, incubated at 37℃ for 30 min, frozen and thawed in liquid nitrogen for 3 times, centrifuged at 4℃, 12000g for 10 min, and the supernatant is used for enzyme activity detection. The final concentration of the substrate phlorizin and UDP-xylose is 0.5 mM in the enzymatic reaction solution, the enzyme solution is 100 μl, and 50 mM Tris-HCl (pH 8.5) is 90 μl. After mixing the components, incubate at 37℃ for 20 min, add 10 μl of 30% TCA to terminate the reaction, and then centrifuge and filter the reaction solution. The product phlorizin 2'-O-xylose glucoside is detected by high performance liquid chromatography analysis.

[0081] The results show that MdPGGT1.2 / MmPGGT1.2 of Jinchuan and Xifuhong, MmPGGT1.1 of Xifuhong and MwPGGT1.1 and MwPGGT1.2 of Donghong have the activity of catalyzing the synthesis of phlorizin 2'-O-xylosylglucoside from phlorizin and UDP-xylose in vitro, but MdPGGT1.1 of Jinchuan does not have the catalytic activity. Figure 4

[0082] Example 2, mutation experiment

[0083] The amino acid sequences of PGGT1.1 and PGGT1.2 amplified from Jinchuan, Donghong and Xifuhong with the catalytic activity of phlorizin glycosylation and MdPGGT1.1 of Jinchuan without the catalytic activity are aligned, and it is found that there are 4 amino acid differences between the sequences with catalytic activity and the sequences without catalytic activity, which correspond to Glu96, Glu125, Ala334, Gln424 in MdPGGT1.1 (corresponding to the positions of 16474009-16474011, 16474094-16474096, 16474722-16474724, 16474992-16474994 on chromosome 10 of the reference genome GDDH13 v1.1) and Asp96, Gln125, Val334, Arg424 in MdPGGT1.2. Figure 5 ) corresponding to the positions of 16963876-16963878, 16963961-16963963, 16964589-16964591, 16964859-16964861 on chromosome 15 of the reference genome GDDH13 v1.1.

[0084] After mutating the 4 amino acids, the enzyme activity determination results show that when Glu96 in MdPGGT1.1 is replaced by Asp96 in MdPGGT1.2 or Asp96 in MdPGGT1.2 is replaced by Glu96 in MdPGGT1.1, the activities of the two proteins will also be exchanged, that is, the mutated MdPGGT1.1 obtains the activity of glycosylated phlorizin, and the mutated MdPGGT1.2 loses the activity of glycosylated phlorizin. When Glu125, Ala334 and Gln424 in MdPGGT1.1 are replaced by Gln125, Val334 and Arg424 in MdPGGT1.2 respectively, or Gln125, Val334 and Arg424 in MdPGGT1.2 are replaced by Glu125, Ala334 and Gln424 in MdPGGT1.1 respectively, the activities of the two proteins will not change. Figure 6 ​), thus it can be seen that, in the case of other base sequences being consistent, the 96th amino acid plays a key role in the activity of glycosylated phloridzin.

[0085] Example 3, Genetic transformation of apple to obtain overexpression transgenic lines

[0086] Construction of overexpression vector: the full-length sequence of the CDS of the PGGT gene was connected to the pCambia 2300 vector by one-step cloning (Vazyme non-enzyme-dependent single-fragment rapid cloning kit), and the target gene was transcribed by the 35S promoter. The target gene PGGT was overexpressed in GL-3 apple seedlings by Agrobacterium-mediated leaf disc transformation.

[0087] The results show that, compared with the wild type, the target gene in the 6 PGGT overexpression lines is up-regulated at the RNA level Figure 7 ), and the content of phloretin 2'-O-xyloside is significantly increased, about 20 mg g -1 FW Figure 8 ).

[0088] Example 4, Isolation and extraction of phloretin 2'-O-xyloside

[0089] Phloretin 2'-O-xyloside was isolated and extracted from the overexpression PGGT transgenic leaves, and the extraction process included five main steps of immersion, extraction (petroleum ether and ethyl acetate), polyamide column chromatography, dextran gel Sephadex LH-20 column chromatography, concentration and crystallization, and phloretin 2'-O-xyloside with a purity of >98% was obtained Figure 9 ). Because the sugar content in the leaves is low, phloridzin can be extracted into the ethyl acetate phase during ethyl acetate extraction, while phloretin 2'-O-xyloside remains in the water phase, greatly reducing the difficulty of separation of phloretin 2'-O-xyloside.

[0090] Example 5, Tobacco transient expression synthesis of phloretin 2'-O-xyloside

[0091] The applicant also transiently expressed PGGT1.1 and PGGT1.2 genes of Jinguang, Xifuhong and Donghong in Nicotiana benthamiana. After injecting the substrate phloridzin, compared with the empty vector, the tobacco leaves transiently expressing PGGT1.2 detected the generation of the product phloretin 2'-O-xyloside, while the tobacco leaves transiently expressing Jinguang MdPGGT1.1 did not detect the compound (see Figure 10-11 ).

[0092] From the above experiments, it can be seen that the series of glycosyltransferase genes PGGT1.1 and PGGT1.2 and the encoded proteases thereof screened by the present application have high catalytic activity of phlorizin and UDP-xylose, and can be used in the biosynthesis and separation and extraction application of phloretin 2'-O-xylose glucoside.

[0093] The foregoing description of specific exemplary embodiments of the application has been presented for the purposes of illustration and description. It is not intended to be exhaustive or to limit the application to the precise form disclosed, and obviously many modifications and variations are possible in light of the above teaching. It is intended that the scope of the application be limited not with this detailed description, but rather by the claims appended hereto.

Claims

1. A protease characterized in that, the protease sequence is as in SEQ ID NO. 6 with the substitution of Asp at position 96; 2. A phloridzin glycosylation gene, characterized in that, the gene encodes the protease of claim 1.

3. A recombinant vector, characterized in that, comprising the phloridzin glycosylation gene of claim 2.

4. A recombinant cell, characterized in that, comprising the recombinant vector of claim 3, wherein the recombinant cell is not a plant cell.

5. Use of a protease for catalyzing the synthesis of phloridzin to phloridzin 2'-O-xylosylglucoside, characterized in that, the protease is any one of: 1) the protease sequence is as in SEQ ID NO. 6 with the substitution of Asp at position 96; 2) the protease sequence is as in any one of SEQ ID NO. 7-10; 3) the protease sequence is as in SEQ ID NO. 7 with the substitution of Glu at position 125; 4) the protease sequence is as in SEQ ID NO. 7 with the substitution of Ala at position 334; 5) the protease sequence is as in SEQ ID NO. 7 with the substitution of Gln at position 424.

6. A method of biosynthesizing phloretin 2'-O-xylosylglucoside, characterized by, comprising the step of overexpressing in a plant a phloridzin glycosylation gene; the phloridzin glycosylation gene encodes a protease; the protease catalyzes the synthesis of phloridzin to phlortin 2'-O-xylosylglucoside; the protease is any one of: 1) the protease sequence is as in SEQ ID NO. 6 with the substitution of Asp at position 96; 2) the protease sequence is as in any one of SEQ ID NO. 7-10; 3) the protease sequence is as in SEQ ID NO. 7 with the substitution of Glu at position 125; 4) the protease sequence is as in SEQ ID NO. 7 with the substitution of Ala at position 334; 5) the protease sequence is as in SEQ ID NO. 7 with the substitution of Gln at position 424.

7. A method for isolating phloretin 2'-O-xylosylglucoside, characterized by, comprising the method of claim 6, and further comprising the step of isolating phlortin 2'-O-xylosylglucoside from the leaves of the plant.